PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Mol Biochem Parasitol. Author manuscript; available in PMC 2013 November 1.
Published in final edited form as:
PMCID: PMC3501679
NIHMSID: NIHMS414740

Identification of genes containing ecdysone response elements in the genome of Brugia malayi

Abstract

Recent studies have demonstrated that filarial parasites contain a functional homologue of the insect ecdysone receptor (EcR). As a first step in deciphering the physiological role that ecdysteroids play in filarial parasites, adult female parasites cultured in the presence and absence of 20-OH ecdysone were metabolically labeled. Gel electrophoretic analysis of proteins extracted from the cultured parasites revealed changes in the level of expression of several proteins, indicating that adult female parasites contained an ecdysone-responsive gene network. A bioinformatic analysis was then conducted to identify putative ecdysone response elements (EcREs) in the B. malayi genome. A total of 18 genes were identified that contained putative EcREs located in the 4 kbp upstream from the start of their open reading frames. The most common functional classifications of the encoded proteins were factors involved in transcription and metabolism. These genes revealed a number of different developmental patterns of transcription. The promoter of one EcRE-containing gene was cloned into a luciferase reporter vector and transfected into B. malayi embryos. Reporter gene expression from embryos transfected with this construct was up-regulated by 20-OH ecdysone. Deletion and substitution mutations in the canonical EcRE resulted in a loss of the ecdysone response. These results demonstrate the presence of functional EcREs in the B. malayi genome.

Keywords: filariasis, ecdysone, transfection, promoter

1. Introduction

The human filarial parasites represent a major impediment to global public health. The lymphatic filaria (Wuchereria bancrofti, Brugia malayi and Brugia timori) together infect roughly 4.4 million people worldwide and are estimated to result in the loss of 5.7 million disability adjusted life years [1]. Onchocerciasis, or river blindness, is caused by the filarial parasite Onchocerca volvulus, and historically has represented the second most important cause of infectious blindness worldwide [2]. The significant socio-economic impact of these diseases has attracted the attention of the international community, which is currently supporting several control and elimination programs whose overall goal is to either eliminate the diseases as public health problems or to regionally eliminate the parasites altogether [3]. All of these programs currently rely primarily upon mass distribution of a very limited number of drugs which must be given repeatedly over a prolonged period of time to control transmission. This is logistically difficult and leaves the programs vulnerable to failure if drug resistance develops. Furthermore, some of the drugs used by these programs may induce adverse reactions, complicating their use in mass drug administration programs. For example diethylcarbamazine, while effective against the lymphatic filaria, causes severe reactions in individuals infected with O. volvulus [4], precluding its use in much of Africa where W. bancrofti and O. volvulus are co-endemic. Similarly, ivermectin can cause severe neurological complications in individuals infected with Loa loa, complicating ivermectin distribution for onchocerciasis in much of central Africa, where L. loa is endemic [5]. Thus, there is a need to develop new drugs that can supplement the currently available compounds used to treat these infections.

The filarial parasites are ecdysozoans, a group of organisms whose developmental profile is characterized by a series of molts. The developmental program of the ecdysozoans is not shared with vertebrates, making this process an attractive potential chemotherapeutic target. In insects, molting is controlled through the release of the molting steroid hormone 20-OH ecdysone. 20-OH ecdysone mediates its effect through the ecdysone receptor, a heterodimer consisting of two different members of the zinc finger-containing nuclear hormone receptor family of transcription factors, the ecdysone receptor protein (EcR) and the retinoic acid X receptor (RXR) [6]. Binding of 20-OH ecdysone activates the ecdysone receptor, which then binds to a specific motif (the ecdysone response element [EcRE]) in a number of ecdysone responsive genes, thereby activating transcription of these genes. These in turn control the specific expression of a number of other genes, resulting in the ecdysone cascade, which eventually leads to molting. Mutation of the ecdysone receptor in insects leads to a wide variety of developmental defects, including embryonic and larval lethality, aberrant neuronal remodeling and defects in vitellogenesis [7, 8]. These findings suggest that the EcR is a central developmental regulator in insects, playing a role in embryogenesis and other developmental processes in addition to controlling molting.

