PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
J Neurosci. Author manuscript; available in PMC 2012 November 13.
Published in final edited form as:
PMCID: PMC3496384
NIHMSID: NIHMS251603
Flotillin-mediated endocytic events dictate cell-type specific responses to Semaphorin 3A
Ioana Carcea,1 Avi Ma'ayan,2 Roxana Mesias,1 Bryan Sepulveda,1 Stephen R. Salton,1* and Deanna L. Benson1
1Fishberg Department of Neuroscience and Friedman Brain Institute, Mount Sinai School of Medicine, 1425 Madison Avenue, New York, NY 10029
2Department of Pharmacology and System Therapeutics, Mount Sinai School of Medicine, 1425 Madison Avenue, New York, NY 10029
Corresponding Author: Deanna L. Benson, Fishberg Department of Neuroscience, Box 1065, The Mount Sinai School of Medicine, 1425 Madison Ave., New York, NY 10029, Tel.: (212) 659-5906; Fax: (212) 996-9785, deanna.benson/at/mssm.edu
Cortical efferents growing in the same environment diverge early in development. The expression of particular transcription factors dictates the trajectories taken presumably by regulating responsiveness to guidance cues via cellular mechanisms that are not yet known. Here we show that cortical neurons that are dissociated and grown in culture maintain their cell-type specific identities defined by the expression of transcription factors. Using this model system we sought to identify and characterize mechanisms that are recruited to produce cell-type specific responses to Semaphorin 3A (Sema3A), a guidance cue that would be presented similarly to cortical axons in vivo. Axons from presumptive corticofugal neurons lacking the transcription factor Satb2 and expressing Ctip2 or Tbr1 respond far more robustly to Sema3A than those from presumptive callosal neurons expressing Satb2. Both populations of axons express similar levels of Sema3A receptors (Neuropilin-1, L1CAM and PlexinA4), but significantly, axons from neurons lacking Satb2 internalize more Sema3A and they do so via a raft-mediated endocytic pathway. We used an in silico approach to identify the endocytosis effector Flotillin-1 as a Sema3A signaling candidate. We tested the contributions of Flotillin-1 to Sema3A endocytosis and signaling, and show that raft-mediated Sema3A endocytosis is defined by and depends on the recruitment of Flotillin-1, which mediates LIMK activation, and regulates axon responsiveness to Sema3A in presumptive corticofugal axons.
Keywords: axon guidance, growth cone, transcription factors, uptake, rafts, cytoskeleton
In the cerebral cortex, pyramidal neurons initiate their axonal trajectories beneath the cortical plate contemporaneous with neural migration. The path that axons take and their final destination characterize distinct neuron types, such that populations of pyramidal neurons that send axons across the corpus callosum to innervate contralateral cortical targets are distinct from those that send axons to subcortical targets. Thus, cortical axons within a shared environment must display differential sensitivities to cues in order to generate distinct trajectories.
Semaphorin3A (Sema3A) is a potent guidance cue that can repel cortical axons (Bagnard et al., 1998; Castellani et al., 2000). Its localization within the developing neuroepithelium suggests that all cortical projections are exposed to the cue (Skaliora et al., 1998), but in vitro assays show that responses are not uniform (Mintz et al., 2008) and in vivo analyses suggest that responses may change over the course of development (Behar et al., 1996; Taniguchi et al., 1997; Campbell et al., 2001; Sibbe et al., 2007; Chen et al., 2008b). In cortical neurons, in order to transmit repelling signals to the cytoskeleton, the Sema3A receptor, Neuropilin 1(Npn1) utilizes a Plexin A4 (PlxA4) co-receptor (Tamagnone et al., 1999; Suto et al., 2005; Yaron et al., 2005). PlxA activation can initiate a variety of signals that converge on actin severing or depolymerization (Aizawa et al., 2001; Terman et al., 2002; Toyofuku et al., 2005). The actions of additional co-receptors are required to generate full responsiveness (Maness and Schachner, 2007; Law et al., 2008), and in cortical neurons, Sema3A-mediated repulsion requires Npn1 binding to the cell adhesion molecule L1CAM (Castellani et al., 2000). The signaling pathways initiated by L1CAM in response to Sema3A include a FAK--MAP kinase cascade (Bechara et al., 2008) and regulated interactions between ERM (ezrin, radixin and moesin) proteins and the actin cytoskeleton (Mintz et al., 2008). Differential receptor/co-receptor expression would be an obvious mechanism for generating cell type specific responses, but mRNAs encoding Npn1, L1CAM and PlxA4 are expressed in nearly all developing cortical neurons, making this unlikely (Perala et al., 2005; Morita et al., 2006), GenePaint database, Allen Brain Atlas). Alternate mechanisms have not been identified.
Several cell types can selectively internalize receptors to regulate responsiveness to ligands, including guidance cues (Hong et al., 1999; Piper et al., 2005). We hypothesized that receptor internalization could be employed selectively to gate responsiveness to Sema3A in different populations of cortical axons. We took advantage of previous work that has defined cortical neuron populations based on the selective expression of transcription factors (Arlotta et al., 2005; Britanova et al., 2005) in order to generate an in vitro assay in which we could identify cell-type specific responses to Sema3A and test the underlying mechanisms. We show that axons from cortical neurons lacking the callosal projection neuron marker, Satb2, are more responsive to Sema3A and that this selective response requires Sema3A internalization via a lipid raft and Flotillin-dependent, dynamin-independent pathway that activates LIM kinase (LIMK). These findings extend earlier studies documenting the significance of membrane microdomains for guidance receptor signaling (Guirland et al., 2004) and further define an adaptable molecular pathway that can be employed to generate cell type specific responses.
Dissociated cortical cultures
All use of animals conformed to guidelines established by Mount Sinai's Institutional Animal Care and Use Committee and those of NIH. Cortical neurons were cultured as previously described (Mintz et al., 2008). Briefly, pregnant Sprague Dawley rats were sacrificed by CO2 exposure and the embryos removed from the uterus at embryonic day 18 (E18). The presumptive embryonic somatosensory cortex was dissected out in cold BSS (1xHBSS, 1%HEPES, 1%PenStrep) and digested for 15 minutes at 37°C in 0.25% trypsin (Invitrogen, Grand Island, NY). The tissue was then triturated to a single-cell suspension and plated on poly-L-Lysine coated glass coverslips at a density between 20,000-40,000 cells per coverslip. Neurons were allowed to adhere for about three hours in media containing 10% fetal bovine serum and then they were transferred to Neurobasal Media containing B27 (Invitrogen) or NS21 (Chen et al., 2008c).
Ex-utero electroporation (adapted after (Hand et al., 2005)
Rat embryos were removed from the uterus at either E15 or E17 and a mix of YFP plasmid and Fast Green (1:20) was injected in the right lateral ventricle, using a pulled glass electrode. Approximately 5 μg of DNA were injected in each brain. Four 50 ms pulses of 40V were applied at 950 ms intervals to the head of the embryo with the positive electrode placed on the right side. The somatosensory cortex was then dissected in cold BSS and cultured as described above.
Plasmids and RNAi
Except for ex-utero electroporation experiments, plasmids and RNAi were introduced into cortical neurons immediately after dissociation using the Amaxa Nucleoporator. The following plasmids were used: YFP: pEYFP-N1 (BD Biosciences, San Jose, CA); Dynamin K44A in the pEGFP vector (gift from Dr. Pietro DeCamilli, (Takei et al., 1999); Flot1 shRNAs (AGAGAAGGCCCAGCTGATCAT, CCTGACCTCAGCCAATAAGAT and AGCTACACTTTGAAGGATATT) were purchased from SA Biosciences (Frederick, MD). The control sequence was GGAATCTCATTCGATGCATAC. The plasmid also expresses GFP to detct transfected cells.
Reagents and Antibodies
Recombinant mouse Sema3A fused to a human Fc fragment was purchased from R&D Systems (Minneapolis, MN, for concentrations used see below). Filipin, monodansyl cadaverine (MDC) and dynasore (Sigma, St.Louis, MO) were used at 1μg/ml, 10μM and 80μM, respectively. The src family kinase inhibitor SU6656 (Sigma) was used at 10μM. Phalloidin, conjugated with Oregon Green, Texas Red or Alexa 647 fluorophores, was purchased from Invitrogen and used at 2U/ml. 655 nm Q-dot conjugated F(ab) anti human-Fc were purchased from Invitrogen and used as described below.
