PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of jcmPermissionsJournals.ASM.orgJournalJCM ArticleJournal InfoAuthorsReviewers
 
J Clin Microbiol. 2012 December; 50(12): 4144–4146.
PMCID: PMC3502971

Allele-Specific PCR for Determination of IL28B Genotype

Abstract

The IL28B genotype is a critical determinant of interferon response in patients infected with hepatitis C virus genotype 1. We describe an allele-specific PCR assay for the IL28B genotype. The assay is simple and robust, uses commonly available real-time PCR instrumentation, and is well suited for clinical laboratories offering IL28B genotyping.

TEXT

Interferon is used to treat hepatitis C virus (HCV) infections, but many patients do not respond. Several tightly linked single nucleotide polymorphisms (SNPs) in noncoding regions near the IL28B gene on chromosome 19 are strongly associated with response rates for HCV genotype 1 infections (5, 12, 1517). The IL28B genotype is therefore useful in determining the appropriate therapy for these individuals (10). Here we describe a simple and robust allele-specific PCR assay for determination of the IL28B genotype.

The assay distinguished C versus T at rs12979860, which is associated with interferon response (5). The assay was performed in two wells, each containing the same 5′ primer (CAAGCGGCGCTTATCGCATACGGCTA) and TaqMan probe (6-carboxyfluorescein [6-FAM]-CTGGCAGCGCACG-MGBNFQ). One well contained a C-specific 3′ primer (GTGCAATTCAACCCTGGTACG), and the other contained a T-specific primer (GTGCAATTCAACCCTGGTACA). The 3′ primers included a deliberate mismatch with the wild-type A at position −3 from the 3′ end (Table 1) to further decrease the efficiency of the mismatched amplification reaction. Primers and probes for amplification of the internal control (EXOBS forward, 5′-AATTGGAAGTGGCGGAAGAA-3′; EXOBS reverse, 5′-GGAACCTAAGACAAGTGTGTTTATGG-3′; and EXOBS probe, 5′-VIC-AGCTATTGCAAACGCCATCGCACAA-6-carboxytetramethylrhodamine [TAMRA]) were included in the master mix (Life Technologies AmpliTaq DNA polymerase).

TABLE 1
Candidate allele-specific primers and plasmids used in this study

Two hundred microliters of whole blood was extracted using the Roche MagNA Pure LC (DNA isolation kit I) and eluted to a volume of 100 μl. Extractions were done using lysis buffer spiked with internal control plasmid containing a 118-bp segment of jellyfish DNA at a concentration resulting in approximately 50 copies of plasmid in the final PCR. (For quality control [QC], the threshold cycle [CT] for the internal control must equal 32 ± 1.5.) Positive control plasmids contained a 261-bp amplicon with either the C or T allele at the rs12979860 SNP. (For QC, the CT must equal 25 ± 1.5.) PCR mixtures contained 10 μl of DNA, 400 nM primers, 100 nM probe, and 40 μl of master mix, using standard TaqMan conditions on an ABI 7500 real-time PCR instrument.

For genotype calls, raw PCR data were imported into an Excel macro that compared the SNP threshold cycle (CT) for each allele-specific reaction. Samples with the C/C genotype were amplified faster with the C-specific primer as follows. If CT (C) − CT (T) was ≤−8, the sample was considered C/C; if CT (C) − CT (T) was ≥8, the sample was considered T/T; finally, if CT (C) − CT (T) was 2 to −2, the sample was considered C/T. All samples could have their genotypes definitely called using this algorithm.

We compared amplifications with 6 different 3′-allele-specific primers to determine those with maximum efficiency and minimum cross-reactivity for C and T genotypes. Primers containing an additional mismatched A at the 3′ third to last base position in addition to the SNP-specific base provided the best specificity (Table 1; see Fig. S1 in the supplemental material). The −3 base mismatch did not substantially impact detection of the matched allele but reduced amplification of the mismatched allele by approximately 1,000-fold (9 cycles) (Table 1).

Assay performance was confirmed by testing DNA from 19 samples from a cohort previously described by one of us (12a). The new allele-specific assay gave identical results to those obtained at Duke University using the ABI TaqMan allelic discrimination kit (12a, 19) (6 C/C, 10 C/T, and 3 T/T).

