PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Methods Enzymol. Author manuscript; available in PMC 2012 December 21.
Published in final edited form as:
PMCID: PMC3528079
NIHMSID: NIHMS293323
Assessing Constitutive Activity of Extracellular Calcium-Sensing Receptors In Vitro and in Bone
Wenhan Chang, Melita Dvorak, and Dolores Shoback
Endocrine Research Unit, Department of Veterans Affairs Medical Center, Department of Medicine, University of California, San Francisco, California, USA
Constitutive activity of the extracellular calcium-sensing receptor (CaSR) has been studied in kindreds with the human disorder autosomal dominant hypocalcemia (ADH) and in an animal model called the Nuf mouse. These families generally showed reduced parathyroid hormone (PTH) secretion and excessive renal calcium (Ca2+) excretion. Soft tissues calcifications in the kidney and basal ganglia are frequent (10–50% of ADH cases), and there is a single report of skeletal abnormalities in a family resulting in short stature and premature osteoarthritis. In the latter, a causative mechanism could not be determined. The phenotype of the Nuf mouse is one of ectopic calcifications and cataracts in addition to biochemical abnormalities (low serum Ca2+ and high serum phosphate concentrations). To better understand the role of CaSRs in the control of osteoblastic function, we generated a transgenic mouse model with constitutively active CaSRs in mature osteoblasts. An analysis of the skeletal phenotype of that mouse indicates that strong signaling by CaSRs in this cell lineage induces alterations in the bone homeostasis reflected in mild osteopenia in male and female mice during growth and in adulthood. These studies indicate that this approach can be readily adapted to assess CaSR actions in other cell systems.
Studying the relationship between the serum [Ca2+] and parathyroid hormone (PTH) gave rise to the concept of a membrane mechanism for mediating sensing changes in the extracellular Ca2+ concentration ([Ca2+]e). Small increases in the [Ca2+]e within the physiological range inhibit PTH secretion and cell proliferation. These events are transduced via multiple G protein-mediated signaling pathways, including the stimulation of phospholipase C, A2, and D (PLC, PLA2, and PLD) activities, intracellular Ca2+ release, and mitogen-activated protein (MAP) kinase activity. High [Ca2+]e also inhibit adenylate cyclase activity in acutely dispersed bovine parathyroid cells (PTCs; Hofer and Brown, 2003). Cloning of the extracellular calciumsensing receptor (CaSR) cDNA from bovine parathyroid glands (PTGs) established the molecular basis for extracellular Ca2+-sensing. When expressed in exogenous cell systems after cDNA transfection, CaSRs couple minute changes in [Ca2+]e, in the sub-millimolar range, to signaling cascades similar to those in PTCs (Brown et al., 1993).
Generalized or conditional knockout in PTCs of the Casr gene produces hypercalcemia and hyperparathyroidism (HPT) in mice due to the inability of the cells to respond to elevated serum [Ca2+] (Ho et al., 1995). In humans, activating and inactivating CaSR mutations induce hypocalcemia and hypercalcemia, respectively. PTH levels are low (or inappropriately normal) in patients with activating mutations and high (or inappropriately normal) in patients with inactivating mutations (Egbuna and Brown, 2008). These observations clearly support the critical functional role of the CaSR in mediating Ca2+-sensing and secretion in PTCs. The phenotype of the global CaSR knockout mouse and these genetic disorders of Ca2+-sensing further establish the central role of the CaSR in renal Ca2+ handling. Inactivating mutations in the CaSR are associated with hypocalciuria, while activating mutations are accompanied by often profound hypercalciuria.
A mouse model of Casr activation has suggested potential roles for activated CaSRs in vivo. The Nuf model comprises Nuf/+ (heterozygous) and Nuf/Nuf (homozygous) mice with one or both Casr alleles carrying a substitution of Leu at position 723 with Gln, respectively (Hough et al., 2004). Nuf/Nuf mice demonstrate severe hypocalcemia, hyperphosphatemia, and low PTH levels. These animals also manifest sudden death, cataracts, and ectopic calcifications throughout its tissues. An elevated Ca × phosphate product may be responsible for these calcifications, or alternatively, excessive and uncontrolled CaSR signaling may produce these pathologic soft tissue calcifications. Families with heterozygous activating CaSR mutations also show basal ganglia and renal calcifications which may be due to the same factors. These observations shed light on the phenotype of global CaSR activation but do address the role of CaSRs in specific tissues.