The following primary antibodies were used: mouse anti-Satb2 (Abcam, Cambridge, MA,1:400), rabbit anti-Ctip2 (Novus Biologicals, Littleton, CO, 1:100), chick anti-GFP (recognizes YFP as well, Aves, Tigard, OR, 1:4000), rabbit anti-Npn-1 (Zymed, South San Francisco, CA, 1:100), rabbit anti-PlxA4 (Abcam, 1:50), mouse anti-L1CAM (Abcam 1:500), rabbit anti-Flotillin-1 (Abcam 1:100), mouse anti-Flotillin-1 (BD Biosciences, San Jose, CA, 1:50), mouse anti-Flotillin-2 (BD Biosciences, San Jose, CA, 1:50), rabbit anti-LIMK (Abcam, 1:100) and phospho-LIMK (Abcam, 1:50). All fluorophore-conjugated secondary antibodies were from Jackson Immunoresearch (West Grove, PA) and were used at dilutions between 1:200-1:400.
Collapse assay
For the live collapse assay, neurons were plated in glass-bottom dishes and imaged on an Olympus inverted microscope equipped with a live-cell imaging chamber that maintained the environment at 37°C and 5% CO2. After the chamber equilibrated, control media was added and growth cones imaged for 30 minutes followed by 100μg Sema3A-Fc for another 30 minutes. The neurons were then fixed and processed for Satb2 immunolabeling as described below. Movies were analyzed and quantified blind to the results of post-hoc immunocytochemistry. Growth cones that retracted or collapsed only during the Sema3A exposure but not during the initial control incubation were considered collapsed. For fixed preparations, an equal number of coverslips were incubated in control media or in 100μg Sema3A-Fc media for 30 minutes, then fixed and immunolabeled. The coverslips were imaged on a Zeiss Axiophot microscope (Thornwood, New York) and the collasped growth cones counted blind to the conditions. Specific inhibitors were added 15 minutes before and remained during the exposure to Sema3A.
Patterned substrates
Alternating stripes of Sema3A and control Fc fragment were prepared on glass coverslips that had been coated first with 1mg/ml PLL and then with anti-human Fc antibody (Sigma, B3773, 1:1000). Silicon matrices with alternating 100μm channels were stamped on top of the coated coverslips and a solution of 4μg/ml recombinant Sema3A fused human Fc was injected in the channels of this matrix (purchased from Dr. Susan Lang (Knoll et al., 2007). The fusion protein was allowed to bind the substrate overnight at 4°C and then the matrix was removed. After washing, the coverslips were incubated with 10 μg/ml solution of Cy3 conjugated human Fc fragment for 2 hours at room temperature. The fluorescent Fc fragment binds to the unoccupied anti-Fc antibodies, highlighting the interstripes. For clarity, the colors were inversed in the final images such that the Sema3A stripes appear red and the control stripes black.
Sema3A-Qdot uptake
100μg/mL recombinant mouse Sema3A-human Fc chimera was mixed 10:1 with a 1μM solution of Qdot conjugated anti-human Fab fragment, and incubated for 1-3 hours at RT in the dark. The mix was then resuspended in home media for a final concentration of 4μg/ml Sema3A. Cortical neurons plated in glass bottom dishes were first washed in warm L15 media and then incubated with about 75μl of Sema3A-Qdot mix for 30 minutes at 37°. When endocytosis was blocked, specific inhibitors were added 15 minutes before and during the entire incubation with Qdot conjugated Sema3A. Neurons were then washed once with warm L15 (for 1 min) and then acid stripped with pH=2 DMEM (Invitrogen) for 1-2 min (Yap et al., 2008a). The neurons were washed three more times with warm L15 media (Invitrogen) and then fixed with 4% paraformaldehyde PFA and 4% sucrose for 5 min. They were placed in cold PBS and imaged soon thereafter.
Immunolabeling
Cultured neurons were fixed in 4% PFA, 4% sucrose for 10 min at RT or 2% PFA, 2% sucrose for 20 min (non-permeabizing conditions; (Kamiguchi and Lemmon, 2000; Wisco et al., 2003). For intracellular antigens neurons were permeabilized with 0.1% Triton X-100 (Sigma) for 1 min at RT. Non-specific binding was blocked by incubation in 10% bovine serum albumin (BSA, Sigma) for 1h, RT. Primary antibodies were diluted in 1% BSA to the appropriate concentration and incubated for 12 hours at 4°C or 2-3 h, RT. After washing the coverslips in PBS, fluorophore-conjugated secondary antibodies were diluted in PBS and added for 1h, RT in the dark. The coverslips were then washed and mounted on slides using Mowiol.
Embryonic brains were collected at E14.5, fixed in fresh 4%PFA for 12 h at 4°C and cryoprotected in 30% sucrose. 50μm thick sections werecut on a cryostat and mounted on charged slides. The sections were blocked in 3% BSA or 3% normal goat serum (NGS) for 1h at RT. Primary antibodies were then added in 0.5% BSA or NGS for 12-48 h at 4°C. The sections were washed 3 times in PBS and fluorophore-conjugated secondary antibodies were added at the appropriate concentration for 1 h at RT. After washing in PBS, the sections were coverslipped in Vectashield (Vector Labs).
Image acquisition
Images were acquired on a Zeiss 510 laser scanning confocal microscope, unless specified otherwise. The objectives used were 20×, 40× and 100×, depending on the assay; larger fields were acquired using a tiling function. For measurements of axonal length, images were imported into Neurolucida, axons were traced in their entirety, and the measurements were analyzed using Neuroexplorer (Microbrightfield, Williston, VT). For Ctip2 overexpressing neurons axons were measured in Image J (Rasband, 1997-2009). All statistical analyses were made using Prism (Irvine, CA).
Cortical projection neurons maintain their identities in dissociated cultures
Projection neurons sharing particular pathways and targets can be identified in vivo by their expression of particular transcription factors. Satb2 is expressed in the majority of callosal projection neurons, while Ctip2 or Tbr1 are expressed in neurons sending axons to subcortical targets (Arlotta et al., 2005; Chen et al., 2005; Alcamo et al., 2008; Britanova et al., 2008; Chen et al., 2008a). To assess whether cortical neurons maintain their identities in culture we immunolabeled for Satb2 and Ctip2 at the time of plating and after 2, 4 or 6 days in culture. The percentage of neurons immunolabeled for Satb2 (Satb2pos) steadily increases from 26% immediately after plating to a maximum of 62% at four days in vitro (DIV) after which it rapidly diminishes (Fig.1A,B). Satb2pos neurons show little to no labeling for either Ctip2 or Tbr1, which are expressed in a much lower proportion of cortical neurons (20% and 12% at 4div, respectively: Fig.1A,B). The gradual increase in Satb2 expression in postmitotic neurons, its exclusion from neurons labeled for Ctip2 or Tbr1, and its subsequent loss closely resemble in vivo observations (Alcamo et al., 2008; Britanova et al., 2008). The interval defining stable Satb2 expression, between 2 and 4 DIV, was used for all subsequent experiments.
Figure 1
Figure 1
Cortical neurons maintain their identity in dissociated cultures
All axons projecting corticofugally originate in deep cortical layers 5 and 6, whereas neurons having callosal projections reside mainly in superficial layers 2/3 and in layer 5a. We asked whether transcription factor expression in cultured neurons also reflects appropriate laminar destiny. In order to visualize lamina-specific cortical neurons in culture, ex-utero electroporation (EUE, see methods) was used to deliver yellow fluorescent protein (YFP) into progenitors of the ventricular zone at embryonic day (E)15.5, when layer 5 neurons are born in the rat somatosensory cortex, or E17.5, when layer 2/3 neurons are born (Bayer and Altman, 1990; Koester and O'Leary, 1994); cortices were dissociated immediately thereafter, cultured for 3 days, and then immunolabeled for transcription factors. Quantitative analysis indicates that half of the E15-born neurons express Satb2 (Fig.1C,E) and many neurons lacking Satb2 (Satb2neg) express Ctip2. In contrast, nearly 80% of the E17-born neurons express Satb2 (Fig 1D,E) and none express Ctip2 alone. These results are consistent with observations in vivo (Britanova et al., 2008). Thus, cortical neurons express and continue to develop key cell-type specific characteristics when grown in culture, providing a tractable model system in which cell biological mechanisms contributing to cell-type specific responses can be identified and evaluated.