We evaluated the impact of sample transportation and storage on assay performance, using EDTA-treated whole-blood samples transported to the laboratory at room temperature. The ability to clearly assign genotype was not impacted by additional storage of EDTA-treated whole blood at room temperature for 1 to 2 days, for up to 6 days at +4°C, or for a month or more at −20°C prior to testing (see Fig. S2 in the supplemental material). Validation on leftover EDTA-treated whole-blood samples submitted for routine hematological tests over a period of 1 month (transported at room temperature and stored up to 1 week at +4C) gave unambiguous genotype results for all samples (Table 2). All positive, negative, and internal control reactions were within established quality control ranges.

TABLE 2
Genotype distribution in tested samples

Over the first 8 months of use, the assay was performed on 94 clinical samples in 35 once-weekly runs. Samples were transported at room temperature and stored for up to 1 week at 4°C prior to testing. All samples passed quality control criteria for the internal control and typing reactions. We observed a higher percentage of genotype T/T than was found in our general population (Table 2), probably because the test was more frequently ordered for patients who did not clear spontaneously or who had a poor treatment response. The mean CT difference between the C and T reactions for the C/C genotype was −9.4 (2 standard deviations [SDs]; range, −10.9 to −8.0). For the T/T genotype, the difference was 10.3 (2 SDs; range, 9.3 to 11.3), and for the C/T genotype, the difference was −0.1 (2 SDs; range, −1.3 to 1.2).

Quality control parameters indicated that the assay was stable over 8 months of clinical use; CTs for the positive controls were very consistent, with excellent means and coefficients of variation (CV) (Table 3). The CV for patient samples was slightly higher, perhaps due to either differences in patient white blood cell counts or additional variation from the extraction step for the patient samples.

TABLE 3
Assay stability in clinical usea

Given the utility of IL28B genotyping in choosing therapy for HCV-infected individuals, a simple, robust, and accurate assay is needed. Previously described SNP genotyping methods include restriction fragment length polymorphism (RFLP) (11), TaqMan allelic discrimination PCR (14, 18, 19), direct sequencing (7), the Invader assay (8), high-resolution melt (HRM) (9), tetra-primer amplification refractory mutation system PCR (T-ARMS-PCR) (4), pyrosequencing (2), the melt-mismatch amplification mutation assay (melt-MAMA) (3), and next generation sequencing (13). Ito et al. found good agreement between five methods (direct sequencing, Invader, TaqMan allele-discrimination, high-resolution melt, and hybridization probes) for the determination of the IL28B genotype (7). Cariani et al. compared sample types (swabs, blood, serum, and formalin-fixed paraffin-embedded [FFPE] liver biopsy specimens) for a probe-based allelic discrimination assay (1) and obtained identical results from all sources. These results suggest that the choice of method can be based largely on factors important in clinical laboratories, including simplicity and robustness.

We have designed an allele-specific PCR assay for the IL28B genotype and evaluated its performance over an extended period of clinical use. Our assay differs from the previously published allelic discrimination TaqMan assays because it evaluates success versus failure of the amplification reaction, rather than differential association of allele-specific probes. We believe that our allele-specific assay may offer advantages to clinical laboratories. Since mismatches between the probe and target, including previously unknown viral variants, can markedly affect CT values for real-time PCR (6), allelic discrimination PCR may perform unpredictably if such viral variation exists anywhere within the probe region. Our assay should be robust for detection of rare viral variants, which would only affect amplification when present at the extreme 3′ end of the allele-specific primers. In this case, the specific amplifications for both alleles would be affected and fall outside the control ranges. Such specimens could then be evaluated by sequencing. However, we did not observe this in the first 94 samples tested, so it is likely to be an uncommon occurrence. Finally, our allele-specific assay is simple to perform and utilizes only a simple Excel macro and standard real-time PCR software provided with most instruments. Thus, it could be readily incorporated into the work flow of any laboratory performing real-time PCR.

Supplementary Material

Supplemental material:

Footnotes

Published ahead of print 10 October 2012

Supplemental material for this article may be found at http://jcm.asm.org/.