The mechanisms controlling the developmental processes of the filarial parasites remain poorly understood. However, several lines of evidence suggest that ecdysone may play important roles in these processes. For example, ecdysone and related compounds (hereafter referred to for simplicity as ecdysteroids) have been found in many parasitic nematodes [9]. Ecdysteroids also have been shown to have developmental effects on parasitic nematodes. For example, ecdysone was shown to stimulate microfilarial release in Brugia pahangi, and to promote embryogenesis in ovaries of Dirofilaria immitis adult females [10]. Finally, two genes encoding orthologues of both partners of the insect ecdysone receptor heterodimer (EcR and RXR) have been recently characterized in B. malayi [11]. The protein encoded by the EcR gene is capable of dimerizing with RXR homologues from B. malayi and other organisms, a property identical to that of the insect EcRs [6]. Finally, synthetic promoter constructs containing a consensus EcRE inserted into a B. malayi ribosomal protein promoter were capable of being induced by 20-OH ecdysone when transfected into B. malayi embryos [11]. Together, these data suggest that B. malayi contains a functional ecdysone regulated developmental pathway.

As a first step in deciphering the physiological role of this ecdysone regulatory pathway in B. malayi, we have studied the effect of ecdysteroid exposure on protein expression in cultured adult female B. malayi and have conducted a bioinformatic analysis of the B. malayi genome to identify endogenous genes containing consensus EcREs. We further demonstrate that a native B. malayi promoter containing an endogenous EcRE is up-regulated by 20-OH-ecdysone, and that the endogenous EcRE is necessary for this ecdysone mediated up-regulation of the promoter.

2. Materials and Methods

2.1 In vivo labeling of B. malayi adult worms

Female B. malayi adults (five per group) were cultured overnight in RPMI 1640 tissue culture medium (Gibco) supplemented with 5% Calf serum and then transferred into 1mL RPMI 1640 methionine-free medium supplemented with 5 μL of 35S-Methionine (50 μCi mL−1, 900–1200 Ci mmol−1, Amersham). The parasites were labeled for 6–8 hrs and 2 μM 20-OH ecdysone in 50% ethanol was added to the culture medium. Control parasite preparations received an equivalent volume of 50% ethanol alone. The parasites were incubated for one additional hour, washed in phosphate buffered saline (PBS) and homogenized in a glass homogenizer in PBS, 0.4% NP-40. After centrifugation to remove insoluble material the proteins were prepared for 2D polyacrylamide gel electrophoresis in 25×25 cm gels as directed by the manufacturer (ESI Genomic systems). The gels were incubated in Amplify enhancer (Amersham) and exposed to X Ray film overnight at −70°C.

2.2 Identification of genes containing endogenous EcREs

B. malayi genome contigs ≥200 kbp in size were searched for the canonical EcRE motif using Pattern Locator [12]. The EcRE motif pattern was defined as the inverted repeat RGGTCA(N)[1]{-6-5-4-3-2-1}[1], i.e. (A/G)GGTCA separated by any one nucleotide followed by the perfect or imperfect (allowing for one mismatch) reverse complement of (A/G)GGTCA. A total of 27 motifs were found matching these criteria. These 27 motifs were mapped in the genome to identify predicted genes flanking the EcRE sites. The EcREs were further filtered to include only those which were located < 4 kbp upstream of the start of a putative open reading frame. A total of 18 EcREs met this criterion. The genes associated with these EcREs were assigned to different functional categories according to the descriptions of the gene given in their gene ontology (GO) classifications and the gene descriptions provided by the NCBI gene website (http://www.ncbi.nlm.nih.gov/gene).

Developmental profiles for each of the EcRE genes were extracted from the reads per kilobase of exon model per million mapped reads (RPKM) normalized data from a recent deep sequencing analysis of the transcriptome of B. malayi [13]. The RPKM normalized sequence reads for each gene were then summed for all life cycle stages examined and the sum used to normalize the relative expression level for each gene in each lifecycle stage.

2.3 Cloning and mutagenesis of the Bm_48650 promoter

The region located from positions −1 to −2006 relative to the start of the Bm1_48650 ORF was amplified from B. malayi genomic DNA using the primers Bm48650 c -2006 (5′-AAGCTTGTGTTATTTTAGGCGTTATCAAGTTG-3′ and Bm48650 nc -1 (5′-AAGCTTAGGAGACGTATAAGGATCTAAGACAAC-3′). The primers contained synthetic Hind III sites (underlined) to facilitate subsequent sub cloning. Amplification conditions were as previously described [14]. The resulting amplicon was cloned into the pCR 2.1 cloning vector, and the sequence of the cloned product confirmed. The insert was then excised from the plasmid and sub-cloned into the Hind III restriction site in the luciferase reporter vector pGL3 basic (Promega, Madison, WS). This clone was designated Bm_48650 (−2006 to −1)/luc.