Satb2neg neurons respond more robustly to Sema3A
We asked whether Sema3A differentially affects axonal growth from cortical neuron populations defined by Satb2. Layer 5 neurons were labeled with YFP using EUE at E15, dissociated and exposed to Sema3A for 72h, and then immunolabeled for Satb2. Axonal growth was compared quantitatively by tracing axons in their entirety. The data show that E15-born Satb2neg neurons have significantly shorter axons when grown in the presence of Sema3A compared to control conditions (Fig.2 A, B), and consistent with previous work (Dent et al., 2004) axon branching is diminished (30% reduction in branch number relative to control). In contrast, Sema3A has no significant effect on the length of axons originating from E17-born neurons, the vast majority of which express Satb2 (ANOVA, p > 0.05; n=50).
Figure 2
Figure 2
Sema3A triggers distinct responses in two populations of cortical neurons
Acute exposure to Sema3A can produce growth cone collapse (Luo et al., 1993). To compare growth cone collapse in Satb2pos and Satb2neg neurons, axonal growth cones were imaged for thirty minutes before and following addition of Sema3A-Fc, after which cell bodies were immunolabeled post-hoc for Satb2. A significantly greater proportion of Satb2neg neurons show growth cone collapse (Fig. 2C and legend).
Sema3A binds chondroitin sulfate proteoglycans and thus may be presented to neurons as part of the extracellular matrix rather than as a soluble cue (de Wit and Verhaagen, 2003). To test whether cortical axon populations respond differentially to a substrate of Sema3A, we plated neurons on stripes of Sema3A-Fc alternating with control Fc stripes. A comparison of the number of border crossings shows that axons of Satb2neg neurons avoid Sema3A stripes while axons of Satb2pos neurons grow equally well on Sema3A and control stripes (Fig.2D,F).
The data indicate that axons of Satb2neg neurons respond more robustly to the repulsive effects of Sema3A than axons of Satb2pos neurons. We next tested whether this difference is dictated by the restricted expression of transcription factors. Overexpression of Satb2 would be predicted to reduce responsiveness to Sema3A, but it also increases cell death and could not be used for this. In mice lacking Satb2, Ctip2 expression is permitted in layer 2/3 neurons, many of which send axons inappropriately to subcortical targets (Alcamo et al., 2008; Britanova et al., 2008). With this in mind, we asked whether Ctip2 overexpression in a mixed population of cortical neurons (Satb2pos and Satb2neg) would increase responsiveness to Sema3A. The data show that Ctip2-overexpression increases axon outgrowth over 72h and that Sema3A abrogates this effect (Supplementary Fig. 1). Moreover, in a stripe assay we see that axons of Ctip2 overexpressing neurons avoid Sema3A stripes (Fig.2E,F). Thus, Ctip2 expression enhances axon responsiveness to Sema3A.
All cortical neurons express similar levels of Sema3A receptors
Guidance cue responsiveness can be regulated by selective expression of receptors and co-receptors (Hong et al., 1999; Liu et al., 2005; Chauvet et al., 2007). While all cortical neurons express Npn1, PlexA4 and L1CAM mRNAs, we asked whether subcellular distribution of the receptors could alter responsiveness. Immunocytochemistry (Fig. 3A-C) and mean fluorescence intensity measurements (not shown) show that growth cones of Satb2pos and Satb2neg neurons express similar levels of Npn1, PlxA4, and L1CAM receptors.
Figure 3
Figure 3
Subunits of the Sema3A receptor complex are expressed at similar levels in cortical axonal growth cones
Although the total pool of receptors is similar, their availability on the growth cone surface may differ. However, surface labeling for Npn1 and L1CAM was also similar in Satb2pos and Satb2neg axons (Fig.3D,E). It remains possible that PlexinA4 is differentially maintained at the surface, but we were unable to detect reliable PlexinA4 labeling under non-permeabilizing conditions.
Axonal internalization of Sema3A correlates with responsiveness
Sema3A induces endocytosis (Fournier et al., 2000; Jurney et al., 2002; Castellani et al., 2004; Piper et al., 2005), so we asked whether different cortical neuron populations could be differentiated based on their ability to internalize Sema3A. In order to examine Sema3A internalization directly, we tagged recombinant Sema3A-hFc with a quantum (Q) dot conjugated Fab fragment that recognizes the hFc-tail. Neurons were incubated with Sema3A-Qdots and the internalized pool was visualized selectively by stripping surface ligands with an acidic wash. Growth cones, dendrites and cell bodies all show internalized fluorescent puncta which are heterogeneous in shape and size. In order to compare populations, we used EUE to label layer 5 or layer 2/3 neurons and then quantified the level of internalized Sema3A in growth cones. E15-born neurons internalize twice the level of Sema3A-Qdots as E17-born neurons (Fig. 4 A,B,G). To confirm that the enhanced internalization capacity resides in layer 5 neurons lacking Satb2, neurons were immunolabeled post-hoc for Satb2, Ctip2, or Tbr1. As expected, Satb2neg neurons internalize significantly more Sema3A than Satb2pos neurons (Supplementary Fig.2A,B), and these Satb2neg neurons are either corticospinal or corticothalamic projecting neurons as they express Ctip2 or Tbr1, respectively (Supplementary Fig.2C,D).
Figure 4
Figure 4
Sema3A internalization is distinct between deep and superficial layer neurons
Despite the similar distribution of Sema3A receptors in all cortical growth cones, it is possible that Satb2neg neurons can bind more Sema3A. To test this Sema3A-Qdot binding was assessed in neurons that were cooled to 12ºC, which prevents internalization. Satb2neg growth cones bind a modestly greater amount of Sema3A than Satb2pos growth cones, but this difference is not significant (1.0 ± 0.12 vs. 0.71 ± 0.2, t-test, p = 0.17; n= 9 per group). More notable is that surface bound Sema3A appears more diffuse in Satb2neg compared to Satb2pos neurons (Fig. 4H). This observation suggests that Sema3A receptors might be differentially clustered and/or distributed within membrane domains of growth cones.
Raft-mediated endocytosis is the principal mode of Sema3A internalization in responsive growth cones
Mammalian cells employ distinct endocytic paths in order to compartmentalize cargo within contexts that are significant for downstream signaling, recycling, or degradation (Nichols and Lippincott-Schwartz, 2001; Pelkmans and Helenius, 2002; Conner and Schmid, 2003). In order to identify the route taken by Sema3A, we compared the two most prominent pathways: Clathrin-mediated endocytosis (CME) and raft-mediated endocytosis (RME). We first confirmed that the two paths are present in cortical neurons by comparing internalization of rhodamine-tagged Transferrin, a marker for CME with FITC-tagged Cholera-toxin B, which binds GM1 gangliosides and is used to tag sphingolipid enriched membrane rafts. As expected, there are endosomes tagged with Transferrin alone, or Cholera toxin alone, in addition to a population tagged with both (Pelkmans et al., 2004) (Supplementary Fig. 3).
We next tested the impact of RME or CME blockade on Sema3A internalization. In axonal growth cones of E15-born neurons, filipin, an inhibitor of RME, dramatically reduces levels of internalized Sema3A (Fig. 4A,C,G), while monodansyl-cadaverin (MDC), an inhibitor of CME, has virtually no effect (Fig. 4A,E,G). In contrast, in growth cones of E17-born neurons, which internalize much less Sema3A overall, both filipin and MDC decrease levels of internalized Sema3A suggesting that both endocytic routes contribute equally (Fig. 4B,D,F,G).
These findings suggest that RME may be responsible for the repelling effects of Sema3A. To test this, we assayed Sema3A-mediated growth cone collapse in neurons exposed to filipin. Consistent with a critical role for RME, filipin prevents collapse (Fig. 4I, Guirland et al, 2004).