CaSRs are broadly expressed in tissues outside the PTG, including bone, cartilage, brain, kidney, skin, breast, gastrointestinal tract, and smooth and cardiac muscle. Understanding the role of CaSRs in these tissues using generalized CaSR knockout mice (CaSR+/− or CaSR −/−) is challenging. At baseline, these mice have chronic mild to severe HPT (Ho et al., 1995). Their HPT obscures the role of CaSRs in tissues like bone and cartilage because high PTH levels can affect those target organs. Assessment of CaSR functions selectively in these and other tissues is now feasible, owing to a newly developed floxed CaSR mouse model (Chang et al., 2008). Using this mouse model, we demonstrated that CaSRs in osteoblasts and chondrocytes are critical regulators of skeletal development.
Based on its topology and sequence homology (Fig. 13.1), the CaSR is classified in family C of the G protein-coupled receptor (GPCR) superfamily. This receptor has a large extracellular domain (ECD, ≈600 amino acids), the classic seven-transmembrane domain (7-TMD, ≈250 amino acids), and a long carboxyl-terminal tail (C-tail, ≈200 amino acids) (Brown et al., 1993; Chang and Shoback, 2004; Hofer and Brown, 2003). The CaSR likely functions as a dimer (homo- or heterodimer) like other family C GPCRs. Both dimerization and glycosylation are critical steps for efficient cell-surface targeting and ligand binding to the receptor.
Figure 13.1
Figure 13.1
Topology of the bovine CaSR. The legend (lower left) shows symbols representing naturally occurring activating (gain-of-function) mutations causing ADH and inactivating (loss-of-function) mutations responsible for FBHH. Modified, with permission, from (more ...)
As a typical GPCR, the 7-TMD of the CaSR has three extracellular (EC1–3) and three intracellular (IC1–3) loops that are responsible for transducing the extracellular stimulus (after ligand binding) into intracellular signals by interacting with different G-protein subunits (Gαq, Gαi, Gα11, Gβγ, etc.). Mutational analysis of CaSR mutants revealed amino acid residues in IC2 and IC3 that are critical for PLC signaling and efficient cell-surface expression of the receptor (Chang et al., 2000). Substitutions of specific residues in these receptor domains with alanine or nonconserved amino acids altered efficiency of the CaSR’s coupling to downstream effectors. Studies of CaSRs in which the carboxyterminal tail is either truncated or mutated revealed the importance of an alpha-helical structure in the N-terminus of the tail, for both signaling and cell-surface expression of the receptor (Chang et al., 2001). Others have shown that there is a filamin-A binding domain in the middle of the C-tail that is required for interaction with the cytoskeleton and for the formation of signaling complexes with other intracellular proteins (Hofer and Brown, 2003).
Family C GPCRs are thought to have evolved from the bacterial periplasmic proteins (PBPs) based on the homology of protein sequences in their ECDs. The PBPs contain a Venus Flytrap (VFT) domain that binds and transports nutrients such as Ca2+, Mg2+, and amino acids across the periplasm and the peptidoglycan mesh (Brown et al., 1993; Chang and Shoback, 2004; Hofer and Brown, 2003; Huang et al., 2009; Silve et al., 2005; Wellendroph and Brauner-Osborne, 2009). Crystallography and computer modeling reveal a VFT-like structure in the ECD of the CaSR (residues 1–540). The CaSR-VFT domain contains three Ca2+-binding sites that include several amino acids in the N-terminus of the ECD (between residues #100 and #300) (Fig. 13.1). The efficiency of Ca2+ binding to these sites depends on the overall tertiary structure of the ECD that is maintained by intra- and intermolecular disulfide bonding, interactions of hydrophobic and hydrophilic domains, and more importantly, local ionic strength. Any substitution of an amino acid residue within or adjacent to Ca2+-binding sites that alters the conformation of the ECD will likely alter the Ca2+ binding of the receptor. Furthermore, amino acids, aminoglycosides, polyamines, pH, and salinity, which alter local ionic strength, can also potentiate or suppress the response of receptor to Ca2+, potentially by altering the conformation of ECD and its affinity to Ca2+.
