PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
J Immunol. Author manuscript; available in PMC 2013 December 15.
Published in final edited form as:
PMCID: PMC3518619
NIHMSID: NIHMS416679

B cells are essential for Protective Immunity against Salmonella Independent of Antibody Secretion1

Abstract

Typhoid fever and non-typhoidal bacteremia caused by Salmonella remain critical human health problems. B cells are required for protective immunity to Salmonella but the mechanism of protection remains unclear. Here, we immunized WildType, B cell deficient, antibody-deficient and class-switched antibody-deficient mice with attenuated Salmonella and examined protection against secondary infection. As expected, WildType mice were protected and B cell deficient mice succumbed to secondary infection. Interestingly, mice with B cells but lacking secreted antibody or class-switched antibody had little deficiency in resistance to Salmonella infection. The susceptibility of B cell deficient mice correlated with marked reductions in CD4 T cell IFN-γ production after secondary infection. Together, these data suggest that the primary role of B cells in acquired immunity to Salmonella is via the development of protective T cell immunity.

Introduction

Typhoid fever is caused by infection with Salmonella typhi and is a serious health concern worldwide, causing an estimated 21 million cases and 216,000 deaths per year (1). Non-typhoidal salmonellosis (NTS) is caused by other Salmonella serovars and is a growing problem among HIV-infected adults and HIV-negative children in Africa and Asia (25). Currently, there are two vaccines for typhoid fever that each provide limited protection but are not widely used in endemic areas (6, 7). There is no available vaccine for NTS, although numerous target antigens have recently been defined (8). The development of novel, effective vaccines for typhoid and NTS requires greater understanding of Salmonella-specific T and B cell responses (9).

Immunity to Salmonella is studied using a well-established murine model of typhoid, in which Salmonella typhimurium causes fatal disseminated disease in susceptible, Nramps mice (10, 11). After oral infection, Salmonella can gain access to the mammalian host by invading M cells in the Peyer’s Patches of the small intestine (10). Salmonella subsequently disseminate via the lymphatic system and replicate within phagocytic cells of the spleen, liver and bone marrow. Salmonella actively inhibit phagolysosomal fusion and infected macrophages require activation via IFN-γ to kill bacteria (12). Salmonella-specific Th1 cells that produce IFN-γ are essential for controlling bacterial growth, and mice lacking αβ CD4 T cells, Th1 cells, or IFN-γ eventually succumb to primary infection with attenuated bacteria (13, 14). Patients with primary genetic deficiencies in IL-12 or IFN-γ receptor signaling suffer from repeated disseminated Salmonella infections (15, 16). Thus, Th1 cells play an important role in mediating protective immunity in both human and murine Salmonellosis.

The resolution of primary Salmonella infection confers robust protective immunity against secondary challenge. CD4 T cells are essential for this acquired resistance and depletion of CD4 T cells eliminates the protective effect of vaccination with attenuated Salmonella (17). More surprisingly for an intra-macrophage infection, B cells are also essential for acquired immunity to Salmonella, and immunized B cell-deficient mice display enhanced susceptibility to secondary infection (1820). However, the protective role of antibody in secondary immunity is somewhat controversial. Passive transfer of antibody is reported to be protective in some studies, while others have observed no protective effect (18, 19, 21). Furthermore, neither IgA, nor mucosal immunoglobulins are required for protective immunity to Salmonella (8, 22). B cells can contribute to protective immunity via antigen presentation to Salmonella-specific Th1 cells (18, 23), or as an important source of inflammatory cytokines during infection (24, 25). However, it remains unclear whether the contribution of B cells to protective immunity is largely mediated by antibody-dependent or antibody-independent mechanisms.

Here, we examined the role of B cells in protection against infection with virulent Salmonella using transgenic mouse strains that lack B cells, class-switched antibody, or antibody secretion and demonstrate that antibody production is largely dispensable for protection against secondary Salmonella infection. In contrast, B cells are required for optimal priming of Salmonella-specific Th1 cells that mediate bacterial clearance.