Since CME contributes to Sema3A internalization in layer2/3 neurons, we asked whether it counters the impact of RME. However, the data show that blocking CME in the less responsive Satb2pos neurons does not enhance Sema3A-mediated growth cone collapse (Fig. 4J). Taken together, these data indicate that Sema3A internalization via RME is required for its repulsive effects in Satb2neg neurons.
Molecular mechanisms controlling the raft-mediated internalization of Sema3A
To identify proteins that could contribute to Sema3A internalization, we first assembled a list of proteins known to function downstream of Sema3A, Npn1, L1CAM, and PlexinAs (PlxA) (Fig. 5A, in red). Using Genes2networks (Berger et al 2007), we employed this seed list to find previously reported protein-protein interactions identified experimentally in mammalian cells that would “connect” the seed list proteins through additional intermediate proteins. This approach generated a list of potential one step-intermediate interactions between members of the seed list. The candidate proteins (Fig. 5A in yellow and blue) were ordered according to their calculated z-scores, which is computed based on the candidate protein links in the seed sub-network compared to the candidate's known previously reported direct physical protein interactions (Supplementary Table 1). The higher a protein's z-score, the more likely the protein is to function specifically downstream of Sema3A. Of the 33 proteins identified having z-scores higher than 2.5, two proteins stood out because of their known role in endocytosis: Flotillin-1 and -2, also known as Reggie-2 and -1 (Bickel et al., 1997; Lang et al., 1998) (z-score = 3.9, 6.2, respectively). Flotillins are members of the SPFH-domain family of proteins, which bind lipid rafts. Significantly, Glebov and colleagues have shown that in HeLa cells Flotillins define and are required for a caveolin-independent RME pathway (Nichols and Lippincott-Schwartz, 2001; Glebov et al., 2006; Frick et al., 2007).
Figure 5
Figure 5
Flotillin-1 and -2 are novel candidates downstream of Sema3A and are immunodetected in cortical axons in vivo and in vitro
To determine whether developing cortical axons express Flotillins, we immunolabeled E14.5 neocortex for Flotillin-1 or -2. Immunolabeling for both Flotillins can be seen throughout the neocortex. The overlying pia and blood vessels show the highest levels of immunolabeling, while lower levels are observed throughout the cortical plate, intermediate zone, and ventricular zone. In the intermediate zone and internal capsule, where corticocortical and corticofugal axons travel, Flotillin labeling colocalizes with F-actin-labeled fibers (Fig. 5B-E). In axonal growth cones of dissociated neurons, where Flotillin localization can be examined at a higher resolution, labeling is primarily punctate (Fig. 5F,G).
Flotillin-1 responds to Sema3A stimulation
In non-neuronal cells, Flotillins relocalize from smaller patches on the plasmalemma to larger and brighter clusters in endosomal compartments in response to EGF (Neumann-Giesen et al., 2007; Riento et al., 2009). Thus, to determine whether Flotillins respond similarly to Sema3A, we used an imaging based approach. In Satb2neg neurons, Flotillin-1 appears less clustered than Flotillin-2 in unexposed growth cones. In response to Sema3A, only Flotillin-1 responds, becoming more clustered (Fig. 6A). In axons from Satb2pos neurons, the distribution of both Flotillins appears similar to Satb2neg growth cones, but neither changes in response to Sema3A (Fig. 6A). These observations were analyzed quantitatively by plotting the mean intensity vs. the area labeled in growth cones, and the data show that Sema3A selectively increases the appearance of low to medium intensity clusters of Flotillin-1 in satb2neg neurons (Fig. 6B).
Figure 6
Figure 6
Sema3A increases Flotillin-1 clustering in growth cones of Satb2neg but not Satb2pos neurons
The Sema3A-stimulated increase in fluorescence is prevented by preincubation with filipin (Fig. 6C) and unchanged by MDC (Fig.6D), consistent with Flotillin-1 recruitment to cholesterol enriched membrane microdomains. Based on previous work, the increased Flotillin-1 labeling most likely arises from the clustering of a pre-existing pool (Neumann-Giesen et al., 2007; Riento et al., 2009), but it is also possible that Flotillin is newly synthesized. To test this we assayed Sema3A-dependent clustering when protein translation was blocked by anisomycin. Anisomycin had no effect (Supplementary Fig. 4A,B,E,F).
In HeLa cells, EGF-mediated Flotillin recruitment requires the activation of fyn kinase (Neumann-Giesen et al., 2007; Riento et al., 2009). Since fyn activation is also essential for Sema3A function (Morita et al., 2006), we asked whether exposure to the Src family kinase inhibitor SU6656 would alter Flotillin-1 recruitment in response to Sema3A. Flotillin-1, but not Flotillin-2, acquires a diffuse expression in cortical axons in response to SU6656, and exposure to Sema3A only modestly increases its clustered appearance from this low baseline level (Supplementary Fig. 4A-D). These data suggest that the higher capacity of Satb2neg neurons to internalize Sema3A via a raft-mediated pathway likely results from their ability to cluster Flotillin-1 in a src-dependent manner in response to Sema3A.
Flotillin-1 is required for Sema3A internalization
Since Flotillin-1 responds robustly to Sema3A in Satb2neg neurons, we asked whether it is required for Sema3A internalization. To test this, we knocked down Flotillin-1 using an equal mix of three shRNAs, each of which target different regions of the mRNA (see methods), and together significantly decrease Flotillin-1 levels to 48% of that in neurons expressing control shRNAs (Supplementary Fig. 5A-C). Flotillin-1 knockdown significantly decreases Sema3A internalization in growth cones to 35% of control values (Fig. 7A,B).
Figure 7
Figure 7
Flotillin-1 is required for the Dynamin-independent, ERM-dependent endocytosis of Sema3A
Previous work suggests that Flotillin-defined RME does not require dynamin-mediated fission (Glebov et al., 2006). To test whether the RME pathway utilized by Sema3A is also dynamin-independent, we treated neurons with a specific and rapidly acting small molecule inhibitor of dynamin, dynasore (Macia et al., 2006), and then quantified Sema3A-Qdot internalization. Dynasore treatment produced a modest, but insignificant decrease in Sema3A internalization (Fig. 7A, B and data not shown), supporting that this pathway is largely independent of dynamin. When dynasore was combined with Flotillin-1 shRNAs, there was a further, but not statistically signficant reduction in Sema3A internalization (Fig. 7A,B). Together these data support that Sema3A utlizes a Flotillin-dependent, but dynamin-indendent endocytic pathway in growth cones from Satb2neg neurons.
We have previously shown that ERMs can also regulate internalization of Npn1 and L1CAM in response to Sema3A, most likely via their association with the intracellular tail of L1CAM (Mintz et al., 2008). To test whether Flotillin-1 mediated endocytosis functions in the same pathway as ERMs, we compared Sema3A internalization in growth cones expressing an ERM dominant negative, NEz, which acts as a pan-ERM dominant negative (Algrain et al., 1993; Dickson et al., 2002), alone or together with Flotillin-1 shRNAs. As expected, NEz greatly reduces Sema3A internalization (Fig. 7C,D). Combined with Flotillin knockdown, there is a similar reduction in Sema3A internalization. The absence of an additive effect suggests that Flotillin and ERMs function in the same pathway controlling the magnitude of Sema3A internalization (Fig. 7C,D).
Flotillin-1 mediates signaling to the cytoskeleton and axonal responsiveness to Sema3A
The data suggest that Flotillin-1 mediated Sema3A internalization could be important for mediating the repulsive effects of Sema3A in axons from Satb2neg neurons. To test this, we assayed axonal growth inhibition in response to Sema3A in Satb2neg neurons expressing Flotillin-1 shRNAs. The data show that axonal growth inhibition is prevented (Fig. 8A, B). Flotillin-1 knockdown also significantly inhibited Sema3A-mediated growth cone collapse (57.8% ± 3% vs. 38.5% ± 3%; n = 2 experiments; t-test, p < 0.01), and in neurons growing on alternating stripes of Sema3A and control substrates, flotillin-1 knock down produced a modest increase in the frequency of border crossings per axon (1.7 ±0.4 vs. 2.1 ± 0.3; n = 2 experiments;15 per group).