The biological significance of mutations in the CaSR is clearly demonstrated by three genetic disorders—familial benign hypocalciuric hypercalcemia (FBHH), neonatal severe HPT (NSHPT), and autosomal dominant hypocalcemia (ADH). Heterozygous and homozygous inactivating (loss-of-function) mutations produce FBHH and NSHPT, respectively, while activating (gain-of-function) mutations cause ADH (Egbuna and Brown, 2008; Huang et al., 2009; Pidasheva et al., 2004; http://www.casrdb.mcgill.ca). The majority of these naturally occurring mutations are found in the ECD of the CaSR (Fig. 13.1). In contrast, the Nuf mouse has mutations in a CaSR residue in the fourth transmembrane domain of the receptor (Hough et al., 2004). These CaSR mutations, in general, cause a shift (to the right for the inactivating mutations and to the left for the activating mutations) in their Ca dose–response curves when expressed in the exogenous cell systems, further underscoring the role of ECD in Ca2+-binding.
The above disorders predominantly affect parathyroid and renal function. The CaSR is, however, expressed in many other tissues, but it has been difficult to determine what role the CaSR plays in these tissues on the basis of these disease phenotypes. Growing interest has focused on exploring the functional impact of the CaSR in different systems using cultured cells. Many of these studies support a role for CaSRs in modulating distinct cell functions depending on the system. Translating the findings from in vitro studies to the biological actions of the CaSR in vivo has been challenging. To address this, we and others have begun to study gain-of-function and loss-of-function in mouse models. The tissue-specific, conditional knockout approach using Cre-lox recombination is being used to delete CaSRs from specific cell populations in vivo. Using another strategy, we have developed a transgenic mouse model with tissue-specific overexpression of the CaSR in mature osteoblasts to study the gain-of-function of CaSR signaling in this cell type. This report describes methods to generate mice that overexpress a constitutively active CaSR in mature osteoblasts to investigate the role of CaSR in bone remodeling.
2.1. Construction of activating CaSR mutant constructs
A pcDNA3.1 vector (Wt-CaSR/pcDNA3.1) containing a bovine CaSR cDNA was subjected to site-directed mutagenesis using Chameleon Mutagenesis Kit (Stratagene, La Jolla, CA) and a set of selection (5′-CCGCTGGAGAAGACGACAAT-3′) and mutagenic (5′-CCACCCTG AGTTTTGTG GCCCCGATCAAGATTGACCCTTTGAAGCTTGGTGAGTTCTGC A-3′) primers to make the Act-CaSR/pcDNA3.1 vector which encodes five point mutations [Q118P; N119I; S123P; N125K; and D127G] in the ligand-binding region of the receptor. This mutant was previously identified by Jensen et al. (2000) using a random saturation mutagenesis approach and shown to exert constitutive activity in transfected NIH-3T3 and tsA (a transformed HEK-293 cell) cell lines. Wt-CaSR/pcDNA3.1 and Act-CaSR/pcDNA3.1 vectors were amplified in TOP-10 Escherichia coli, purified using a Qiagen Maxi-Prep Kit (Qiagen, Valencia, CA), and stored in a sterile Tris–HCl buffer (10 mM, pH 8.5) at a concentration of 1 μg/μl.
2.2. Cell transfection
HEK-293 cells were cultured in T75 flasks containing growth medium (Dulbecco’s Minimal Essential Medium, containing 10% fetal calf serum and penicillin (100 U/ml) and streptomycin (100 μg/ml) at 37 °C in 5% CO2 until confluence). Confluent cells were split (1:6) into fresh T75 flasks containing 10 ml of growth medium, cultured for 4–6 h, and then transfected with CaSR cDNA using Ca–phosphate precipitation method (Chang et al., 2000, 2001). Ten micrograms of vector DNA was first mixed with 0.5 ml of 0.25 M CaCl2. The DNA/CaCl2 mixture was then added dropwise over 60 s to 0.5 ml of twofold concentrated HES buffer (in mM, 280 NaCl, 10 KCl, 1.5 NaH-PO4·2H2O, 12 dextrose, 50 HEPES (pH 7.5)) in a 15 ml test tube with gentle agitation by swirling the tube continually. The resulting mixture was incubated for 15 min at room temperature and then added to the culture flasks. After 18–24 h incubation at 37 °C in 5% CO2, transfected cells were trypsinized and plated into wells of a 6-well Falcon culture plate (Nunc, Rochester, NY). Cells from one T75 flask were dispensed into a total of 24 wells and cultured for 24–48 h before assays.
