PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Circ Res. Author manuscript; available in PMC 2013 December 7.
Published in final edited form as:
PMCID: PMC3518748
NIHMSID: NIHMS414613

Genome Editing of Human Embryonic Stem Cells and Induced Pluripotent Stem Cells With Zinc Finger Nuclease for Cellular Imaging

Abstract

Rationale

Molecular imaging has proven to be a vital tool in the characterization of stem cell behavior in vivo. However, the integration of reporter genes has typically relied upon random integration, a method that is associated with unwanted insertional mutagenesis and position effects on transgene expression.

Objective

To address this barrier, we used genome editing with zinc finger nuclease technology to integrate reporter genes into a safe harbor gene locus (PPP1R12C, also known as AAVS1) in the genome of human embryonic stem cells (hESCs) and human induced pluripotent stem cells (iPSCs) for molecular imaging.

Methods and Results

We employed ZFN technology to integrate a construct containing monomeric red fluorescent protein (mRFP), firefly luciferase (Fluc), and herpes simplex virus thymidine kinase (HSVtk) reporter genes driven by a constitutive ubiquitin promoter into a safe harbor locus for bioluminescence imaging (BLI) and positron emission tomography (PET) imaging, respectively. High efficiency of ZFN-mediated targeted integration was achieved in both hESCs and iPSCs. ZFN-edited cells maintained both pluripotency and long-term reporter gene expression. Functionally, we successfully tracked the survival of ZFN-edited hESCs, iPSCs, and their differentiated cardiomyocytes and endothelial cells in murine models, demonstrating the utility of ZFN-edited cells for preclinical studies in regenerative medicine.

Conclusion

Our study demonstrates a novel application of ZFN technology to the targeted genetic engineering of human pluripotent stem cells (PSCs) and their progeny for molecular imaging in vitro and in vivo.

Keywords: Induced pluripotent stem cells, zinc finger nuclease, homologous recombination, reporter gene, molecular imaging, stem cells, imaging

INTRODUCTION

Both human embryonic stem cells (hESCs) and induced pluripotent stem cells (iPSCs) hold great promise in the field of regenerative medicine1-5. These cells are characterized by their indefinite self-renewing ability and pluripotent differentiation potential. Because these cells possess the ability to differentiate into all somatic cell types present in the human body6, in theory hESCs and iPSCs should be ideal therapeutic donor sources, as exemplified by the recent first-in-human therapeutic benefit obtained from an injection of hESC differentiated progeny7. However, further research has brought to light many issues regarding the direct delivery of these stem cells and their derivatives. Cell survival, teratoma formation, host immune rejection, and cellular migration outside the area of administration are among the most pressing challenges8-10. Thus, investigation into the transplanted cells’ in vivo behavior is essential to both the full understanding of stem cells’ therapeutic potential and their subsequent clinical applications.

Molecular imaging has offered researchers an accurate, noninvasive, and sensitive means to longitudinally track in vivo cell behavior10-14. It has proven to be the most effective tracking modality for the study of cell survival and proliferation over time. In fact, reporter gene-based molecular imaging has been utilized to track teratoma formation, cell survival, and host immune rejection for both hESCs and iPSCs8-10, 15. However, clinical translatability of modified cells for reporter gene-based imaging has been hampered by current transgenesis methods utilizing random integration16, 17, which is suboptimal for the following reasons: 1) The cell lines resulting from this method are non-isogenic, with some cells bearing single copies of the reporter gene while others bearing multiple; 2) if the reporter genes are inserted into a “closed” locus or if one cell contains multiple copies, expression driven by the reporter genes tends to be unstable over time due to epigenetic effects18, 19; and 3) it has been observed that insertional mutagenesis resulting from random integration can be severely detrimental to the biology of the stem cells20, 21. Imaging heterogeneous populations of these cells could lead to inaccurate assessment of in vivo cell behavior. Furthermore, a batch of hESCs and iPSCs carrying a transgene at multiple locations poses difficulties from a clinical translation and regulatory perspective, since the final product is biologically nonhomogeneous.

An added challenge in this regard comes from the use of transgenic hESCs and iPSCs for “disease in a dish/in animal” efforts. The development of iPSC technology has fostered great interest in understanding the impact that interpersonal genome variation has on phenotypic differences, and consequently, large numbers of iPSC lines are being generated for that purpose. To allow a comparison of the iPSC in vitro and in vivo properties, reporter genes are indispensable, but it is essential to avoid the insertional effects of the reporter and the confounding effects of multiple reporter gene copies. Therefore, a safe targeted transgenesis method supporting long-term gene expression is vital to the translatability of molecular imaging for in vivo cell tracking. In the present work, we set out to develop a method to comprehensively solve this problem by using human genome editing22. This technology relies on an engineered zinc finger nuclease (ZFN) to induce a double-strand break (DSB)23, which then allows targeted gene repair24, knockout25, or transgene integration26. Earlier work has established genome editing in hESCs and iPSCs27. Here, we wanted to investigate whether ZFNs we developed for targeted gene addition to a genomic “safe harbor”22 could be used to track hESC and iPSC fate in vitro and in vivo.

Classical work from the Soriano lab on the Rosa26 locus28 prompted a complementary effort in human cells. The PPP1R12C gene on chromosome 19, also known as AAVS1, can be used as a landing pad for ZFN-directed transgenes to allow for their long-term expression22. AAVS1 is dispensable in hESCs and iPSCs when knocked out with either ZFNs22, 29 or TALENs30 or made hemizygous by conventional gene targeting31, and also can carry transgenes in such a way that transcription of neighboring genes is not affected32. We reasoned that we could rely on genome editing to establish a method to rapidly generate isogenic hESC and iPSC panels carrying distinct reporters at the same genomic location.