Figure 8
Figure 8
Flotillin-1 knockdown decreases Sema-mediated axon responses and LIMK activation
To mediate repulsion, Flotillin-based RME would be anticipated to initiate signalling pathways to the growth cone cytoskeleton. It has been shown previously that Sema3A-mediated growth cone collapse in dorsal root ganglia requires LIM kinase (LIMK)-1 mediated inactivation of cofilin (Aizawa et al., 2001). LIM kinases are positively regulated by phosphorylation, so we first asked whether Sema3A stimulates LIMK phosophorylation in growth cones from Satb2neg cortical neurons. As expected, 5min exposure to Sema3A increases phospho-LIMK labeling by nearly 3-fold, while showing no change in labeling for total LIMK (Fig. 8C-E). Flotillin-1-knockdown reduces this response by a third. Taken together, the data show that in presumptive corticofugal axons, Flotillin-1 is required for the internalization of Sema3A generating endosomes that signal to the cytoskeleton via LIMK activation and thus can initiate axonal responsiveness.
While it has long been appreciated that axons can take different trajectories while growing in a similar environment (Dodd and Jessell, 1988; Fishell and Hanashima, 2008), the cellular mechanisms that drive such differential responses are poorly understood. Here we show that cortical neurons grown in culture retain their cell-type specific identities and thus, can be used as a tractable model system to investigate the mechanisms mediating cell-type selective responses. Using this system, we show that axons extending from cortical neurons lacking the transcription factor Satb2 respond more robustly to Sema3A in a variety of assays than those that express Satb2. This differential responsiveness cannot be accounted for by differences in Sema3A receptor expression. Rather, the data show that axons from Satb2neg neurons utilize RME to internalize more Sema3A. We identify Flotillin-1 as a Sema3A signaling intermediate that defines this raft-mediated pathway, and show that it can regulate LIMK activity and is essential for generating Sema3A responses in cortical neurons.
Response Selectivity
Axonal growth cones employ a variety of mechanisms to mediate spatial, temporal and cell type specific responses. Most previously identified mechanisms regulate the number or type of receptors available on the surface. For example, PKC activation in hippocampal neurons leads to the selective internalization of the UNC5H1 receptor for Netrin converting Netrin-based repulsion to attraction (Williams et al., 2003); and in the developing spinal cord, commissural axons increase their expression of Robo1 receptors and become sensitive to the repelling effects of midline Slits after crossing the midline (Kidd et al., 1998; Zou et al., 2000; Reeber et al., 2008). In contrast, cortical axons express similar levels of Sema3A receptors, but utilize different modes of internalization.
In many cases cell type specificity or graded responses can be directly attributed to the selective or graded expression of the transcription factors that control the expression of receptors or ligands (Barbieri et al., 2002; Mui et al., 2002; Herrera et al., 2003; Pak et al., 2004; Polleux et al.,; Lee et al., 2008). While we show that Satb2 expression correlates with decreased sensitivity, and Ctip2 overexpression increases axon sensitivity to Sema3A, we also provide data showing similar levels of Npn1, L1CAM and PlxA4 receptors in all cortical axons. Since we observe that membrane bound Sema3A is more clustered in axons of Satb2pos neurons, it is possible that in responsive axons, receptors form combinations at the plasma membrane that are more likely to reside in lipid rafts and/or be internalized via RME. These data suggest that Satb2 and Ctip2 regulate the expression of proteins affecting plasma membrane organization, of binding proteins that alter receptor distribution within membrane microdomains, or of signaling proteins that act downstream of receptor binding. It will be important in future experiments to identify the relevant transcriptional targets.
Sema3A has been shown previously to repel cortical axons (Bagnard et al., 1998; Polleux et al., 1998) but prior to the current study it was not clear how different cortical populations respond to this cue. Knockout studies for Sema3A and its receptors offer valuable but sometimes confounding information on cortical axon guidance (Behar et al., 1996; Dahme et al., 1997; Taniguchi et al., 1997; Demyanenko et al., 1999; Gu et al., 2003; Suto et al., 2005; Yaron et al., 2005; Sibbe et al., 2007). In these models the manipulation is broad and chronic, allowing for non-cell autonomous effects and for homeostatic compensation. These shortcomings have made it difficult to parse roles for particular guidance cues in generating structures that rely on multiple simultaneous cues (like the neocortex). Thus, while it has been demonstrated that cortical axons are attracted by Netrin-1 (expressed in the basal telencephalon) and repelled by Semaphorin 5B (ventricular zone), Draxin (cortical plate) and Slit1 and 2 (basal telencephalon) (Metin et al., 1997; Richards et al., 1997; Bagri et al., 2002; Lett et al., 2009), the selective influence of these cues on molecularly defined neuronal populations at different stages of development is poorly understood.
Endocytosis
In general, cells utilize several distinct modes of endocytosis to efficiently control the spatial and temporal propagation of signals from the plasma membrane to intracellular effectors. There is substantial evidence for a large number of endocytic paths that differ in their targets, the effectors and adaptors employed, and their regulation (Pelkmans et al., 2001; Pelkmans and Helenius, 2002; Yap et al., 2008b). In retinotectal axons CME is required for growth cone adaptation to Netrin-1 and to Sema3A, and for responsiveness to Ephrins (Cowan et al., 2005; Piper et al., 2005). The function of RME in axon guidance has received comparatively little attention, although significantly, localization within membrane microdomains can segregate guidance cue response pathways (Marquardt et al., 2005), and guidance cue receptors, including Npn1, can translocate to lipid rafts following ligand binding, and event that is essential for the appropriate response (Guirland et al., 2004; Ibanez, 2004).
Axonal growth cones of Satb2neg neurons internalize Sema3A via a pathway that is dependent on lipid raft integrity and on expression of Flotillin-1, a resident protein of rafts that actively participates in membrane bending and internalization, independent of Clathrin, Dynamin and Caveolin-1 (Glebov et al., 2006). This mechanism is inherently adaptable as it permits neurons to intrinsically control signaling downstream of a guidance cue by an internalization switch. This strategy would allow neurons to generate relevant signals in distinct cellular compartments and at different developmental stages, and therefore to employ the same cues and receptors for different outcomes. Satb2pos neurons offer an excellent example. While their axons do not respond to Sema3A, they probably employ Npn1 receptors to respond to Sema3C (Piper et al., 2005; Niquille et al., 2009). At the same time, their cell bodies and apical processes use Npn1 for radial migration in the cortical plate, most likely in response to Sema3A secreted by the marginal zone (Chen et al., 2008b). It will be interesting to determine whether internalization of Npn1 is required for these additional functions.
Relationship between RME and CME
In previous work we showed that ERM proteins could regulate L1CAM and Npn1 internalization in cortical axons (Mintz et al., 2008), and in Cos cells it has been shown that Npn1 internalization requires L1CAM (Castellani et al., 2004). Since the binding domains for ERMs and the clathrin adapter, AP2 on L1CAM partially overlap (Kamiguchi et al., 1998; Cheng et al., 2005; Sakurai et al., 2008), our interpretation was that ERMs most likely prevent CME. However, despite many attempts, we did not detect competition between the binding of ERM and AP2 to L1CAM and the current data show that ERMs function in the same pathway as Flotillin-1. In non-neuronal cells ERM proteins can associate with lipid rafts and control the translocation of their transmembrane partners to these membrane domains (Gupta et al., 2006; Chakrabandhu et al., 2007), suggesting that ERMs function upstream of Flotillin-1 to promote Npn1 translocation to lipid rafts (Guirland et al., 2004).
Sema3A can also induce CME (Piper et al., 2005), and blocking CME with MDC reduces Sema3A-mediated growth cone collapse in cortical neurons (Mintz et al., 2008). However, since we do not detect significant uptake of Sema3A via the CME pathway in responsive growth cones, we hypothesize that Sema3A engages CME indirectly. Crosstalk between RME and CME has been described in other cell types (Pelkmans et al., 2004), and while speculative, our data fit a model (Fig. 9) in which RME of Sema3A leads to LIMK-1 activation, Cofilin inactivation (Aizawa et al., 2001), and the stabilization of a pool of subplasmalemmal F-actin necessary for CME (Romer et al., 2010; Merrifield et al., 2002). CME could remove adhesive sites, an event that precedes the Plexin-initiated depolymerization of F-actin, but is equally important for growth cone detachment during retraction (Hung et al., 2010; Mikule et al., 2002; Terman et al., 2002).