2.3. Inositol phosphate (InsP) assays
Transfected HEK-293 cells were prelabeled with [3H]myoinositol (2 mCi/ml; Amersham, Piscataway, NJ) for 18–24 h in the growth media (Chang et al., 2000, 2001). After three washes with fresh growth media, cells were pretreated with LiCl (to block Ins polyphosphate 1-phosphatase activity) in a MEM-LiCl solution [Eagle’s modified essential medium with Earle’s salts custom-prepared without CaCl2, MgSO4, and NaHCO3 and supplemented with 0.5 mM CaCl2, 0.5 mM MgSO4, and 10 mM LiCl] for 15 min at 37 °C. For experimental treatments, media were replaced with fresh MEM-LiCl media supplemented with different concentrations of CaCl2 (0.1–10 mM) and incubated for 60 min at 37 °C. Total 3H-InsPs were extracted from cells and quantitated by anion-exchange chromatography (Chang et al., 1998).
2.4. Expression of Act-CaSR in osteoblasts
In vivo expression of the Act-CaSR transgene was driven by the 3.5 kb human osteocalcin (OC) promoter which is active in mature osteoblasts (Dvorak et al., 2007). Act-CaSR cDNA was subcloned from the Act-CaSR/pcDNA3.1 vector into ClaI/XbaI sites between the OC promoter and a bovine growth hormone poly A (bGH-poly A) sequence in the pBluescript II vector (Fig. 13.2). The transgene containing the OC promoter, Act-CaSR, and bGH-poly A was released by digestion with Kpn I restriction enzyme, purified using Qiagen Gel Extraction Kit (Qiagen, Valencia, CA), and stored in 10 mM Tris–HCl buffer (pH 8.5). The DNA was microinjected into the pronuclei of fertilized ova harvested from the oviducts of newly plugged FVB/N mice by standard techniques at the University of California San Francisco Transgenic Core Facility. Surviving microinjected embryos were reimplanted into the oviduct of pseudopregnant female recipients. After birth, transgenic FVB/N mice were maintained under standardized environmental conditions, with access to food and water ad libitum. Genotyping of tail DNA was performed using two sets of transgene-specific primers (set 1: 5′-GTGCTGCCTCCGCCACTGAT-3′ and 5′-GCCCACCTGCTGCTTTGAGT-3′, spans end of OC promoter and 5′ end of transgene amplifying a 1379 bp fragment; set 2: 5′-GGGTATGGTGCGGAGGAAGG-3′ and 5′-TTGTGCTGCCCGAC CCTTTC-3′, spans end of OC promoter and 3′ end of transgene amplifying a 1539 bp fragment). All protocols were approved by the Animal Care Committee of the San Francisco Veterans Affairs Medical Center.
Figure 13.2
Figure 13.2
Expression of Act-CaSR transgene in osteoblasts. (A) Act-CaSR transgenic construct containing a 3.5 kb fragment of the human OC promoter, Act-CaSR coding sequence, and bovine growth hormone poly A (bGH-poly A) signal sequence in a pBlusescript II SK vector. (more ...)
2.5. Assessment of Act-CaSR expression in transgenic osteoblasts: Immunoblotting
Crude membrane proteins were prepared from cultured bone marrow stromal cells from Wt and transgenic Act-CaSR mice as described previously (Dvorak et al., 2007). Immunoblotting with a polyclonal anti-CaSR antiserum and peroxidase-conjugated anti-rabbit IgG secondary antibodies (GE Healthcare, Little Chalfont, UK) was performed as described previously (Chang et al., 1998). Specificity of the antiserum was confirmed by the absence of signal after preincubating anti-CaSR antiserum with the peptide against which it was raised.