The putative EcRE in the Bm1_48650 promoter was mutated using the Gene Tailor in vitro mutagenesis system (Invitrogen) as previously described [14]. In brief, overlapping primers 5′ GTTTATTTAATAAGAAGGAACATCTCAGAGTACGTCGACTTGAATGT -3′ and 5′-TTCCTTCTTATTAAATAAACACTTTCTGCTA -3 were prepared spanning the putative EcRE in the Bm1_48650 promoter (positions −1858 to −1846 relative to the start of the ORF) and replacing the sequence of the EcRE (5′ AGGTCATTGACCT 3′) with the sequence 5′ CATCTCAGAGTAC 3′. These primers were used to produce a mutant promoter sequence, employing Bm_48650 (−2006 to −1)/luc as a template, following the manufacturer’s instructions. The sequences of the plasmids in the resulting mutagenized colonies were confirmed by DNA sequencing. Mutants encoding imperfect palindromes were prepared using the same protocol employing primers encoding the corresponding polymorphic residues.

2.4 Transient transfection and analysis of reporter activity

Isolated B. malayi embryos were transfected and promoter activity assayed by luciferase activity as previously described [15]. In brief, embryos were isolated from gravid female parasites and biolistically transfected with DNA-coated gold beads. Transfected embryos were maintained in culture in the presence or absence of 5 μM 20-OH ecdysone for 48 hours before being assayed for transgene activity. All assays were carried out using the dual luciferase format, in which the beads used to transfect the embryos were coated with the experimental construct driving the expression of the firefly luciferase reporter gene and a constant amount of a construct consisting of the BmHSP70 promoter driving the expression of a renilla luciferase reporter gene (Construct BmHSP70(−659 to −1)/ren)[15] as an internal control. Firefly luciferase activity was normalized to the amount of renilla luciferase activity in each sample to control for variations in transfection efficiency. Firefly/renilla luciferase activity ratios for each sample were further normalized to the activity ratio found in embryos transfected in parallel with the wild type promoter cultured in the absence of 20-OH ecdysone. This permitted comparisons of data collected in experiments carried out on different days. Each construct was tested in two independent experiments, with each experiment containing three independent transfections of each construct to be analyzed. The statistical significance of the differences in activity were determined using Dunnett’s test, as previously described [16].

3. Results

In order to extend earlier observations on the biological effects of ecdysteroids in filarial parasites in vivo, 2D gel electrophoretic analysis of B. malayi adult female parasites which had been metabolically labeled with 35-S-Methionine was performed. A brief exposure to 20-OH-ecdysone caused a number of identifiable changes in global protein expression denoting either induction or suppression of expression, or potentially other post-translational modifications (Figure 1). These data demonstrated that ecdysone treatment resulted in the modification of expression of a number of proteins in adult female parasites, suggesting that genes expressed in the adult female parasites were responsive to ecdysone treatment.

Figure 1
Analysis of protein expression in adult female parasites cultured in the presence and absence of 20-OH-ecdysone

A total of 18 genes with putative EcREs located within 4kbp of the start of their predicted open reading frames were identified from a screen of contigs ε 200 kbp in size in the B. malayi genome sequence database (Table 1). These genes were classified into a number of functional categories. Apart from the proteins which could not be classified, the most common classifications were genes involved in metabolism and transcription (Table 1). The relatively high representation of transcriptional factors was in keeping with the fact that in insects, many of the initial genes activated by the EcR are transcriptional regulators responsible for activating transcription of the downstream genes in the ecdysone cascade [17].

Table 1
B. malayi Genes containing Putative EcREs

The developmental profile of the transcription of the 18 genes containing putative EcREs were explored using data from a previously published deep sequence analysis of different lifecycle stages of B. malayi [13]. The genes could be divided into 5 different transcriptional profiles. Seven genes appeared to be transcribed relatively equally in all life cycle stages (Table 1), while 4 genes were transcribed primarily in adult female parasites with some transcripts detected in the larval stages (Table 1). Three genes exhibited a bimodal pattern, with peaks in adult females and associated eggs and embryos and in mature mf (Table 1). Two genes exhibited a bimodal pattern with peaks in adult and larval stages (Table 1), while one gene was transcribed almost exclusively in adult males (Table 1).