The key aim of this study was to establish a platform for in vivo imaging of hESCs and iPSCs and their differentiated progeny. For this purpose, we introduced a reporter construct containing monomeric red fluorescent protein (mRFP) for fluorescence imaging (FLI), firefly luciferase (Fluc) for bioluminescence imaging (BLI), and herpes simplex virus thymidine kinase (HSVtk) for positron emission tomography (PET) imaging into the AAVS1 locus using ZFN-driven genome editing. Our results demonstrate that such ZFN-edited stem cells maintain long-term and robust reporter gene expression and can be accurately monitored by both BLI and PET imaging in live animals. Our data establish a turnkey method for rapidly generating isogenic hESCs and iPSCs carrying any number of reporter constructs for both in vitro and in vivo cell fate tracking.

METHODS

Cell culture and maintenance of human pluripotent stem cells

For derivation of human iPSC line, please see Supplemental Methods. Human ESCs (WA09, Wicell, Madison, WI) and iPSCs were cultured on Matrigel-coated plates (ES qualified, BD Biosciences, San Diego, CA) using mTeSR-1 cell culture medium (StemCell Technologies, Vancouver, Canada) under conditions of 37°C, 95% air, and 5% CO2 in a humidified incubator as previously described33. Cells were passaged via disassociation with Collagenase IV (Invitrogen) every 4-6 days.

Construction of an AAVS1-TF donor plasmid for ZFN-mediated integration

The DNA fragment containing mRFP-Fluc-HSVtk reporter genes was PCR-amplified from the triple fusion construct (pFU-UFRTW)34 with primers GGGGGGACATGTCAGCAGAGATCCA GTTTGGTT/GGGGCGCGCCCCACATAGCGTAAAAGGAGCA and digested with restriction enzymes PciI and AscI (NEB). The fragment was then inserted into the MluI/NcoI-cut site of the donor plasmid AAVS1-CAGGS-eGFP backbone (Addgene, Cambridge, MA)22. The resultant donor plasmid, p5_AAVS1-SA-puro-pA-CAG-mRFP-Fluc-HSVtk-pA-3_AAVS1 (referred to hereafter as AAVS1-TF), contains a splice acceptor element and a 2A linker placed in front of a promoterless puromycin-polyA cassette, which expresses the puromycin resistance element only if inserted downstream of a constitutively active promoter such as the PPP1R12C promoter. The triple-fusion minigene cassette driven by the human ubiquitin promoter was placed downstream of the puromycin resistance element.

Targeted gene addition using AAVS1 ZFNs

2×105 hESCs or iPSCs were dissociated for 3-4 minutes using Accutase (Sigma) and neutralized by mTeSR-1 cell culture medium. The cells were centrifuged at 100g for 5 minutes, washed with PBS, and resuspended in R buffer (Neon Transfection system, Invitrogen) with a total of 4 μg of AAVS1-TF donor plasmids and 500 ng of the AAVS1 ZFN encoding plasmids22. The cells were transfected with the Neon Transfection system (Invitrogen) at 1100 V, 20 ms, and 1 pulse. Cells were then immediately plated onto Matrigel-coated plates with 10 μM ROCK inhibitor Y27632 (Stemgent). Puromycin selection (0.2 μg/ml) was started at day 5. After a week of selection, individual clones were picked and expanded in puromycin-free culture. In addition to the single cell-derived clones, we derived several cell pools (H7, JL, 16W, and FB) transgenic for a ZFN-directed transgene cassette at AAVS1.

Genomic polymerase chain reaction (PCR) to detect reporter gene addition

Please see Online Supplemental Methods.

Southern blot of ZFN-mediated HR-targeted hESCs and iPSCs

Genomic DNA was digested with XmnI and BglII, separated on a 0.7% agarose gel, transferred to a nylon membrane (Amersham), and hybridized with 32P-labeled random primer (Stratagene) probes.

Embryoid body (EB) formation

Please see Online Supplemental Methods.

Pluripotency markers and EB analysis

Please see Online Supplemental Methods.

Bioluminescence imaging (BLI) for longitudinal tracking of cell fate

Please see Online Supplemental Methods.

Positron emission tomography (PET) imaging for longitudinal tracking of cell fate

Please see Online Supplemental Methods.

Differentiation of pluripotent stem cell-derived cardiomyocytes (CMs)

Cardiomyocyte differentiation was performed following a protocol described by Laflamme et al.36 with minimal modification. In brief, 2×106 undifferentiated ESCs were detached by Accutase (Sigma) and seeded onto Matrigel-coated plates (ES qualified, BD Biosciences, San Diego, CA) using mTeSR-1 cell culture medium for one day. To induce cardiac differentiation, we replaced mTeSR-1 medium with RPMI-B27 medium (Invitrogen) supplemented with the following cytokines: 100 ng/ml human recombinant activin A (R&D Systems) for 24 h, followed by 10 ng/ml human recombinant BMP4 (R&D Systems) for 4 days. The medium was then exchanged for RPMI-B27 without supplementary cytokines; cultures were re-fed every 2 days for 13 additional days. Widespread spontaneous beating activity was typically observed by day 14 after addition of activin A. After 18 days of in vitro differentiation, cells were enzymatically dispersed for implantation using Blendzyme IV (Roche, prepared at 0.56 U/ml in PBS) and DNAse (Invitrogen, 60 U/ml) for 30 min at 37 °C and enriched for cardiomyocytes by separation over a discontinuous Percoll gradient.