Materials and Methods

Mice

Balb/c (WildType) and JhD/Balb/c (B cell Deficient) mice (National Cancer Institute, Frederick, MD) were used at 6–12 weeks of age. Transgenic m+s IgM and mIgM use the B1–8 heavy chain, have a restricted BCR repertoire, were maintained on a JhD/Balb/c background (26) and were provided by Dr. Shlomchik (Yale University, New Haven, CT). Transgenic mice were intercrossed with JhD/Balb/c mice and used at 6–12 weeks of age. Homozygosity at the JHD locus was maintained by interbreeding with JhD mice and PCR screening of mIgM heavy chain was done using the following primers (Vh186.2 5′ 216 CTACTGGATGCACTGGGTGA and Vh186.2 3′ 459 TTGGCCCCAGTAGTCAAAGTA). All mice were housed in specific pathogen free conditions for breeding and experimentation.

Bacteria and Infection

Attenuated S. typhimurium BRD509 (ΔaroA/ΔaroD) and parental virulent strain SL1344 were grown overnight in Luria-Bertani broth and diluted in PBS after estimating bacterial counts by spectrophotometry. Mice were immunized IV with 5×105 BRD509 and challenged orally with 5×107 SL1344 after oral administration of 100μl 5% NaHCO3. Infection doses were confirmed by plating serial dilutions onto MacConkey agar plates. Any moribund infected mice were euthanized as stipulated in our IACUC protocol. Bacterial growth in vivo was calculated by plating serial dilutions of organ homogenates onto MacConkey agar and bacterial counts were determined after overnight incubation at 37°C.

Detection of in vivo cytokine production and Flow Cytometry

Salmonella-specific CD4 and CD8 T cell responses were visualized, as previously described (27). Immunized mice were injected IV with 1×108 Heat-Killed Salmonella typhimurium (HKST) and spleens harvested three or five hours later. A single cell suspension was surface stained using FITC-, PE-, PE-Cy5-, PE-Cy7-, APC-, eF450-, AF700- and APCeF780-conjugated antibodies to CD3, CD4, CD8, Gr-1, CD11c, CD11b, F4/80, B220, and CD44 in Fc block (spent 24G2 supernatant, 2% rat serum, 2% mouse serum). Cells were fixed, permeabilized, and stained intracellularly using PE conjugated anti-IFN-γ. All staining reagents were purchased from BD Biosciences (San Jose, CA) or eBioscience (San Diego, CA). Samples were analyzed by flow cytometry using a FACSCanto and data analyzed using FlowJo Software (Tree Star).

Salmonella-specific antibody response

Blood was collected by retro-orbital bleeding and sera prepared and stored at −20°C. Salmonella-specific IgM and IgG antibodies were measured by ELISA, as previously described (27).

Statistical Analysis

Statistical analysis was performed using unpaired t tests (Prism 4, GraphPad Software, Inc., La Jolla, CA). Survival data was compared using a Log-rank (Mantel–Cox) test (Prism 4). Statistical differences between groups are highlighted with *, P < 0.05; **, P < 0.01; or ***, P < 0.001.

Results and Discussion

Class-switched antibody is not required for secondary protection against Salmonella

Defining protective immune responses to Salmonella infection is a prerequisite for development of new effective vaccines against typhoid and NTS (10). Although CD4 T cells are critical for protective immunity to Salmonella, the contribution of B cells has not been clearly defined. Salmonella-specific antibody production, inflammatory cytokine production, and direct antigen presentation to T cells have each been proposed as mechanisms to explain the protective role of B cells during secondary infection (18, 19, 23, 24, 28). We sought to investigate whether B cells provide secondary protective immunity against Salmonella primarily in an antibody dependent or independent manner. Given previous data showing that serum transfer can protect (19), but that neither IgA nor mucosal immunoglobulin is required (8), we hypothesized that systemic IgG is essential for secondary clearance of bacteria. To test this hypothesis, we examined immunity in B cell deficient mice (JhD), transgenic mice with B cells that cannot class switch or secrete antibody (membrane IgM- mIgM), and mice with B cells that cannot class switch but are able to secrete IgM, (membrane + secretory IgM- m+s IgM) (26). Although the mIgM and m+s IgM transgenic mice have a restricted BCR repertoire, they do not have significant deviations in naive B cell and T cell subsets (Supplemental Fig. 1A–1D and (29)). All four strains (WildType, B cell deficient, mIgM, and m+s IgM mice) survived vaccination with attenuated S. typhimurium and had largely cleared bacteria from the spleen 44 days later (Supplemental Fig. 1E). This confirmed previous reports that resolution of primary infection with attenuated Salmonella does not require B cells (18, 19).