Figure 9
Figure 9
Model for the role of RME in the response of corticofugal axons to Sema3A
Supplementary Material
Supp1
Acknowledgments
This work was supported by NIH grants NS050634 and AA014898.
  • Aizawa H, Wakatsuki S, Ishii A, Moriyama K, Sasaki Y, Ohashi K, Sekine-Aizawa Y, Sehara-Fujisawa A, Mizuno K, Goshima Y, Yahara I. Phosphorylation of cofilin by LIM-kinase is necessary for semaphorin 3A-induced growth cone collapse. Nat Neurosci. 2001;4:367–373. [PubMed]
  • Alcamo EA, Chirivella L, Dautzenberg M, Dobreva G, Farinas I, Grosschedl R, McConnell SK. Satb2 regulates callosal projection neuron identity in the developing cerebral cortex. Neuron. 2008;57:364–377. [PubMed]
  • Algrain M, Turunen O, Vaheri A, Louvard D, Arpin M. Ezrin contains cytoskeleton and membrane binding domains accounting for its proposed role as a membrane-cytoskeletal linker. J Cell Biol. 1993;120:129–139. [PMC free article] [PubMed]
  • Arlotta P, Molyneaux BJ, Chen J, Inoue J, Kominami R, Macklis JD. Neuronal subtype-specific genes that control corticospinal motor neuron development in vivo. Neuron. 2005;45:207–221. [PubMed]
  • Bagnard D, Lohrum M, Uziel D, Puschel AW, Bolz J. Semaphorins act as attractive and repulsive guidance signals during the development of cortical projections. Development. 1998;125:5043–5053. [PubMed]
  • Bagri A, Marin O, Plump AS, Mak J, Pleasure SJ, Rubenstein JL, Tessier-Lavigne M. Slit proteins prevent midline crossing and determine the dorsoventral position of major axonal pathways in the mammalian forebrain. Neuron. 2002;33:233–248. [PubMed]
  • Barbieri AM, Broccoli V, Bovolenta P, Alfano G, Marchitiello A, Mocchetti C, Crippa L, Bulfone A, Marigo V, Ballabio A, Banfi S. Vax2 inactivation in mouse determines alteration of the eye dorsal-ventral axis, misrouting of the optic fibres and eye coloboma. Development. 2002;129:805–813. [PubMed]
  • Bayer SA, Altman J. Development of layer I and the subplate in the rat neocortex. Exp Neurol. 1990;107:48–62. [PubMed]
  • Bechara A, Nawabi H, Moret F, Yaron A, Weaver E, Bozon M, Abouzid K, Guan JL, Tessier-Lavigne M, Lemmon V, Castellani V. FAK-MAPK-dependent adhesion disassembly downstream of L1 contributes to semaphorin3A-induced collapse. Embo J. 2008;27:1549–1562. [PubMed]
  • Behar O, Golden JA, Mashimo H, Schoen FJ, Fishman MC. Semaphorin III is needed for normal patterning and growth of nerves, bones and heart. Nature. 1996;383:525–528. [PubMed]
  • Bickel PE, Scherer PE, Schnitzer JE, Oh P, Lisanti MP, Lodish HF. Flotillin and epidermal surface antigen define a new family of caveolae-associated integral membrane proteins. J Biol Chem. 1997;272:13793–13802. [PubMed]
  • Britanova O, Akopov S, Lukyanov S, Gruss P, Tarabykin V. Novel transcription factor Satb2 interacts with matrix attachment region DNA elements in a tissue-specific manner and demonstrates cell-type-dependent expression in the developing mouse CNS. Eur J Neurosci. 2005;21:658–668. [PubMed]
  • Britanova O, de Juan Romero C, Cheung A, Kwan KY, Schwark M, Gyorgy A, Vogel T, Akopov S, Mitkovski M, Agoston D, Sestan N, Molnar Z, Tarabykin V. Satb2 is a postmitotic determinant for upper-layer neuron specification in the neocortex. Neuron. 2008;57:378–392. [PubMed]
  • Campbell DS, Regan AG, Lopez JS, Tannahill D, Harris WA, Holt CE. Semaphorin 3A elicits stage-dependent collapse, turning, and branching in Xenopus retinal growth cones. J Neurosci. 2001;21:8538–8547. [PubMed]
  • Castellani V, Falk J, Rougon G. Semaphorin3A-induced receptor endocytosis during axon guidance responses is mediated by L1 CAM. Mol Cell Neurosci. 2004;26:89–100. [PubMed]
  • Castellani V, Chedotal A, Schachner M, Faivre-Sarrailh C, Rougon G. Analysis of the L1-deficient mouse phenotype reveals cross-talk between Sema3A and L1 signaling pathways in axonal guidance. Neuron. 2000;27:237–249. [PubMed]
  • Chakrabandhu K, Herincs Z, Huault S, Dost B, Peng L, Conchonaud F, Marguet D, He HT, Hueber AO. Palmitoylation is required for efficient Fas cell death signaling. Embo J. 2007;26:209–220. [PubMed]
  • Chao WT, Kunz J. Focal adhesion disassembly requires clathrin-dependent endocytosis of integrins. FEBS Lett. 2009;583:1337–1343. [PMC free article] [PubMed]
  • Chauvet S, Cohen S, Yoshida Y, Fekrane L, Livet J, Gayet O, Segu L, Buhot MC, Jessell TM, Henderson CE, Mann F. Gating of Sema3E/PlexinD1 signaling by neuropilin-1 switches axonal repulsion to attraction during brain development. Neuron. 2007;56:807–822. [PMC free article] [PubMed]
  • Chen B, Schaevitz LR, McConnell SK. Fezl regulates the differentiation and axon targeting of layer 5 subcortical projection neurons in cerebral cortex. Proc Natl Acad Sci U S A. 2005;102:17184–17189. [PubMed]
  • Chen B, Wang SS, Hattox AM, Rayburn H, Nelson SB, McConnell SK. The Fezf2-Ctip2 genetic pathway regulates the fate choice of subcortical projection neurons in the developing cerebral cortex. Proc Natl Acad Sci U S A. 2008a;105:11382–11387. [PubMed]
  • Chen G, Sima J, Jin M, Wang KY, Xue XJ, Zheng W, Ding YQ, Yuan XB. Semaphorin-3A guides radial migration of cortical neurons during development. Nat Neurosci. 2008b;11:36–44. [PubMed]
  • Chen Y, Stevens B, Chang J, Milbrandt J, Barres BA, Hell JW. NS21: re-defined and modified supplement B27 for neuronal cultures. J Neurosci Methods. 2008c;171:239–247. [PMC free article] [PubMed]
  • Cheng L, Itoh K, Lemmon V. L1-mediated branching is regulated by two ezrin-radixin-moesin (ERM)-binding sites, the RSLE region and a novel juxtamembrane ERM-binding region. J Neurosci. 2005;25:395–403. [PMC free article] [PubMed]
  • Conner SD, Schmid SL. Regulated portals of entry into the cell. Nature. 2003;422:37–44. [PubMed]
  • Cowan CW, Shao YR, Sahin M, Shamah SM, Lin MZ, Greer PL, Gao S, Griffith EC, Brugge JS, Greenberg ME. Vav family GEFs link activated Ephs to endocytosis and axon guidance. Neuron. 2005;46:205–217. [PubMed]
  • Dahme M, Bartsch U, Martini R, Anliker B, Schachner M, Mantei N. Disruption of the mouse L1 gene leads to malformations of the nervous system. Nat Genet. 1997;17:346–349. [PubMed]
  • de Wit J, Verhaagen J. Role of semaphorins in the adult nervous system. Prog Neurobiol. 2003;71:249–267. [PubMed]
  • Demyanenko GP, Tsai AY, Maness PF. Abnormalities in neuronal process extension, hippocampal development, and the ventricular system of L1 knockout mice. J Neurosci. 1999;19:4907–4920. [PubMed]