Differentiation of pluripotent stem cell-derived endothelial cells (ECs)

To derive ZFN-edited or un-edited endothelial cells, we performed the differentiation protocol described by Li et al.37. Briefly, we cultured undifferentiated hESCs in differentiation medium on ultra-low attachment plates (Corning Incorporated, Corning, NY) for embryoid body formation (EBs). Differentiation medium consisted of Iscove’s modified Dulbecco’s medium (IMDM) with 16 BIT (BSA, insulin, transferring; Stem Cell Technologies), 15% Knockout TM Serum Replacement (KnockoutTMSR) (Invitrogen, Carlsbad, CA), 2 mM L-glutamine, 450 mM monothioglycerol (Sigma, St. Louis, MO), 20 ng/ml bFGF, 0.1 mM nonessential amino acids, 50 ng/ml VEGF (R&D Systems Inc.), 50 mg/ml streptomycin, and 50 U/ml penicillin supplemented. Twelve days after differentiation, EBs were collected and resuspended in 1.5 mg/ml rat tail collagen type I (Becton Dickinson, San Jose, CA), and then plated onto six-well plates, incubated for 30 minutes at 37°C. Upon gel formation, each dish received an addition of EGM-2 medium (Lonza, Basel, Switzerland) with 5% Knockout TM SR, 50 ng/ml VEGF, and 20 ng/ml bFGF, and was then further incubated for 3 days without media change.

RESULTS

Rapid and efficient ZFN-mediated targeted reporter addition into the AAVS1 safe harbor locus in hESCs

To overcome the limitations inherent in random integration of reporter genes, we designed a series of experiments to use ZFN technology for engineering human pluripotent stem cells (PSCs) for molecular imaging (Figure 1A). We designed a multifunctional reporter construct flanked by short (800 bp) stretches of homology to the ZFN target site22 on chr 19 in exon 1 of the PPP1r12C gene (Figure 1B). A useful feature of this site is that it lies downstream of exon 1 of a transcribed gene22; we therefore included a promotorless selectable marker in our donor construct to maximize efficiency of isolating the desired cell22. The reporter cassette, driven by the ubiquitin promoter, is a triple fusion (TF) gene of mRFP, Fluc, and HSVtk supporting FLI, BLI, and PET imaging, respectively34. We introduced the reporter construct and the ZFN expression vector into hESCs (H9) by electroporation; following puromycin selection, six clones were screened by genomic polymerase chain reaction (PCR), all of which carried the transgenic cassette at the ZFN specified location (Figure 1C). Bona fide targeted addition was confirmed by Southern blotting on 4 single-cell-derived clones (designated as ZT1-4). As shown in Figure 1D, clones ZT2 and ZT3 carried the reporter cassette integrated on both copies of the AAVS1 locus; and clones ZT1 and ZT4 on one copy. Clone ZT1 also contained an additional randomly integrated reporter transgene. We also tested for the potential random integration of the ZFN expression plasmid with Southern blotting. The data revealed that there is no random integration of ZFN expression plasmid DNA in these edited cells (Online Figure IA). We next genotyped a panel of putative ZFN off-target sites in clones ZT2-4 (Online Figure IB-C) and the un-edited allele of the AAVS1 in clone ZT4 (Online Figure ID-E); our data demonstrate all to be wild-type, in agreement with previous studies on the robust specificity of this ZFN set22, 29. In addition to the H9 line, we edited another hESC line, H7, using the same constructs. Successful integration of the reporter gene was confirmed by PCR (Online Figure IF).

Figure 1
ZFN-driven reporter gene addition to the AAVS1 locus

ZFN-mediated targeting of human iPSCs

Next, we tested the ZFN integration system in iPSCs. To derive clinically translatable iPSCs, we generated several nonviral, transgene-free iPSCs using non-integrating, episomal minicircle DNA vectors created in our lab38. The resulting iPSC lines expressed high levels of pluripotency markers and spontaneously formed 3 germ layers both in vitro with embryoid body (EB) formation and in vivo when injected into murine recipients (Online Figure IIA-C). ZFN-driven targeted reporter addition to the AAVS1 locus was comparably efficient in the iPSCs (Online Figure IID). We also edited three more iPSC lines generated in our lab (manuscript in preparation) with the TF construct and an iPSC line with cardiac specific promoter myosin heavy chain driving enhanced green fluorescent protein (MHC-eGFP) reporter construct (Online Figure IIE). The reporter gene addition was confirmed by PCR (Online Figure IIF).

Preservation of cell pluripotency post ZFN-editing

To determine whether the genetic engineering and subsequent drug selection would be comparable with retention of stemness, we tested the pluripotency of our cells after ZFN-editing and observed that all three ZFN-edited cell lines displayed normal morphology relative to control un-edited H9 cells (Online Figure III). Further testing revealed that ZFN-edited cells maintained their pluripotent state, as indicated by the expression of pluripotency markers Oct4, Tra-1-60, Sox2, Tra-1-81, Nanog, and SSEA4 (Figure 2A). Functionally, these cells were capable of differentiation into all 3 germ layers both in vivo (Figure 2B) and in vitro (Figure 2C). We also observed spontaneous EB beating after two weeks of differentiation (Online Video I). All ZFN-edited cells exhibited normal karyotypes (Figure 2D). Analysis of ZFN-edited iPSCs was also performed. These cells similarly maintained pluripotency, as demonstrated by pluripotency marker expression and EB formation (Online Figure IVA-B). In conclusion, both hESCs and iPSCs maintained their pluripotent potential after ZFN-mediated addition of reporter genes to the AAVS1 locus and subsequent drug selection.