2.5.1. Quantitative PCR (qPCR)
Femora of 6-week-old Wt and Act-CaR littermates were isolated and separated into epiphyseal/metaphyseal and diaphyseal compartments. Bone marrow was flushed out with PBS before bones were frozen in liquid nitrogen. For RNA isolation, the bones were powdered using a multisample biopulverizer (RPI, Mt. Prospect, IL) and homogenized with a rotor-stator homogenizer (Polytron PT 3000; Brinkmann Instruments, Westbury, NY) in RNA-Stat reagent (Tel-Test, Friendswood, TX). cDNAs were synthesized with Moloney murine leukemia virus reverse transcriptase (Invitrogen, Carlsbad, CA), and expression of Act-CaSR transgene was quantified using TaqMan qPCR kits and ABI PRISM 7900HT Sequence Detection System with SDS software (Applied Biosystems Foster City, CA). A threshold cycle (number of PCR cycles required to generate a fluorescent signal exceeding a preset threshold) was determined for the Act-CaSR transgene and normalized to the threshold cycle for a housekeeping gene (L19) in the same sample. Primers and probes for Act-CaR (forward primer: 5″-AGGCCAGCTGCTCGAGAGT-3″, reverse primer: 5″-CTTGAGTCTTCAGAAGTCACATCATG-3″, and probe: 5′-FAM-ACTCAGCTCAGCACGACTGGGAAGC-BHQ-3′) were custom made by Integrated DNA Technologies (Skokie, IL) according to published nucleotide sequences.
2.6. Assessment of skeletal phenotypes in transgenic mice
The approach used to monitor temporal changes in bone mass and structure was in vivo microcomputed tomography (μCT) because it allows quantitation of mineralized tissue and assessment of three-dimensional structural parameters in live animals over time. μCT scans were performed on transgenic Act-CaSR versus Wt mice using a SCANCO VivaCT 40 scanner (SCANCO Medical, Bassersdorf, Switzerland). Animals were anesthetized with 2% isoflurane (Baxter Healthcare Corporation, Deerfield, IL), mixed in oxygen, and scanned every 6 weeks from 6 to 30 weeks of age. To examine trabecular bone, 100 serial cross-sectional scans (1.05 mm) of the secondary spongiosa of the left distal femoral metaphysis were obtained, from the end of the growth plate extending proximally to the shaft. The isotropic voxel (volumic pixel) size was 10.5 μm, and X-ray energy was 55 kV. A global threshold (27.5% of the grayscale) was applied to segment mineralized from soft tissue in the μCT images. Linear attenuation was calibrated using preset hydroxyapatite blocks. 3-D image reconstruction and analysis were performed using software provided by the manufacturer.
2.7. Statistics
Data from two groups were compared using unpaired Student’s t test. Data from multiple groups were compared using ANOVA with Tukey’s post hoc analysis. Significance was assigned for p < 0.05.
3.1. Assessment of activity of Act-CaSR in vitro
In principle, the activity of mutant CaSRs can be assessed by their ability to stimulate PLC, raise the intracellular [Ca2+], enhance MAPK activity, and inhibit cAMP production. However, measurement of PLC activity and intracellular Ca2+ mobilization are more standard methods for assessing receptor activation because they are straightforward, economical, and adaptable to high-throughput assays. More importantly, these methods can quantify changes in the efficacy of CaSR’s response to its ligand, in this case, high [Ca2+]e.
By measuring the accumulation of total InsPs as an index of PLC activation, we observed different signaling responses in HEK-293 cells expressing Wt-CaSR versus Act-CaSR cDNAs (Fig. 13.3). We observed a clear left-shift in the EC50 of the Ca dose–response curves from ≈3.5 mM in Wt-CaSR-expressing cells to <0.3 mM in Act-CaSR-expressing cells. We also observed an elevation of basal activity at 0.1 mM Ca2+ in Act-CaSR-expressing versus Wt-CaSR-expressing cells, compatible with the notion that this was a constitutively active receptor mutant.
Figure 13.3
Figure 13.3
Effects of raising [Ca2+]e from 0.1 mM to the concentrations shown on total 3H-InsP accumulation in HEK-293 cells transiently expressing cDNAs encoding Wt-CaSR and Act-CaSR. Results are expressed as the percentage of the maximal response at 10 mM Ca2+ (more ...)