To examine acquired immunity to secondary Salmonella infection, naive and immunized mice from all four strains were challenged orally with virulent S. typhimurium (Fig. 1A). Regardless of the B cell compartment, all naïve mice succumbed to primary infection with virulent Salmonella at a similar rate (Fig. 1A). In contrast, immunized WildType mice resisted secondary infection with virulent Salmonella, while B cell deficient mice succumbed to secondary challenge (Fig. 1A). Surprisingly, m+s IgM mice that lack class-switched antibody also survived secondary infection with Salmonella, demonstrating a similar degree of protective immunity to wild-type mice (Fig. 1A). Furthermore, most mIgM mice that lack all secreted antibodies were resistant to secondary Salmonella infection. However, approximately 25% of these mice eventually died from infection, and this was statistically different from the survival of WildType and B cell deficient mice (Fig. 1A). Together, these data confirm that B cells are essential for resistance to secondary infection with virulent Salmonella, and surprisingly demonstrate that production of class-switched antibodies is not required for protective immunity. Additionally, although secreted IgM antibodies may contribute to secondary protection, the mechanism of B cell-mediated protection against secondary Salmonella infection is largely antibody-independent in this vaccination and rechallenge model.

FIGURE 1
Class-switched antibody is not necessary for immunity to Salmonella.

Given these findings, it was important to confirm the absence of circulating Salmonella-specific antibody in each B cell deficient strain examined above. Serum was collected nine days after secondary infection, and Salmonella-specific antibody responses were examined. Nine days after secondary infection, both WildType mice and IgM Ab Only (m+s IgM) mice had modest levels of circulating Salmonella-specific IgM (Fig. 1B), but only WildType mice developed Salmonella-specific IgG (Fig. 1B). These results confirm that only WildType mice produced a class-switched antibody response to Salmonella, but that IgM Ab Only mice developed low Salmonella-specific IgM responses during secondary infection.

Secondary bacterial clearance does not require class-switched antibody

Given the fact that mice lacking all antibodies had a 25% death rate following virulent challenge, it seemed likely that bacterial clearance was hindered at late time points in these mice, perhaps because IgM is required for clearance from a particularly persistent anatomical site such as the mesenteric lymph nodes (30). Thus, we examined the rate of bacterial clearance in immunized mice lacking B cells, class-switched antibody or all antibody. Three days after secondary infection, WildType mice had lower bacterial loads in the spleen than B cell deficient mice (Fig. 2A), demonstrating that B cells are required for rapid secondary clearance of bacteria. At this early time point, no significant differences were apparent between antibody deficient strains and B cell deficient mice, but antibody deficient mice had a trend towards lower CFUs in the spleen (Fig. 2A). No significant differences were detected in liver CFUs at this same early time point (Fig. 2B). Nine days after secondary infection, mice lacking B cells had much higher bacterial loads in both the spleen and liver compared to WildType mice (Fig. 2A and B). In marked contrast, mIgM and m+s IgM mice had lower CFUs in both spleen and liver (Fig. 2A and B). Together these data demonstrate that the rate of bacterial clearance during secondary infection is largely unaffected by the absence of antibody, despite a requirement for B cells. This finding contrasts with prior studies that showed a protective effect of serum transfer (19, 21). However, these studies were not designed to test an antibody-independent role of B cells and both described protection against low dose challenge. Our finding has broad implications since the measurement of circulating immunoglobulin is often used as an indicator of vaccine efficacy.

FIGURE 2
Rapid bacterial clearance does not require antibody

B cell-deficient mice have reduced CD4 T cell responses to Salmonella

It is clear from previous work that secretion of IFN-γ by Th1 cells is critical for the resolution of Salmonella infections (14, 31). We confirmed this by depleting CD4 and CD8 T cells in immunized WildType mice and challenging with a virulent strain of Salmonella. T cell depletion caused a significant increase in bacterial loads during secondary infection (Supplemental Fig. 2A). It has been suggested that antibody can enhance T cell responses to Salmonella by allowing bacterial uptake via Fc receptors on dendritic cells (32). B cells also can present antigen and secrete cytokines that shape the development of protective T cell responses. Thus, we examined the effect of B cell or antibody deficiency on the generation of Salmonella-specific Th1 cells.