Figure 2
Pluripotency analysis of ZFN-edited cells

In vitro imaging of ZFN-edited cells

To verify the functionality of the reporter genes in the ZFN-edited stem cells, we tested the edited hESCs for expression of the integrated Fluc and HSVtk reporter genes. All three ZFN-edited cell lines showed robust BLI and PET signals (Figure 3A-B). Importantly, when ZFN-edited hESCs were differentiated into EBs, these EBs could still be imaged by BLI, demonstrating the retention of reporter gene expression after hESC differentiation (Figure 3C). As expected, ZFN-edited iPSCs also showed robust Fluc enzyme activity as gauged by BLI (Online Figure IVC-D). Finally, we demonstrated a strong correlation between the cell numbers and BLI signals (Figure 3D-E), validating the fact that Fluc signal intensity very accurately represents the viable cell count. These results show that the quantity of ZFN-edited cells can be accurately measured by BLI because the signal directly represents cell survival and proliferation. Similarly, we tested the activity of RFP for FLI (Online Figure VA). In addition, we tested eGFP signal of the ZFN-edited MHC-eGFP reporter cells. The edited iPSCs did not have eGFP signals at undifferentiated state (Online Figure VB). However, during cardiomyocyte differentiation, the eGFP signals can be detected on day 11 (Online Figure VC). The cardiomyocytes start beating on day 12 (Online Video II). In summary, we have established that ZFN-driven targeted reporter addition into the AAVS1 locus in hESCs and iPSCs produces pluripotent cells and differentiated progenies that are robustly compatible with fluorescence, bioluminescence, and PET imaging.

Figure 3
In vitro imaging of ZFN-edited cells

ZFN-edited cells maintain long-term reporter gene expression

The key to being able to track cell fate is long-term transgene expression upon addition to the AAVS1 locus. To ask whether the multifunctional reporter cassette maintains its transcriptional status in the AAVS1 locus over an extended period, we measured reporter gene activity every seven days for up to eight weeks after having obtained and validated the genome-edited single cell-derived clones. BLI analysis revealed that luciferase enzyme activity remained constant through the duration of the experiment, indicating the stability of our reporter gene expression in the ZFN-edited cells (Figure 3F-G).

In vivo imaging of ZFN-edited cells

Next, we examined the in vivo imaging potential of the ZFN-edited hESCs in mice. We injected 103, 104, 105, and 106 hESCs into a subcutaneous site of each mouse and performed BLI on day 2. The results revealed that as few as 10,000 cells could be efficiently detected in vivo (Figure 4A). The cell numbers and bioluminescence signals were correlated in vivo (Figure 4B), consistent with our in vitro results (Figure 3D-E). These results confirm that ZFN-edited cells are accurate in tracing cell behavior in vivo. To examine whether ZFN-edited hESCs can also be imaged in vivo post differentiation, we performed a teratoma formation assay in immunodeficient mice. We successfully monitored the teratoma formation until sufficient palpability for explantation (until week 6) via BLI (Figure 4C-D). Therefore, the ZFN-edited cells and their derivatives are suitable for in vivo molecular imaging.

Figure 4
In vivo imaging of ZFN-edited cells. (A-B)

Molecular imaging of cardiomyocytes and endothelial cells derived from ZFN-edited ESCs

Myocardial infarction (MI) is the leading cause of death and morbidity in both industrialized and developing nations. Transplantation of cells, such as cardiomyocytes (CMs) and endothelial cells (ECs), has shown promise as a strategy in the treatment of MI37, 39, 40. However, the in vivo behavior of transplanted cells needs to be extensively investigated before clinical trials. To test the cardiovascular application potential of ZFN-edited cells, we first differentiated ZFN-edited hESCs into cardiomyocytes (hESC-CMs) in vitro. We performed side-by-side comparisons of the ZFN-edited hESCs and unmodified hESCs for differentiation potential. After 12 days of differentiation, cell beating was observed for both ZFN-edited and unmodified hESC-CMs (Online Video III and IV). Both differentiation efficiency and cardiac marker expression (α-actinin, TNNT2, MLC-2a and MLC-2v) in these ZFN-edited hESCs were similar to those seen in control unmodified hESCs (Online Figure VIA-B). Consistent with previous reports in hESCs and iPSCs41, 42, three types of action-potential morphologies (nodal-like, atrial-like, and ventricular-like) were recorded from un-edited and edited hESC-CMs (Online Figure VIIA). The current-clamp mode recordings revealed no significant differences in action-potential durations (APD), action potential amplitudes (APA), action potential durations at 90% repolarization (APD90), sub-population ratio or beating frequency between un-edited and edited hESC-CMs (Online Figure VIIB-F). Similarly, we differentiated ZFN-edited cells into ECs (hESC-ECs). Flow cytometry results showed ~97% pure population ECs from ZFN-edited cells and ~96% pure population ECs from unmodified cells were obtained by assessment of endothelial marker CD31+ expression (Online Figure VIIIA). Morphogenesis, endothelial marker staining, angiogenesis potential, and DiI-ac-LDL uptake assays showed that ECs derived from ZFN-edited cells were also similar to those derived from control unmodified hESCs (Online Figure VIIIB-D). These results demonstrate that the integration and expression of reporter genes from the AAVS1 locus does not influence the differentiation potential of hESCs.

Of further significant note, we show that two distinct differentiated cell types – CM and EC – generated from hESCs carrying a ZFN-directed transgenic cassette at AAVS1 are essentially indistinguishable from wild-type, unmodified, cells as gauged by a comprehensive panel of molecular and functional tests. We tested the imaging potential of these cells derived from ZFN-edited cells. As expected, both hESC-CMs and hESC-ECs showed robust luciferase signals by BLI in vitro (Figure 5A-D). We then injected one million hESC-CMs or hESC-ECs into the mouse heart and imaged them in vivo. Robust luciferase signal was detected for both hESC-CMs and hESC-ECs in the heart up to four weeks post injection (Figure 5E-H). The luciferase signal decreased over time due to donor cell death, consistent with results from our prior studies37, 39, 40. Overall, these results establish the applicability of ZFN-edited stem cells for pre-clinical in vitro and in vivo imaging studies.