3.2. Transgenic expression of Act-CaSR in osteoblasts
Extensive biochemical and mutational analyses have identified CaSR mutants that demonstrate constitutive activity (Egbuna and Brown, 2008; Pidasheva et al., 2004). Little is known about whether and how these mutants impact cellular functions outside the PTGs in vivo, especially in bone and cartilage, because the resulting alterations in parathyroid function (hypoparathyroidism) can affect those tissues directly. Our transgenic approach, using a highly cell-specific OC promoter to express the Act-CaSR in mature osteoblasts, allowed us to target the mutant receptor to bone and avoid the metabolic changes of a more generalized promoter. Indeed in two transgenic Act-CaSR mouse lines that we established, we observed no significant differences in levels of serum Ca2+ or PTH between Wtand Act-CaSR transgenic mice (Dvorak et al., 2007).
We further confirmed targeting of the transgene to bone by qPCR analysis of RNA extracted from femurs and calvariae but not in the other tissues tested (Fig. 13.2). Both the epiphyseal/metaphyseal and diaphyseal femoral compartments, which primarily contain cancellous and cortical bone, respectively, exhibited significant transgene expression (Fig. 13.2). Immunoblotting of crude membrane fractions of cultured bone marrow stromal cells from Act-CaSR mice revealed immunoreactive bands corresponding to the bovine CaR (120, 140, and 150 kDa) (Fig. 13.2).
3.3. Skeletal phenotype of transgenic Act-CaSR mice
By in vivo μCT scanning, we observed profound changes in trabecular bone of the transgenic Act-CaSR mice, from 6 to 30 weeks of age (Fig. 13.4). Act-CaSR mice consistently showed reduced trabecular bone mass (Fig. 13.4) as indicated by the decreased ratio of total bone volume (BV) over total tissue volume (TV) (BV/TV) and an osteopenic phenotype supported by the reduced bone mineral density (BMD; Fig. 13.4). Reduced bone mass in the Act-CaSR mice was mainly due to decreases in the number and connectivity of trabecular bones and increases in trabecular spacing. Similar bone phenotypes were observed in both male and female mice. These data suggest that constitutive activity of CaSRs in osteoblasts is detrimental to skeletal function and causes osteopenia likely due to increased bone breakdown. Bone histomorphometric parameters (increased osteoclast surface per eroded surface) further support that conclusion (Dvorak et al., 2007).
Figure 13.4
Figure 13.4
In vivo μCT scans to investigate changes in trabecular bone mass and structure in Wt versus Act-CaSR mice. μCT analysis was performed on the distal femur of 6–30-week-old female mice. (A) Three-dimensional μCT image reconstruction (more ...)
While human activating mutations uncovered during the genetic evaluation of individuals with ADH (hypocalcemia, low PTH levels, and hypercalciuria) demonstrate the prominence of the CaSR in regulating parathyroid and renal function, it has been difficult to discern the role of CaSRs in other tissues from studying these families. Mouse models of generalized knockout of the CaSR are dominated by the mild to severe disturbances in serum [Ca2+] and PTH levels that have secondary effects on skeletal tissues. This report describes the analysis in transgenic mice of a constitutively activated CaSR mutant targeted to mature mineralizing osteoblasts through the use of a well-defined OC promoter. In the absence of abnormalities in serum [Ca2+] and PTH, this strategy demonstrated that the CaSR is likely playing a role in controlling the balance of bone remodeling—modulating levels of bone resorption most likely. Use of this and other well-defined mutants in transgenic models should give additional information relevant to understanding CaSR function outside the PTG.
ACKNOWLEDGMENTS
The authors acknowledge the technical skills of Ms. Tsui-Hua Chen and administrative support of Ms. Janelle Mendiola of the San Francisco VA Medical Center Endocrine Research Unit Laboratory and support from the Department of Veterans Affairs Research service and the NIH and the Department of Defense.
  • Brown EM, Gamba G, Riccardi D, Lombardi M, Butters R, Kifor O, Sun A, Hediger MA, Lytton J, Hebert SC. Cloning and characterization of an extracellular Ca2+-sensing receptor from bovine parathyroid. Nature. 1993;366:575–580. [PubMed]
  • Chang W, Shoback D. Extracellular Ca2+-sensing receptor—An overview. Cell Calc. 2004;35:183–186.