WildType, B cell deficient, m+s IgM and mIgM mice were immunized with attenuated Salmonella and Salmonella-specific CD4 T cell responses examined 42 days later. As previously reported (33, 34), immunized WildType mice had a large population of CD4 T cells that produced IFNγ in response to HKST stimulation (Fig. 3A and Supplemental Fig. 2B). In marked contrast, immunized B cell deficient mice had lower numbers of IFNγ-producing Th1 cells in response to HKST (Fig. 3A and Supplemental Fig. 2B). This difference was antibody-independent since immunized m+s IgM and mIgM mice had similar levels of IFNγ-producing CD4 T cells as WildType mice (Fig. 3A and Supplemental Fig. 2B). In fact, mIgM mice, which lack all secreted antibodies, had a larger population of Salmonella-specific IFNγ-producing CD4 T cells. Interestingly, IFNγ-producing CD8 T cells were also slightly reduced in immunized B cell deficient mice, but this was not statistically significant (Fig. 3B and Supplemental Fig. 2B). Taken together, these data indicate that B cells, but not antibody, are required for shaping the development of protective CD4 Th1 responses to Salmonella. A similar role for B cells has been reported in other infection models such as LCMV and Pneumocystis (35, 36). Although B cells may directly present antigen and drive Salmonella-specific Th1 responses, a recent study demonstrated that B cell production of IL-6 is important for maximal Th17 responses, and B cell production of IFNγ contributed to Th1 development (24). A recent study has also shown that B cells can affect secondary responses to Salmonella infection via a MyD88 and IL-10-dependent mechanism (37). Thus, B cells likely contribute to protective CD4 responses, via antigen presentation and production of specific cytokines that drive effector lineage commitment during primary responses. It is not yet clear whether these required B cells are necessarily Salmonella-specific, however the limited B cell repertoire in IgM Only and No Antibody mice did not affect protective immunity. We also attempted to address this issue using in vitro re-stimulation and B cell tetramer pull-down experiments in previously infected mice, but did not detect an elevated frequency of Salmonella-specific B cells using either of these approaches. However, it remains possible that expanded Salmonella-specific B cells contribute to immunity to secondary infection.

FIGURE 3
Antibody is not required for optimal Salmonella-specific Th1 cells

Together, our data demonstrate that antibody production plays only a minor role in Salmonella immunity while B cells are required for the development of protective T cell immunity. These findings will be important for the development of new effective vaccines against typhoid and NTS.

Supplementary Material

1

Footnotes

1This work was supported by Grants AI091298 (to MRN), AI087830 (to SSW), AI043603 (to MJS), AI055743 and AI073672 (to SJM), and T32 GM008244 (to UMN MSTP) from the National Institutes of Health.