Figure 5
Molecular imaging of CMs and ECs derived from ZFN-edited hESCs

DISCUSSION

The present work aimed to use the latest genetic engineering techniques combined with in vitro and in vivo imaging applications to realize the full translational potential of hESCs and iPSCs. To our knowledge, this is the first application of ZFN genome editing technology for molecular imaging of hESCs and iPSCs. In this study, we successfully edited both hESCs and iPSCs using ZFNs and achieved a high efficiency of site-specific integration. We showed that both ZFN-editing and reporter gene expression do not adversely affect cell pluripotency or differentiation potential for in vivo imaging applications. Furthermore, we demonstrated that over the extended period necessary for in vivo imaging, ZFN-edited cells robustly and stably express reporter genes without epigenetic silencing. Taken together, and in light of the recent advances in introducing stem cell progeny into the clinic, our data have important implications for the translational utility of targeted genetic engineering.

First-generation transgenesis methods that rely on random integration are associated with substantial limitations. In this regard, we believe that ZFN-driven isogenic targeted addition to a safe harbor is the preferred technology for basic science, preclinical, and in-the-clinic applications22, 29. Our data fully agree with reports demonstrating the AAVS1 locus is nonessential for hESC/iPSC pluripotency29, 31, and further establish that human stem cells carrying transgenes at this locus can be effectively imaged in vivo. Of further significant note, we carefully compared, using a large panel of immunological, molecular, and cell-physiological assays, the properties of unperturbed control cells and cells carrying a ZFN-directed transgene cassette at AAVS1. Both cardiomyocytes and endothelial cells transgenic at AAVS1 were essentially indistinguishable from control nontransgenic cells in every respect, other than being positive for the transgene-encoding marker. Our data thus extend the existing dataset on targeted gene addition to the AAVS1 locus22, 29, 30, 43 to demonstrate its suitability for in vivo imaging.

We built the reporter system not only to be multifunctional, but also to be compatible with a high-throughput process of engineering multiple distinct lines of hESCs and iPSCs. In our experiments, 100% of both hESC and iPSC single-cell-derived marker-positive clones carried the reporter at the ZFN-specified location. Accuracy and efficiency of this sort reduces the workload associated with isolating desired cells—obtaining one single-cell-derived clone per reporter construct and validating the clones before proceeding with downstream studies—to the theoretically possible minimum. This means the method we describe can be applied to large panels of hESCs and iPSCs without a measurable detriment to process flow. It is also important that the genetic approach is highly specific. The within-cell action profile of ZFNs we have engineered is a function of their DNA recognition specificity. We investigated a total of 27 maximal-likelihood off-target cleavage sites for the ZFNs we used29, and found all to be wild-type. Our data thus add to the existing body of evidence validating these ZFNs’ in-cell specificity29, 44.

Molecular imaging plays an important role in the tracking of stem cell fate in vivo, but conventional vectors that randomly integrate reporter genes throughout the genome are problematic and have limited applicability. In fact, variable expression levels among transduced cells and genetic silencing within the cells may occur depending on the reporter gene’s integration site31, 45, 46. Thus, the conventional reporter gene-based imaging may not truly demonstrate the behavior of cells. In this study, we successfully achieved long-term stable gene expression for up to two months by integrating the reporter genes into the AAVS1 locus (i.e., in isogenic settings). Our observations in this regard are consistent with results from previous studies in both transformed and stem cells22, 29, 43, 46.

Pluripotent stem cells are capable of indefinite self-renewal and pluripotency, and show promise for cell replacement therapy. However, to fully understand the beneficial effects of PSC therapy, investigators must be able to track the biology and physiology of transplanted cells in living subjects over time. In a previous study, we transplanted hESC-ECs and hESC-CMs into murine MI models and monitored cell fate using molecular imaging methods37, 39, 40. However, the expression of reporter genes in these studies was achieved using a lentivirus system that could be silenced by epigenetic effects. To minimize the epigenetic influence, we made use of the ZFN-driven site-specific integration approach. CMs and ECs derived from ZFN-edited hESCs show no significant difference compared to those derived from unmodified ESCs, and the fate of these cells can be monitored in the heart over time. Application of this novel ZFN technology in the field of cardiovascular research can thus greatly accelerate the transition of findings from basic research towards clinical translation. In summary, our study has demonstrated that ZFN-driven addition of a reporter gene cassette is a powerful tool for modifying human PSCs for molecular imaging.

Novelty and Significance

What Is Known?

  • Molecular imaging plays an important role in the characterization of stem cell behavior inside living organisms.
  • Zinc finger nuclease (ZFN) technology bypasses the negative effects of current random genetic integration techniques.
  • The AAVS1 locus is a safe harbor site in human genome and supports long-term transgene expression.

What New Information Does This Study Contribute?

  • Use of ZFN to introduce the triple fusion reporter gene into the safe harbor AAVS1 locus for effective molecular imaging.
  • Combines the latest genetic engineering techniques with state-of-the-art in vitro and in vivo imaging applications to create a platform with which to further investigate the translational potential of hESCs and iPSCs.