  • Chang W, Pratt S, Chen TH, Nemeth E, Huang Z, Shoback D. Coupling of calcium receptors to inositol phosphate and cyclic AMP generation in mammalian cells and Xenopus laevis oocytes and immunodetection of receptor protein by region-specific antipeptide antisera. J. Bone Min. Res. 1998;13:570–580. [PubMed]
  • Chang W, Chen TH, Pratt S, Shoback D. Amino acids in the second and third intracellular loops of the parathyroid Ca2+-sensing receptor mediate efficient coupling to phospholipase C. J. Biol. Chem. 2000;275:19955–19963. [PubMed]
  • Chang W, Pratt S, Chen TH, Shoback D. Amino acids in the cytoplasmic C terminus of the parathyroid Ca2+-sensing receptor mediate efficient cell-surface expression and phospholipase C activation. J. Biol. Chem. 2001;276:44129–44136. [PubMed]
  • Chang W, Tu C, Chen TH, Bikle D, Shoback D. The extracellular calcium-sensing receptor (CaSR) is a critical modulator of skeletal development. Sci. Signal. 2008;1(35):ra1. [PMC free article] [PubMed]
  • Dvorak MM, Chen TH, Orwoll B, Garvey C, Chang W, Bikle DD, Shoback DM. Constitutive activity of the osteoblast Ca2+-sensing receptor promotes loss of cancellous bone. Endocrinology. 2007;148:3156–3163. [PubMed]
  • Egbuna OI, Brown EM. Hypercalcaemic and hypocalcemic conditions due to calcium-sensing receptor mutations. Best Pract. Res. Clin. Rheumatol. 2008;22:129–148. [PMC free article] [PubMed]
  • Ho C, Conner DA, Pollak MR, Ladd DJ, Kifor O, Warren HB, Brown EM, Seigman JG, Seidman CE. A mouse model of human familial hypocalciuric hypercalcemia and neonatal severe hyperparathyroidism. Nat. Genet. 1995;11:389–394. [PubMed]
  • Hofer AM, Brown EM. Extracellular calcium and signaling. Nat. Rev. Mol. Cell Biol. 2003;4:530–538. [PubMed]
  • Hough TA, Bogani D, Cheeseman MT, Favor J, Nesbit MA, Thakker RV, Lyon MF. Activating calcium-sensing receptor mutation in the mouse is associated with cataracts and ectopic calcification. Proc. Natl. Acad. Sci. USA. 2004;101:13566–13571. [PubMed]
  • Huang Y, Zhou Y, Castiblanco A, Yang W, Brown EM, Yang JJ. Multiple Ca(2+)-binding sites in the extracellular domain of the Ca(2+)-sensing receptor corresponding to the cooperative Ca(2+) response. Biochemistry. 2009;48:388–398. [PMC free article] [PubMed]
  • Jensen AA, Spalding TA, Burstein ES, Sheppard PO, O’Hara PJ, Brann MR, Krogsgaard-Larsen P, Brauner-Osborne H. Functional importance of the Ala(116)-Pro(136) region in the calcium-sensing receptor. Constitutive activity and inverse agonism in a family C G-protein-coupled receptor. J. Biol. Chem. 2000;275:29547–29555. [PubMed]
  • Pidasheva V, D’Souza-Li L, Canaff L, Cole DEC, Hendy GN. CASRdb: Calcium-sensing receptor locus-specific database for mutations causing familial (benign hypocalciuric hypercalcemia, neonatal severe hyperparathyroidism and autosomal dominant hypocalcemia) Hum. Mutat. 2004;24:107–111. [PubMed]
  • Silve C, Petrel C, Leroy C, Bruel H, Mallet E, Rognan D, Ruat M. Delineating a Ca2+ binding pocket with the venus flytrap module of the human calcium-sensing receptor. J. Biol. Chem. 2005;280:37917–37923. [PubMed]
  • Wellendroph P, Brauner-Osborne H. Molecular basis for amino acid sensing by family C G-protein-coupled receptors. Br. J. Pharm. 2009;156:869–884. [PubMed]