The upstream domain of gene BM1_48650 was chosen for further study. Bm1_48650 was chosen because it encoded a zinc finger domain (characteristic of a transcription factor) and it exhibited a pattern of transcription that was similar to that seen with the BmEcR (Bm_46530; Figure 2). Roughly 2 kbp of the sequence located upstream of the start of the ORF was cloned into a firefly luciferase reporter vector and tested for promoter activity in transiently transfected B. malayi embryos cultured in the presence and absence of 20-OH ecdysone, as described in Materials and Methods. The Bm1_48650 sequence exhibited promoter activity in this system, and this activity was increased in embryos cultured in the presence of 20-OH ecdysone (Figure 3). Mutation of the putative EcRE in the BM1_48650 promoter (located −1858 to −1846 relative to the start of the ORF) eliminated the response to 20-OH ecdysone, while not affecting the activity of the promoter in embryos cultured in the absence of the hormone (Figure 3).

Figure 2
Developmental profiles of mRNA levels of Bm1_48650 and the B. malayi EcR homologue Bm1_46530
Figure 3
Expression of luciferase in B. malayi embryos transfected with native and mutant Bm1_48650 (−2006 to −1)/luc in the presence and absence of 20-OH ecdysone

Among the 18 genes in which putative EcREs were identified, several encoded putative EcREs with polymorphisms in the central nucleotide at position 7 separating the two halves of the palindrome (Figure 4, Panels A and B). In addition, of the 18 genes found to contain a putative EcRE in their upstream domains, only two (BM1_48635 and BM1_48650) contained a perfect match to the canonical EcRE palindrome. The remaining genes encoded imperfect palindromes (Figure 4). To determine if these imperfect palindromes encoded active EcREs, the EcRE in the BM1_48650 construct was mutated to the imperfect palindromes present in the other genes. Mutants were constructed representing imperfect palindromes present in two or more of the genes identified in the analysis described above. The central T residue in Bm1_48650 was also mutated to a C to test the effect of polymorphisms in this position. These mutants were then transiently transfected into B. malayi embryos. The transfected embryos were then cultured in the presence and absence of 20-OH ecdysone and the amount of luciferase produced in each culture determined. Mutation of the central T residue at position 7 had no effect on the ecdysone response (Figure 5). In contrast, none of the mutants resulting in imperfect palindromes were responsive to 20-OH ecdysone, suggesting that the B. malayi EcR recognized only a perfect palindromic sequence corresponding to that found in the canonical EcRE (Figure 5).

Figure 4
Sequence of putative EcREs identified in the upstream domains of B. malayi genes
Figure 5
Analysis of ecdysone responsiveness in mutant constructs of Bm1_48650 containing imperfect palindromes

4. Discussion

Previous studies have demonstrated that a homologue of the ecdysone receptor exists in B. malayi and other filarial parasites, and that reporter gene expression from a ribosomal protein promoter modified to contain a synthetic EcRE was increased in transiently transfected embryos cultured in the presence of 20-OH ecdysone [11]. These studies strongly suggested that an ecdysone responsive regulatory pathway exists in B. malayi. However, ecdysone is involved in the regulation of many different developmental pathways in insects, including embryogenesis, vitellogenesis and molting [7, 8]. In contrast, the physiological role of the ecdysone receptor in filarial parasites remains obscure. The biochemical and bioinformatic analyses carried out here provide some preliminary information regarding the physiological role that the ecdysone mediated regulatory pathway may play in B. malayi. First, ecdysone treatment of adult female parasites in culture resulted in changes in expression of ca. 30 different proteins as analyzed by metabolic labeling and 2D gel electrophoresis (Figure 1). Together with previous studies that demonstrated that reporter gene expression in isolated embryos transiently transfected with a construct containing a synthetic EcRE was up-regulated when the embryos were cultured in the presence of 20-OH ecdysone [11], these studies demonstrate that a functional ecdysone responsive pathway is present in adult female parasites and their associated immature embryos.