REFERENCES

1. Cariani E, et al. 2011. Interleukin 28B genotype determination using DNA from different sources: a simple and reliable tool for the epidemiological and clinical characterization of hepatitis C. J. Virol. Methods 178:235–238. [PubMed]
2. Doehring A, et al. 2010. Screening for IL28B gene variants identifies predictors of hepatitis C therapy success. Antiviral Ther. 15:1099–1106. [PubMed]
3. Fonseca-Coronado S, et al. 2011. Interleukin-28B genotyping by melt-mismatch amplification mutation assay PCR analysis using single nucleotide polymorphisms rs12979860 and rs8099917, a useful tool for prediction of therapy response in hepatitis C patients. J. Clin. Microbiol. 49:2706–2710. [PMC free article] [PubMed]
4. Galmozzi E, et al. 2011. A tetra-primer amplification refractory mutation system polymerase chain reaction for the evaluation of rs12979860 IL28B genotype. J. Viral Hepat. 18:628–630. [PubMed]
5. Ge D, et al. 2009. Genetic variation in IL28B predicts hepatitis C treatment-induced viral clearance. Nature 461:399–401. [PubMed]
6. Hoffman NG, Cook L, Atienza EE, Limaye AP, Jerome KR. 2008. Marked variability of BK virus load measurement using quantitative real-time PCR among commonly used assays. J. Clin. Microbiol. 46:2671–2680. [PMC free article] [PubMed]
7. Ito K, et al. 2011. The rs8099917 polymorphism, when determined by a suitable genotyping method, is a better predictor for response to pegylated alpha interferon/ribavirin therapy in Japanese patients than other single nucleotide polymorphisms associated with interleukin-28B. J. Clin. Microbiol. 49:1853–1860. [PMC free article] [PubMed]
8. Kawaoka T, et al. 2011. Predictive value of the IL28B polymorphism on the effect of interferon therapy in chronic hepatitis C patients with genotypes 2a and 2b. J. Hepatol. 54:408–414. [PubMed]
9. Kovanda A, Poljak M. 2011. Real-time polymerase chain reaction assay based on high-resolution melting analysis for the determination of the rs12979860 polymorphism involved in hepatitis C treatment response. J. Virol. Methods 175:125–128. [PubMed]
10. Lange CM, Zeuzem S. 2011. IL28B single nucleotide polymorphisms in the treatment of hepatitis C. J. Hepatol. 55:692–701. [PubMed]
11. Nakamoto S, et al. 2011. Simple assay based on restriction fragment length polymorphism associated with IL28B in chronic hepatitis C patients. Scand. J. Gastroenterol. 46:955–961. [PubMed]
12. Rauch A, et al. 2010. Genetic variation in IL28B is associated with chronic hepatitis C and treatment failure: a genome-wide association study. Gastroenterology 138:1338–1345. [PubMed]
12a. Scott J, et al. 2011. IL28B genotype effects during early treatment with peginterferon and ribavirin in difficult-to-treat hepatitis C virus infection. J. Infect. Dis. 204:419–425. [PMC free article] [PubMed]
13. Smith KR, et al. 2011. Identification of improved IL28B SNPs and haplotypes for prediction of drug response in treatment of hepatitis C using massively parallel sequencing in a cross-sectional European cohort. Genome Med. 3:57 doi:10.1186/gm273. [PMC free article] [PubMed]
14. Stattermayer AF, et al. 2011. Impact of IL28B genotype on the early and sustained virologic response in treatment-naive patients with chronic hepatitis C. Clin. Gastroenterol. Hepatol 9:344–350. [PubMed]
15. Suppiah V, et al. 2009. IL28B is associated with response to chronic hepatitis C interferon-alpha and ribavirin therapy. Nat. Genet. 41:1100–1104. [PubMed]
16. Tanaka Y, et al. 2009. Genome-wide association of IL28B with response to pegylated interferon-alpha and ribavirin therapy for chronic hepatitis C. Nat. Genet. 41:1105–1109. [PubMed]
17. Thomas DL, et al. 2009. Genetic variation in IL28B and spontaneous clearance of hepatitis C virus. Nature 461:798–801. [PMC free article] [PubMed]
18. Tillmann HL, et al. 2010. A polymorphism near IL28B is associated with spontaneous clearance of acute hepatitis C virus and jaundice. Gastroenterology 139:1586–1592. [PubMed]
19. Urban TJ, et al. 2010. IL28B genotype is associated with differential expression of intrahepatic interferon-stimulated genes in patients with chronic hepatitis C. Hepatology 52:1888–1896. [PMC free article] [PubMed]

Articles from Journal of Clinical Microbiology are provided here courtesy of American Society for Microbiology (ASM)