  • Dent EW, Barnes AM, Tang F, Kalil K. Netrin-1 and semaphorin 3A promote or inhibit cortical axon branching, respectively, by reorganization of the cytoskeleton. J Neurosci. 2004;24:3002–3012. [PubMed]
  • Dickson TC, Mintz CD, Benson DL, Salton SRJ. Functional binding interaction identified between the axonal CAM L1 and members of the ERM family. J Cell Biol. 2002;157:1105–1112. [PMC free article] [PubMed]
  • Dodd J, Jessell TM. Axon guidance and the patterning of neuronal projections in vertebrates. Science. 1988;242:692–699. [PubMed]
  • Fishell G, Hanashima C. Pyramidal neurons grow up and change their mind. Neuron. 2008;57:333–338. [PubMed]
  • Fournier AE, Nakamura F, Kawamoto S, Goshima Y, Kalb RG, Strittmatter SM. Semaphorin3A enhances endocytosis at sites of receptor-F-actin colocalization during growth cone collapse. J Cell Biol. 2000;149:411–422. [PMC free article] [PubMed]
  • Frick M, Bright NA, Riento K, Bray A, Merrified C, Nichols BJ. Coassembly of flotillins induces formation of membrane microdomains, membrane curvature, and vesicle budding. Curr Biol. 2007;17:1151–1156. [PubMed]
  • Glebov OO, Bright NA, Nichols BJ. Flotillin-1 defines a clathrin-independent endocytic pathway in mammalian cells. Nat Cell Biol. 2006;8:46–54. [PubMed]
  • Gu C, Rodriguez ER, Reimert DV, Shu T, Fritzsch B, Richards LJ, Kolodkin AL, Ginty DD. Neuropilin-1 conveys semaphorin and VEGF signaling during neural and cardiovascular development. Dev Cell. 2003;5:45–57. [PubMed]
  • Guirland C, Suzuki S, Kojima M, Lu B, Zheng JQ. Lipid rafts mediate chemotropic guidance of nerve growth cones. Neuron. 2004;42:51–62. [PubMed]
  • Gupta N, Wollscheid B, Watts JD, Scheer B, Aebersold R, DeFranco AL. Quantitative proteomic analysis of B cell lipid rafts reveals that ezrin regulates antigen receptor-mediated lipid raft dynamics. Nat Immunol. 2006;7:625–633. [PubMed]
  • Hand R, Bortone D, Mattar P, Nguyen L, Heng JI, Guerrier S, Boutt E, Peters E, Barnes AP, Parras C, Schuurmans C, Guillemot F, Polleux F. Phosphorylation of Neurogenin2 specifies the migration properties and the dendritic morphology of pyramidal neurons in the neocortex. Neuron. 2005;48:45–62. [PubMed]
  • Herrera E, Brown L, Aruga J, Rachel RA, Dolen G, Mikoshiba K, Brown S, Mason CA. Zic2 patterns binocular vision by specifying the uncrossed retinal projection. Cell. 2003;114:545–557. [PubMed]
  • Hong K, Hinck L, Nishiyama M, Poo MM, Tessier-Lavigne M, Stein E. A ligand-gated association between cytoplasmic domains of UNC5 and DCC family receptors converts netrin-induced growth cone attraction to repulsion. Cell. 1999;97:927–941. [PubMed]
  • Hung RJ, Yazdani U, Yoon J, Wu H, Yang T, Gupta N, Huang Z, van Berkel WJ, Terman JR. Mical links semaphorins to F-actin disassembly. Nature. 463:823–827. [PMC free article] [PubMed]
  • Ibanez CF. Lipid rafts as organizing platforms for cell chemotaxis and axon guidance. Neuron. 2004;42:3–5. [PubMed]
  • Jurney WM, Gallo G, Letourneau PC, McLoon SC. Rac1-mediated endocytosis during ephrin-A2- and semaphorin 3A-induced growth cone collapse. J Neurosci. 2002;22:6019–6028. [PubMed]
  • Kamiguchi H, Lemmon V. Recycling of the cell adhesion molecule L1 in axonal growth cones. J Neurosci. 2000;20:3676–3686. [PMC free article] [PubMed]
  • Kamiguchi H, Long KE, Pendergast M, Schaefer AW, Rapoport I, Kirchhausen T, Lemmon V. The neural cell adhesion molecule L1 interacts with the AP-2 adaptor and is endocytosed via the clathrin-mediated pathway. J Neurosci. 1998;18:5311–5321. [PMC free article] [PubMed]
  • Kidd T, Brose K, Mitchell KJ, Fetter RD, Tessier-Lavigne M, Goodman CS, Tear G. Roundabout controls axon crossing of the CNS midline and defines a novel subfamily of evolutionarily conserved guidance receptors. Cell. 1998;92:205–215. [PubMed]
  • Knoll B, Weinl C, Nordheim A, Bonhoeffer F. Stripe assay to examine axonal guidance and cell migration. Nat Protoc. 2007;2:1216–1224. [PubMed]
  • Koester SE, O'Leary DD. Development of projection neurons of the mammalian cerebral cortex. Prog Brain Res. 1994;102:207–215. [PubMed]
  • Lang DM, Lommel S, Jung M, Ankerhold R, Petrausch B, Laessing U, Wiechers MF, Plattner H, Stuermer CA. Identification of reggie-1 and reggie-2 as plasmamembrane-associated proteins which cocluster with activated GPI-anchored cell adhesion molecules in non-caveolar micropatches in neurons. J Neurobiol. 1998;37:502–523. [PubMed]
  • Law CO, Kirby RJ, Aghamohammadzadeh S, Furley AJ. The neural adhesion molecule TAG-1 modulates responses of sensory axons to diffusible guidance signals. Development. 2008;135:2361–2371. [PubMed]
  • Lee R, Petros TJ, Mason CA. Zic2 regulates retinal ganglion cell axon avoidance of ephrinB2 through inducing expression of the guidance receptor EphB1. J Neurosci. 2008;28:5910–5919. [PubMed]
  • Lett RL, Wang W, O'Connor TP. Semaphorin 5B is a novel inhibitory cue for corticofugal axons. Cereb Cortex. 2009;19:1408–1421. [PubMed]
  • Liu Y, Shi J, Lu CC, Wang ZB, Lyuksyutova AI, Song XJ, Zou Y. Ryk-mediated Wnt repulsion regulates posterior-directed growth of corticospinal tract. Nat Neurosci. 2005;8:1151–1159. [PubMed]
  • Luo Y, Raible D, Raper JA. Collapsin: a protein in brain that induces the collapse and paralysis of neuronal growth cones. Cell. 1993;75:217–227. [PubMed]
  • Macia E, Ehrlich M, Massol R, Boucrot E, Brunner C, Kirchhausen T. Dynasore, a cell-permeable inhibitor of dynamin. Dev Cell. 2006;10:839–850. [PubMed]
  • Maness PF, Schachner M. Neural recognition molecules of the immunoglobulin superfamily: signaling transducers of axon guidance and neuronal migration. Nat Neurosci. 2007;10:19–26. [PubMed]
  • Marquardt T, Shirasaki R, Ghosh S, Andrews SE, Carter N, Hunter T, Pfaff SL. Coexpressed EphA receptors and ephrin-A ligands mediate opposing actions on growth cone navigation from distinct membrane domains. Cell. 2005;121:127–139. [PubMed]
  • Merrifield CJ, Feldman ME, Wan L, Almers W. Imaging actin and dynamin recruitment during invagination of single clathrin-coated pits. Nat Cell Biol. 2002;4:691–698. [PubMed]
  • Metin C, Deleglise D, Serafini T, Kennedy TE, Tessier-Lavigne M. A role for netrin-1 in the guidance of cortical efferents. Development. 1997;124:5063–5074. [PubMed]
  • Mikule K, Gatlin JC, de la Houssaye BA, Pfenninger KH. Growth cone collapse induced by semaphorin 3A requires 12/15-lipoxygenase. J Neurosci. 2002;22:4932–4941. [PubMed]