Currently, most stable reporter gene expression is based on random integration, which is associated with unwanted insertional mutations and harmful effects on genetic expression, rendering this method problematic for clinical translation. The present work aimed to use the latest genome editing technique with molecular imaging applications to bypass these negative consequences and facilitate future translational potential of hESCs and iPSCs. Using ZFN technology, we integrated a reporter gene complex into the AAVS1 locus of multiple pluripotent cell lines, injected these pluripotent cell progeny in mouse models, and tracked cell fate in vivo using bioluminescence imaging (BLI). We carefully compared these edited pluripotent cell lines and their derivatives, using a large panel of immunological, molecular, cellular, and physiological assays, to unmodified control cells to verify that our ZFN-modified cells are indistinguishable from control cells. Our data extend the existing dataset on novel application of ZFN technology to targeted genetic engineering for molecular imaging of human pluripotent stem cells and their progeny. Genome editing on safe harbor sites may be a powerful technology for basic and translational research in cardiovascular sciences.

Supplementary Material

ACKNOWLEDGEMENTS

We would like to acknowledge Yongquan Gong, MD, PhD for assistance with experimental protocols, Erica Moehle for drawing Figure 1A, and Philip Gregory for comments on the manuscript.

SOURCES OF FUNDING

This work was supported in part by grants from Burroughs Wellcome Fund, Leducq Fondation, NIH DP2 OD004437, NIH EB009689, NIH HL113006, NIH HL093172, CIRM RB3-05129 (JCW), U01 HL099776 (RCR), AHA BGIA 7660028 (MH), and ISHLT Research Fellowship Award (PEA).

Requests for ZFNs should be directed to FDU (furnov/at/sangamo.com).

Non-standard Abbreviations

BLI
Bioluminescence imaging
DSB
Double strand break
CM
Cardiomyocyte
EB
Embryoid body
EC
Endothelial cell
hESC
Human embryonic stem cell
FLI
Fluorescence imaging
Fluc
Firefly luciferase
HSVtk
Herpes simplex virus thymidine kinase
NHEJ
Non-homologous end joining
iPSC
Induced pluripotent stem cell
MI
Myocardial infarction
PCR
Polymerase chain reaction
PET
Positron emission tomography
PSC
pluripotent stem cell ZFN Zinc finger nuclease

Footnotes

DISCLOSURES

FDU is a full-time employee of Sangamo Biosciences, Inc.

Subject codes:

[139] Developmental biology

[142] Gene expression

[89] Genetics of cardiovascular disease

[150] Imaging

[124] Cardiovascular imaging agents/Techniques

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

REFERENCES

1. Thomson JA, Itskovitz-Eldor J, Shapiro SS, Waknitz MA, Swiergiel JJ, Marshall VS, Jones JM. Embryonic stem cell lines derived from human blastocysts. Science. 1998;282:1145–1147. [PubMed]
2. Takahashi K, Tanabe K, Ohnuki M, Narita M, Ichisaka T, Tomoda K, Yamanaka S. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell. 2007;131:861–872. [PubMed]
3. Yu J, Vodyanik MA, Smuga-Otto K, Antosiewicz-Bourget J, Frane JL, Tian S, Nie J, Jonsdottir GA, Ruotti V, Stewart R, Slukvin II, Thomson JA. Induced pluripotent stem cell lines derived from human somatic cells. Science. 2007;318:1917–1920. [PubMed]
4. Burridge PW, Keller G, Gold JD, Wu JC. Production of de novo cardiomyocytes: Human pluripotent stem cell differentiation and direct reprogramming. Cell Stem Cell. 2012;10:16–28. [PMC free article] [PubMed]
5. Narsinh K, Narsinh KH, Wu JC. Derivation of human induced pluripotent stem cells for cardiovascular disease modeling. Circ Res. 2011;108:1146–1156. [PMC free article] [PubMed]
6. Dambrot C, Passier R, Atsma D, Mummery CL. Cardiomyocyte differentiation of pluripotent stem cells and their use as cardiac disease models. Biochem J. 2011;434:25–35. [PubMed]
7. Schwartz SD, Hubschman JP, Heilwell G, Franco-Cardenas V, Pan CK, Ostrick RM, Mickunas E, Gay R, Klimanskaya I, Lanza R. Embryonic stem cell trials for macular degeneration: A preliminary report. Lancet. 2012;379:713–720. [PubMed]
8. Ghosh Z, Huang M, Hu S, Wilson KD, Dey D, Wu JC. Dissecting the oncogenic and tumorigenic potential of differentiated human induced pluripotent stem cells and human embryonic stem cells. Cancer Res. 2011;71:5030–5039. [PMC free article] [PubMed]
9. Cao F, Li Z, Lee A, Liu Z, Chen K, Wang H, Cai W, Chen X, Wu JC. Noninvasive de novo imaging of human embryonic stem cell-derived teratoma formation. Cancer Res. 2009;69:2709–2713. [PMC free article] [PubMed]
10. Swijnenburg RJ, Schrepfer S, Cao F, Pearl JI, Xie X, Connolly AJ, Robbins RC, Wu JC. In vivo imaging of embryonic stem cells reveals patterns of survival and immune rejection following transplantation. Stem Cells Dev. 2008;17:1023–1029. [PMC free article] [PubMed]
11. Barnett BP, Arepally A, Stuber M, Arifin DR, Kraitchman DL, Bulte JW. Synthesis of magnetic resonance-, x-ray- and ultrasound-visible alginate microcapsules for immunoisolation and noninvasive imaging of cellular therapeutics. Nat Protoc. 2011;6:1142–1151. [PMC free article] [PubMed]
12. Ponomarev V. Nuclear imaging of cancer cell therapies. J Nucl Med. 2009;50:1013–1016. [PubMed]
13. Chen IY, Wu JC. Cardiovascular molecular imaging: Focus on clinical translation. Circulation. 2011;123:425–443. [PMC free article] [PubMed]
14. Nguyen PK, Lan F, Wang Y, Wu JC. Imaging: Guiding the clinical translation of cardiac stem cell therapy. Circ Res. 2011;109:962–979. [PMC free article] [PubMed]
15. Swijnenburg RJ, Schrepfer S, Govaert JA, Cao F, Ransohoff K, Sheikh AY, Haddad M, Connolly AJ, Davis MM, Robbins RC, Wu JC. Immunosuppressive therapy mitigates immunological rejection of human embryonic stem cell xenografts. Proc Natl Acad Sci U S A. 2008;105:12991–12996. [PubMed]
16. Lee AS, Wu JC. Imaging of embryonic stem cell migration in vivo. Methods Mol Biol. 2011;750:101–114. [PMC free article] [PubMed]
17. Sun N, Lee A, Wu JC. Long term non-invasive imaging of embryonic stem cells using reporter genes. Nat Protoc. 2009;4:1192–1201. [PMC free article] [PubMed]
18. Krishnan M, Park JM, Cao F, Wang D, Paulmurugan R, Tseng JR, Gonzalgo ML, Gambhir SS, Wu JC. Effects of epigenetic modulation on reporter gene expression: Implications for stem cell imaging. FASEB J. 2006;20:106–108. [PMC free article] [PubMed]
19. Kita-Matsuo H, Barcova M, Prigozhina N, Salomonis N, Wei K, Jacot JG, Nelson B, Spiering S, Haverslag R, Kim C, Talantova M, Bajpai R, Calzolari D, Terskikh A, McCulloch AD, Price JH, Conklin BR, Chen HS, Mercola M. Lentiviral vectors and protocols for creation of stable hesc lines for fluorescent tracking and drug resistance selection of cardiomyocytes. PLoS One. 2009;4:e5046. [PMC free article] [PubMed]
20. Stein S, Ott MG, Schultze-Strasser S, Jauch A, Burwinkel B, Kinner A, Schmidt M, Kramer A, Schwable J, Glimm H, Koehl U, Preiss C, Ball C, Martin H, Gohring G, Schwarzwaelder K, Hofmann WK, Karakaya K, Tchatchou S, Yang R, Reinecke P, Kuhlcke K, Schlegelberger B, Thrasher AJ, Hoelzer D, Seger R, von Kalle C, Grez M. Genomic instability and myelodysplasia with monosomy 7 consequent to evi1 activation after gene therapy for chronic granulomatous disease. Nat Med. 2010;16:198–204. [PubMed]
21. Ott MG, Schmidt M, Schwarzwaelder K, Stein S, Siler U, Koehl U, Glimm H, Kuhlcke K, Schilz A, Kunkel H, Naundorf S, Brinkmann A, Deichmann A, Fischer M, Ball C, Pilz I, Dunbar C, Du Y, Jenkins NA, Copeland NG, Luthi U, Hassan M, Thrasher AJ, Hoelzer D, von Kalle C, Seger R, Grez M. Correction of x-linked chronic granulomatous disease by gene therapy, augmented by insertional activation of mds1-evi1, prdm16 or setbp1. Nat Med. 2006;12:401–409. [PubMed]
22. DeKelver RC, Choi VM, Moehle EA, Paschon DE, Hockemeyer D, Meijsing SH, Sancak Y, Cui X, Steine EJ, Miller JC, Tam P, Bartsevich VV, Meng X, Rupniewski I, Gopalan SM, Sun HC, Pitz KJ, Rock JM, Zhang L, Davis GD, Rebar EJ, Cheeseman IM, Yamamoto KR, Sabatini DM, Jaenisch R, Gregory PD, Urnov FD. Functional genomics, proteomics, and regulatory DNA analysis in isogenic settings using zinc finger nuclease-driven transgenesis into a safe harbor locus in the human genome. Genome Res. 2010;20:1133–1142. [PubMed]
23. de Souza N. Primer: Genome editing with engineered nucleases. Nat Methods. 2012;9:27. [PubMed]