Using a pattern location algorithm to screen B. malayi contigs > 200 kb, we identified 18 genes that contained putative EcREs. However, because this analysis was restricted to contigs >200 kbp, the catalog of genes containing putative EcREs described here is likely to be incomplete. For example, the B. malayi genome encodes a homologue of E75A, which in insects is a transcription factor that is directly activated by the EcR and is an early regulator in the ecdysone cascade [18]. However, the gene encoding the E75A homologue is currently not in a large contig, and was thus not examined for the presence of an EcRE in its promoter region as part of this analysis. As a more complete assembly of the B. malayi genome becomes available, it will be possible to conduct a more thorough survey of genes containing putative EcREs. In addition, chromatin immunoprecipitation – deep sequencing (ChIP-Seq) [19] employing antibodies raised against the BmEcR could be used to precisely the recognition sites of the receptor in adult females, where sufficient biological material is available to carry out such studies.

Mutational analyses of the Bm1_48650 promoter demonstrated that while mutations in the single nucleotide separating the halves of the EcRE palindrome did not affect the element’s activity, a perfect match to the canonical palindrome was necessary to confer ecdysone responsiveness in B. malayi embryos. These data suggest that the BmEcR will only recognize a perfect palindromic sequence. Alternatively, it is possible that BmEcR EcRE recognition is dependent upon the context in which the element is found. Thus, while the imperfect palindromes present in some EcREs were inactive when inserted in the Bm1_48650 promoter (which normally contains a perfect palindrome), they might be active when presented in the context of their native promoter sequence. Experiments testing the ecdysone responsiveness of the native promoter sequences containing imperfect palindromes will be necessary to answer this question.

Previous northern blot based studies of the expression of the B. malayi EcR have suggested that the receptor was highly expressed in adult females, and expressed to a lesser extent in microfilaria and adult males [11]. The transcriptomic data analyzed here confirm and augment this pattern of expression. As expected, sequence tags derived from the Bm EcR were most abundant in adult females, and are also found in mf and adult males. However, the transcriptomic data also indicate that the Bm EcR is also expressed in isolated eggs and embryos and in the L3 or L4 larvae, stages not examined in the previous northern blot studies (Figure 2). This developmental profile suggests that the Bm EcR may be involved in regulating multiple developmental processes, including embryogenesis and molting in the larval stages. Additional studies exploring the pathways and gene networks which are up-regulated in parasites from different life cycle stages in response to 20-OH ecdysone treatment would be useful in further defining the role that ecdysteroids play in B. malayi development.

Ecdysone-mediated developmental pathways are essential to the ecdysozoans, while similar pathways are completely lacking in mammals. Indeed, this pathway has already been exploited by the agricultural industry, which has developed new insecticides that very specifically target certain insect pests, while exhibiting very low toxicity against mammals [2022]. The demonstration of functional ecdysone-mediated transcriptional regulatory pathways in the filariae holds great potential for the development of novel anti-filarial drugs that could be used to supplement or replace those agents currently employed by the control and elimination programs worldwide.

Highlights

  1. Protein expression is modified in adult B. malayi exposed to ecdysone.
  2. Some B. malayi promoters contain putative ecdysone response elements.
  3. Common functional classifications of these genes were transcription and metabolism.
  4. One promoter containing an ecdysone response element was up-regulated by ecdysone.
  5. Ecdysone up-regulation of this gene required the ecdysone response element.

Acknowledgments

We thank Dr. Naomi Lang-Unnasch for critically reviewing the manuscript. Parasite material used in this study was obtained through the Filariasis Research Reagent Resource Center (FR3), Division of Microbiology and infectious Diseases, NIAID, NIH. This work was supported by a grant from the US National Institute of Allergy and Infectious Disease (Project # R01AI048562) to TRU.

Abbreviations

EcR
Ecdysone receptor protein
EcRE
Ecdysone response element
mf
microfilariae
kbp
kilobase pairs
PBS
phosphate buffered saline
RXR
retinoic acid X receptor
RPKM
reads per kilobase of exon model per million mapped reads