References

1. Crump JA, Luby SP, Mintz ED. The global burden of typhoid fever. Bull World Health Organ. 2004;82:346–353. [PubMed]
2. Gordon MA, Kankwatira AM, Mwafulirwa G, Walsh AL, Hopkins MJ, Parry CM, Faragher EB, Zijlstra EE, Heyderman RS, Molyneux ME. Invasive non-typhoid salmonellae establish systemic intracellular infection in HIV-infected adults: an emerging disease pathogenesis. Clin Infect Dis. 2010;50:953–962. [PubMed]
3. Graham SM. Nontyphoidal salmonellosis in Africa. Curr Opin Infect Dis. 2010;23:409–414. [PubMed]
4. MacLennan CA, Gilchrist JJ, Gordon MA, Cunningham AF, Cobbold M, Goodall M, Kingsley RA, van Oosterhout JJ, Msefula CL, Mandala WL, Leyton DL, Marshall JL, Gondwe EN, Bobat S, Lopez-Macias C, Doffinger R, Henderson IR, Zijlstra EE, Dougan G, Drayson MT, MacLennan IC, Molyneux ME. Dysregulated humoral immunity to nontyphoidal Salmonella in HIV-infected African adults. Science. 2010;328:508–512. [PMC free article] [PubMed]
5. MacLennan CA, Gondwe EN, Msefula CL, Kingsley RA, Thomson NR, White SA, Goodall M, Pickard DJ, Graham SM, Dougan G, Hart CA, Molyneux ME, Drayson MT. The neglected role of antibody in protection against bacteremia caused by nontyphoidal strains of Salmonella in African children. J Clin Invest. 2008;118:1553–1562. [PMC free article] [PubMed]
6. Black RE, Levine MM, Ferreccio C, Clements ML, Lanata C, Rooney J, Germanier R. Efficacy of one or two doses of Ty21a Salmonella typhi vaccine in enteric-coated capsules in a controlled field trial. Chilean Typhoid Committee. Vaccine. 1990;8:81–84. [PubMed]
7. Fraser A, Paul M, Goldberg E, Acosta CJ, Leibovici L. Typhoid fever vaccines: systematic review and meta-analysis of randomised controlled trials. Vaccine. 2007;25:7848–7857. [PubMed]
8. Lee SJ, Liang L, Juarez S, Nanton MR, Gondwe EN, Msefula CL, Kayala MA, Necchi F, Heath JN, Hart P, Tsolis RM, Heyderman RS, MacLennan CA, Felgner PL, Davies DH, McSorley SJ. Identification of a common immune signature in murine and human systemic Salmonellosis. Proc Natl Acad Sci U S A. 2012;109:4998–5003. [PubMed]
9. Pasetti MF, Simon JK, Sztein MB, Levine MM. Immunology of gut mucosal vaccines. Immunol Rev. 2011;239:125–148. [PMC free article] [PubMed]
10. Griffin AJ, McSorley SJ. Development of protective immunity to Salmonella, a mucosal pathogen with a systemic agenda. Mucosal Immunol. 2011;4:371–382. [PubMed]
11. Tsolis RM, Xavier MN, Santos RL, Baumler AJ. How to become a top model: impact of animal experimentation on human Salmonella disease research. Infect Immun. 2011;79:1806–1814. [PMC free article] [PubMed]
12. Mastroeni P, Grant A, Restif O, Maskell D. A dynamic view of the spread and intracellular distribution of Salmonella enterica. Nat Rev Microbiol. 2009;7:73–80. [PubMed]
13. Hess J, Ladel C, Miko D, Kaufmann SH. Salmonella typhimurium aroA- infection in gene-targeted immunodeficient mice: major role of CD4+ TCR-alpha beta cells and IFN-gamma in bacterial clearance independent of intracellular location. J Immunol. 1996;156:3321–3326. [PubMed]
14. Ravindran R, Foley J, Stoklasek T, Glimcher LH, McSorley SJ. Expression of T-bet by CD4 T cells is essential for resistance to Salmonella infection. J Immunol. 2005;175:4603–4610. [PubMed]
15. Dorman SE, Holland SM. Interferon-gamma and interleukin-12 pathway defects and human disease. Cytokine Growth Factor Rev. 2000;11:321–333. [PubMed]
16. MacLennan C, Fieschi C, Lammas DA, Picard C, Dorman SE, Sanal O, MacLennan JM, Holland SM, Ottenhoff TH, Casanova JL, Kumararatne DS. Interleukin (IL)-12 and IL-23 are key cytokines for immunity against Salmonella in humans. J Infect Dis. 2004;190:1755–1757. [PubMed]
17. Nauciel C. Role of CD4+ T cells and T-independent mechanisms in acquired resistance to Salmonella typhimurium infection. Journal of immunology. 1990;145:1265–1269. [PubMed]
18. Mastroeni P, Simmons C, Fowler R, Hormaeche CE, Dougan G. Igh-6(−/−) (B-cell-deficient) mice fail to mount solid acquired resistance to oral challenge with virulent Salmonella enterica serovar typhimurium and show impaired Th1 T-cell responses to Salmonella antigens. Infect Immun. 2000;68:46–53. [PMC free article] [PubMed]
19. McSorley SJ, Jenkins MK. Antibody is required for protection against virulent but not attenuated Salmonella enterica serovar typhimurium. Infect Immun. 2000;68:3344–3348. [PMC free article] [PubMed]