24. Urnov FD, Miller JC, Lee YL, Beausejour CM, Rock JM, Augustus S, Jamieson AC, Porteus MH, Gregory PD, Holmes MC. Highly efficient endogenous human gene correction using designed zinc-finger nucleases. Nature. 2005;435:646–651. [PubMed]
25. Santiago Y, Chan E, Liu PQ, Orlando S, Zhang L, Urnov FD, Holmes MC, Guschin D, Waite A, Miller JC, Rebar EJ, Gregory PD, Klug A, Collingwood TN. Targeted gene knockout in mammalian cells by using engineered zinc-finger nucleases. Proc Natl Acad Sci U S A. 2008;105:5809–5814. [PubMed]
26. Moehle EA, Rock JM, Lee YL, Jouvenot Y, DeKelver RC, Gregory PD, Urnov FD, Holmes MC. Targeted gene addition into a specified location in the human genome using designed zinc finger nucleases. Proc Natl Acad Sci U S A. 2007;104:3055–3060. [PubMed]
27. Carroll D. Genome engineering with zinc-finger nucleases. Genetics. 2011;188:773–782. [PubMed]
28. Zambrowicz BP, Imamoto A, Fiering S, Herzenberg LA, Kerr WG, Soriano P. Disruption of overlapping transcripts in the rosa beta geo 26 gene trap strain leads to widespread expression of beta-galactosidase in mouse embryos and hematopoietic cells. Proc Natl Acad Sci U S A. 1997;94:3789–3794. [PubMed]
29. Hockemeyer D, Soldner F, Beard C, Gao Q, Mitalipova M, DeKelver RC, Katibah GE, Amora R, Boydston EA, Zeitler B, Meng X, Miller JC, Zhang L, Rebar EJ, Gregory PD, Urnov FD, Jaenisch R. Efficient targeting of expressed and silent genes in human escs and ipscs using zinc-finger nucleases. Nat Biotechnol. 2009;27:851–857. [PubMed]
30. Hockemeyer D, Wang H, Kiani S, Lai CS, Gao Q, Cassady JP, Cost GJ, Zhang L, Santiago Y, Miller JC, Zeitler B, Cherone JM, Meng X, Hinkley SJ, Rebar EJ, Gregory PD, Urnov FD, Jaenisch R. Genetic engineering of human pluripotent cells using tale nucleases. Nat Biotechnol. 2011;29:731–734. [PMC free article] [PubMed]
31. Smith JR, Maguire S, Davis LA, Alexander M, Yang F, Chandran S, ffrench-Constant C, Pedersen RA. Robust, persistent transgene expression in human embryonic stem cells is achieved with aavs1-targeted integration. Stem Cells. 2008;26:496–504. [PubMed]
32. Lombardo A, Cesana D, Genovese P, Di Stefano B, Provasi E, Colombo DF, Neri M, Magnani Z, Cantore A, Lo Riso P, Damo M, Pello OM, Holmes MC, Gregory PD, Gritti A, Broccoli V, Bonini C, Naldini L. Site-specific integration and tailoring of cassette design for sustainable gene transfer. Nat Methods. 2011;8:861–869. [PubMed]
33. Wilson KD, Sun N, Huang M, Zhang WY, Lee AS, Li Z, Wang SX, Wu JC. Effects of ionizing radiation on self-renewal and pluripotency of human embryonic stem cells. Cancer Res. 2010;70:5539–5548. [PMC free article] [PubMed]
34. Ray P, Tsien R, Gambhir SS. Construction and validation of improved triple fusion reporter gene vectors for molecular imaging of living subjects. Cancer Res. 2007;67:3085–3093. [PubMed]
35. Cao F, Lin S, Xie X, Ray P, Patel M, Zhang X, Drukker M, Dylla SJ, Connolly AJ, Chen X, Weissman IL, Gambhir SS, Wu JC. In vivo visualization of embryonic stem cell survival, proliferation, and migration after cardiac delivery. Circulation. 2006;113:1005–1014. [PubMed]
36. Laflamme MA, Chen KY, Naumova AV, Muskheli V, Fugate JA, Dupras SK, Reinecke H, Xu C, Hassanipour M, Police S, O’Sullivan C, Collins L, Chen Y, Minami E, Gill EA, Ueno S, Yuan C, Gold J, Murry CE. Cardiomyocytes derived from human embryonic stem cells in pro-survival factors enhance function of infarcted rat hearts. Nat Biotechnol. 2007;25:1015–1024. [PubMed]
37. Li Z, Wilson KD, Smith B, Kraft DL, Jia F, Huang M, Xie X, Robbins RC, Gambhir SS, Weissman IL, Wu JC. Functional and transcriptional characterization of human embryonic stem cell-derived endothelial cells for treatment of myocardial infarction. PLoS One. 2009;4:e8443. [PMC free article] [PubMed]
38. Jia F, Wilson KD, Sun N, Gupta DM, Huang M, Li Z, Panetta NJ, Chen ZY, Robbins RC, Kay MA, Longaker MT, Wu JC. A nonviral minicircle vector for deriving human ips cells. Nat Methods. 2010;7:197–199. [PMC free article] [PubMed]
39. Cao F, Wagner RA, Wilson KD, Xie X, Fu JD, Drukker M, Lee A, Li RA, Gambhir SS, Weissman IL, Robbins RC, Wu JC. Transcriptional and functional profiling of human embryonic stem cell-derived cardiomyocytes. PLoS One. 2008;3:e3474. [PMC free article] [PubMed]
40. Li Z, Wu JC, Sheikh AY, Kraft D, Cao F, Xie X, Patel M, Gambhir SS, Robbins RC, Cooke JP. Differentiation, survival, and function of embryonic stem cell derived endothelial cells for ischemic heart disease. Circulation. 2007;116:I46–54. [PMC free article] [PubMed]
41. He JQ, Ma Y, Lee Y, Thomson JA, Kamp TJ. Human embryonic stem cells develop into multiple types of cardiac myocytes: Action potential characterization. Circ Res. 2003;93:32–39. [PubMed]
42. Itzhaki I, Maizels L, Huber I, Zwi-Dantsis L, Caspi O, Winterstern A, Feldman O, Gepstein A, Arbel G, Hammerman H, Boulos M, Gepstein L. Modelling the long qt syndrome with induced pluripotent stem cells. Nature. 2011;471:225–229. [PubMed]
43. Lombardo A, Genovese P, Beausejour CM, Colleoni S, Lee YL, Kim KA, Ando D, Urnov FD, Galli C, Gregory PD, Holmes MC, Naldini L. Gene editing in human stem cells using zinc finger nucleases and integrase-defective lentiviral vector delivery. Nat Biotechnol. 2007;25:1298–1306. [PubMed]
44. Zou J, Sweeney CL, Chou BK, Choi U, Pan J, Wang H, Dowey SN, Cheng L, Malech HL. Oxidase-deficient neutrophils from x-linked chronic granulomatous disease ips cells: Functional correction by zinc finger nuclease-mediated safe harbor targeting. Blood. 2011;117:5561–5572. [PubMed]
45. Ellis J. Silencing and variegation of gammaretrovirus and lentivirus vectors. Hum Gene Ther. 2005;16:1241–1246. [PubMed]
46. Ramachandra CJ, Shahbazi M, Kwang TW, Choudhury Y, Bak XY, Yang J, Wang S. Efficient recombinase-mediated cassette exchange at the aavs1 locus in human embryonic stem cells using baculoviral vectors. Nucleic Acids Res. 2011;39:e107. [PMC free article] [PubMed]