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

1. Mathers CD, Ezzati M, Lopez AD. Measuring the burden of neglected tropical diseases: The global burden of disease framework. PLoS Negl Trop Dis. 2007;1:e114. [PMC free article] [PubMed]
2. Thylefors B. Ocular onchocerciasis. Bull WHO. 1978;56:63–72. [PubMed]
3. Cupp EW, Sauerbrey M, Richards F. Elimination of human onchocerciasis: History of progress and current feasibility using ivermectin (Mectizan®) monotherapy. Acta Trop. 2011;120 (Suppl 1):S100–8. [PubMed]
4. Awadzi K. Clinical picture and outcome of serious adverse events in the treatment of onchocerciasis. Filaria J. 2003;2:S6. [PMC free article] [PubMed]
5. Twum-Danso NA. Serious adverse events following treatment with ivermectin for onchocerciasis control: A review of reported cases. Filaria Journal. 2003;2:S3. [PMC free article] [PubMed]
6. Thomas HE, Stunnenberg HG, Stewart AF. Heterodimerization of the Drosophila ecdysone receptor with retinoid X receptor and ultraspiracle. Nature. 1993;362:471–5. [PubMed]
7. Carney GE, Bender M. The Drosophila ecdysone receptor (EcR) gene is required maternally for normal oogenesis. Genetics. 2000;154:1203–11. [PubMed]
8. Schubiger M, Wade AA, Carney GE, et al. Drosophila EcR-β ecdysone receptor isoforms are required for larval molting and for neuron remodeling during metamorphosis. Development. 1998;125:2053–62. [PubMed]
9. Franke S, Kauser G. Occurrence and hormonal role of ecdysteroids in non-arthropods. In: Koolman J, editor. Ecdysone: From chemistry to mode of action. New York: Georg Theine Verlag; 1989. pp. 296–307.
10. Barker GC, Mercer JG, Rees HH, et al. The effect of ecdysteroids on the microfilarial production of Brugia pahangi and the control of meiotic reinitiation in the oocytes of Dirofilaria immitis. Parasitol Res. 1991;77:65–71. [PubMed]
11. Tzertzinis G, Egana AL, Palli SR, et al. Molecular evidence for a functional ecdysone signaling system in Brugia malayi. PLOS Neglected Tropical Diseases. 2010;4:e625. [PMC free article] [PubMed]
12. Mrazek J, Xie S. Pattern locator: A new tool for finding local sequence patterns in genomic DNA sequences. Bioinformatics. 2006;22:3099–100. [PubMed]
13. Choi YJ, Ghedin E, Berriman M, et al. A deep sequencing approach to comparatively analyze the transcriptome of lifecycle stages of the filarial worm, Brugia malayi. PLoS Negl Trop Dis. 2011;5:e1409. [PMC free article] [PubMed]
14. Liu C, Chauhan C, Katholi CR, et al. The splice leader addition domain represents an essential conserved motif for heterologous gene expression in B. Malayi. Mol Biochem Parasitol. 2009;166:15–21. [PMC free article] [PubMed]
15. Shu L, Katholi C, Higazi T, et al. Analysis of the Brugia malayi HSP70 promoter using a homologous transient transfection system. Mol Biochem Parasitol. 2003;128:67–75. [PubMed]
16. Higazi TB, DeOliveira A, Katholi CR, et al. Identification of elements essential for transcription in Brugia malayi promoters. J Mol Biol. 2005;353:1–13. [PubMed]
17. Baehrecke EH. Ecdysone signaling cascade and regulation of Drosophila metamorphosis. Arch Insect Biochem Physiol. 1996;33:231–44. [PubMed]
18. Lam GT, Jiang C, Thummel CS. Coordination of larval and prepupal gene expression by the dhr3 orphan receptor during Drosophila metamorphosis. Development. 1997;124:1757–69. [PubMed]
19. MacQuarrie KL, Fong AP, Morse RH, et al. Genome-wide transcription factor binding: Beyond direct target regulation. Trends Genet. 2011;27:141–8. [PMC free article] [PubMed]
20. Nakagawa Y. Nonsteroidal ecdysone agonists. Vitam Horm. 2005;73:131–73. [PubMed]
21. Soin T, Swevers L, Kotzia G, et al. Comparison of the activity of non-steroidal ecdysone agonists between dipteran and lepidopteran insects, using cell-based ecr reporter assays. Pest Manag Sci. 2010;66:1215–29. [PubMed]
22. Borchert DM, Walgenbach JF, Kennedy GG, et al. Toxicity and residual activity of methoxyfenozide and tebufenozide to codling moth (lepidoptera: Tortricidae) and oriental fruit moth (lepidoptera: Tortricidae) J Econ Entomol. 2004;97:1342–52. [PubMed]