20. Mittrucker HW, Raupach B, Kohler A, Kaufmann SH. Cutting edge: role of B lymphocytes in protective immunity against Salmonella typhimurium infection. J Immunol. 2000;164:1648–1652. [PubMed]
21. Mastroeni P, Villarreal-Ramos B, Hormaeche CE. Adoptive transfer of immunity to oral challenge with virulent salmonellae in innately susceptible BALB/c mice requires both immune serum and T cells. Infect Immun. 1993;61:3981–3984. [PMC free article] [PubMed]
22. Wijburg OL, Uren TK, Simpfendorfer K, Johansen FE, Brandtzaeg P, Strugnell RA. Innate secretory antibodies protect against natural Salmonella typhimurium infection. J Exp Med. 2006;203:21–26. [PMC free article] [PubMed]
23. Ugrinovic S, Menager N, Goh N, Mastroeni P. Characterization and development of T-Cell immune responses in B-cell-deficient (Igh-6(−/−)) mice with Salmonella enterica serovar Typhimurium infection. Infect Immun. 2003;71:6808–6819. [PMC free article] [PubMed]
24. Barr TA, Brown S, Mastroeni P, Gray D. TLR and B cell receptor signals to B cells differentially program primary and memory Th1 responses to Salmonella enterica. J Immunol. 2010;185:2783–2789. [PMC free article] [PubMed]
25. Barr TA, Brown S, Mastroeni P, Gray D. B cell intrinsic MyD88 signals drive IFN-gamma production from T cells and control switching to IgG2c. J Immunol. 2009;183:1005–1012. [PubMed]
26. Chan OT, Hannum LG, Haberman AM, Madaio MP, Shlomchik MJ. A novel mouse with B cells but lacking serum antibody reveals an antibody-independent role for B cells in murine lupus. J Exp Med. 1999;189:1639–1648. [PMC free article] [PubMed]
27. Griffin A, Baraho-Hassan D, McSorley SJ. Successful treatment of bacterial infection hinders development of acquired immunity. J Immunol. 2009;183:1263–1270. [PMC free article] [PubMed]
28. Cunningham AF, Gaspal F, Serre K, Mohr E, Henderson IR, Scott-Tucker A, Kenny SM, Khan M, Toellner KM, Lane PJ, MacLennan IC. Salmonella induces a switched antibody response without germinal centers that impedes the extracellular spread of infection. J Immunol. 2007;178:6200–6207. [PubMed]
29. Hannum LG, Haberman AM, Anderson SM, Shlomchik MJ. Germinal center initiation, variable gene region hypermutation, and mutant B cell selection without detectable immune complexes on follicular dendritic cells. The Journal of experimental medicine. 2000;192:931–942. [PMC free article] [PubMed]
30. Griffin AJ, Li LX, Voedisch S, Pabst O, McSorley SJ. Dissemination of persistent intestinal bacteria via the mesenteric lymph nodes causes typhoid relapse. Infect Immun. 2011;79:1479–1488. [PMC free article] [PubMed]
31. Mastroeni P, Villarreal-Ramos B, Hormaeche CE. Role of T cells, TNF alpha and IFN gamma in recall of immunity to oral challenge with virulent salmonellae in mice vaccinated with live attenuated aro- Salmonella vaccines. Microb Pathog. 1992;13:477–491. [PubMed]
32. Tobar JA, Gonzalez PA, Kalergis AM. Salmonella escape from antigen presentation can be overcome by targeting bacteria to Fc gamma receptors on dendritic cells. J Immunol. 2004;173:4058–4065. [PubMed]
33. Griffin AJ, McSorley SJ. Generation of Salmonella-specific Th1 cells requires sustained antigen stimulation. Vaccine. 2011;29:2697–2704. [PMC free article] [PubMed]
34. Srinivasan A, Foley J, McSorley SJ. Massive number of antigen-specific CD4 T cells during vaccination with live attenuated Salmonella causes interclonal competition. J Immunol. 2004;172:6884–6893. [PubMed]
35. Whitmire JK, Asano MS, Kaech SM, Sarkar S, Hannum LG, Shlomchik MJ, Ahmed R. Requirement of B cells for generating CD4+ T cell memory. J Immunol. 2009;182:1868–1876. [PMC free article] [PubMed]
36. Lund FE, Hollifield M, Schuer K, Lines JL, Randall TD, Garvy BA. B cells are required for generation of protective effector and memory CD4 cells in response to Pneumocystis lung infection. J Immunol. 2006;176:6147–6154. [PubMed]
37. Neves P, Lampropoulou V, Calderon-Gomez E, Roch T, Stervbo U, Shen P, Kuhl AA, Loddenkemper C, Haury M, Nedospasov SA, Kaufmann SH, Steinhoff U, Calado DP, Fillatreau S. Signaling via the MyD88 adaptor protein in B cells suppresses protective immunity during Salmonella typhimurium infection. Immunity. 2010;33:777–790. [PubMed]