  • Mintz CD, Carcea I, McNickle DG, Dickson TC, Ge Y, Salton SR, Benson DL. ERM proteins regulate growth cone responses to Sema3A. J Comp Neurol. 2008;510:351–366. [PMC free article] [PubMed]
  • Morita A, Yamashita N, Sasaki Y, Uchida Y, Nakajima O, Nakamura F, Yagi T, Taniguchi M, Usui H, Katoh-Semba R, Takei K, Goshima Y. Regulation of dendritic branching and spine maturation by semaphorin3A-Fyn signaling. J Neurosci. 2006;26:2971–2980. [PubMed]
  • Mui SH, Hindges R, O'Leary DD, Lemke G, Bertuzzi S. The homeodomain protein Vax2 patterns the dorsoventral and nasotemporal axes of the eye. Development. 2002;129:797–804. [PubMed]
  • Neumann-Giesen C, Fernow I, Amaddii M, Tikkanen R. Role of EGF-induced tyrosine phosphorylation of reggie-1/flotillin-2 in cell spreading and signaling to the actin cytoskeleton. J Cell Sci. 2007;120:395–406. [PubMed]
  • Nichols BJ, Lippincott-Schwartz J. Endocytosis without clathrin coats. Trends Cell Biol. 2001;11:406–412. [PubMed]
  • Niquille M, Garel S, Mann F, Hornung JP, Otsmane B, Chevalley S, Parras C, Guillemot F, Gaspar P, Yanagawa Y, Lebrand C. Transient neuronal populations are required to guide callosal axons: a role for semaphorin 3C. PLoS Biol. 2009;7:e1000230. [PMC free article] [PubMed]
  • Pak W, Hindges R, Lim YS, Pfaff SL, O'Leary DD. Magnitude of binocular vision controlled by islet-2 repression of a genetic program that specifies laterality of retinal axon pathfinding. Cell. 2004;119:567–578. [PubMed]
  • Pelkmans L, Helenius A. Endocytosis via caveolae. Traffic. 2002;3:311–320. [PubMed]
  • Pelkmans L, Kartenbeck J, Helenius A. Caveolar endocytosis of simian virus 40 reveals a new two-step vesicular-transport pathway to the ER. Nat Cell Biol. 2001;3:473–483. [PubMed]
  • Pelkmans L, Burli T, Zerial M, Helenius A. Caveolin-stabilized membrane domains as multifunctional transport and sorting devices in endocytic membrane traffic. Cell. 2004;118:767–780. [PubMed]
  • Perala NM, Immonen T, Sariola H. The expression of plexins during mouse embryogenesis. Gene Expr Patterns. 2005;5:355–362. [PubMed]
  • Piper M, Salih S, Weinl C, Holt CE, Harris WA. Endocytosis-dependent desensitization and protein synthesis-dependent resensitization in retinal growth cone adaptation. Nat Neurosci. 2005;8:179–186. [PubMed]
  • Polleux F, Ince-Dunn G, Ghosh A. Transcriptional regulation of vertebrate axon guidance and synapse formation. Nat Rev Neurosci. 2007;8:331–340. [PubMed]
  • Polleux F, Giger RJ, Ginty DD, Kolodkin AL, Ghosh A. Patterning of cortical efferent projections by semaphorin-neuropilin interactions. Science. 1998;282:1904–1906. [PubMed]
  • Rasband WS. Image J. 1997-2009. http://rsb.info.nih.gov/ij (ImageJ USNIoH, Bethesda, Maryland, ed). USA.
  • Reeber SL, Sakai N, Nakada Y, Dumas J, Dobrenis K, Johnson JE, Kaprielian Z. Manipulating Robo expression in vivo perturbs commissural axon pathfinding in the chick spinal cord. J Neurosci. 2008;28:8698–8708. [PMC free article] [PubMed]
  • Richards LJ, Koester SE, Tuttle R, O'Leary DD. Directed growth of early cortical axons is influenced by a chemoattractant released from an intermediate target. J Neurosci. 1997;17:2445–2458. [PubMed]
  • Riento K, Frick M, Schafer I, Nichols BJ. Endocytosis of flotillin-1 and flotillin-2 is regulated by Fyn kinase. J Cell Sci. 2009;122:912–918. [PubMed]
  • Romer W, Pontani LL, Sorre B, Rentero C, Berland L, Chambon V, Lamaze C, Bassereau P, Sykes C, Gaus K, Johannes L. Actin dynamics drive membrane reorganization and scission in clathrin-independent endocytosis. Cell. 140:540–553. [PubMed]
  • Sakurai T, Gil OD, Whittard JD, Gazdoiu M, Joseph T, Wu J, Waksman A, Benson DL, Salton SR, Felsenfeld DP. Interactions between the L1 cell adhesion molecule and ezrin support traction-force generation and can be regulated by tyrosine phosphorylation. J Neurosci Res. 2008;86:2602–2614. [PMC free article] [PubMed]
  • Sibbe M, Taniguchi M, Schachner M, Bartsch U. Development of the corticospinal tract in Semaphorin3A- and CD24-deficient mice. Neuroscience. 2007;150:898–904. [PubMed]
  • Skaliora I, Singer W, Betz H, Puschel AW. Differential patterns of semaphorin expression in the developing rat brain. Eur J Neurosci. 1998;10:1215–1229. [PubMed]
  • Suto F, Ito K, Uemura M, Shimizu M, Shinkawa Y, Sanbo M, Shinoda T, Tsuboi M, Takashima S, Yagi T, Fujisawa H. Plexin-a4 mediates axon-repulsive activities of both secreted and transmembrane semaphorins and plays roles in nerve fiber guidance. J Neurosci. 2005;25:3628–3637. [PubMed]
  • Takei K, Slepnev VI, Haucke V, De Camilli P. Functional partnership between amphiphysin and dynamin in clathrin-mediated endocytosis. Nat Cell Biol. 1999;1:33–39. [PubMed]
  • Tamagnone L, Artigiani S, Chen H, He Z, Ming GI, Song H, Chedotal A, Winberg ML, Goodman CS, Poo M, Tessier-Lavigne M, Comoglio PM. Plexins are a large family of receptors for transmembrane, secreted, and GPI-anchored semaphorins in vertebrates. Cell. 1999;99:71–80. [PubMed]
  • Taniguchi M, Yuasa S, Fujisawa H, Naruse I, Saga S, Mishina M, Yagi T. Disruption of semaphorin III/D gene causes severe abnormality in peripheral nerve projection. Neuron. 1997;19:519–530. [PubMed]
  • Terman JR, Mao T, Pasterkamp RJ, Yu HH, Kolodkin AL. MICALs, a family of conserved flavoprotein oxidoreductases, function in plexin-mediated axonal repulsion. Cell. 2002;109:887–900. [PubMed]
  • Toyofuku T, Yoshida J, Sugimoto T, Zhang H, Kumanogoh A, Hori M, Kikutani H. FARP2 triggers signals for Sema3A-mediated axonal repulsion. Nat Neurosci. 2005;8:1712–1719. [PubMed]
  • Williams ME, Wu SC, McKenna WL, Hinck L. Surface expression of the netrin receptor UNC5H1 is regulated through a protein kinase C-interacting protein/protein kinase-dependent mechanism. J Neurosci. 2003;23:11279–11288. [PubMed]
  • Wisco D, Anderson ED, Chang MC, Norden C, Boiko T, Folsch H, Winckler B. Uncovering multiple axonal targeting pathways in hippocampal neurons. J Cell Biol. 2003;162:1317–1328. [PMC free article] [PubMed]
  • Yap CC, Nokes RL, Wisco D, Anderson E, Folsch H, Winckler B. Pathway selection to the axon depends on multiple targeting signals in NgCAM. J Cell Sci. 2008a;121:1514–1525. [PubMed]
  • Yap CC, Wisco D, Kujala P, Lasiecka ZM, Cannon JT, Chang MC, Hirling H, Klumperman J, Winckler B. The somatodendritic endosomal regulator NEEP21 facilitates axonal targeting of L1/NgCAM. J Cell Biol. 2008b;180:827–842. [PMC free article] [PubMed]
  • Yaron A, Huang PH, Cheng HJ, Tessier-Lavigne M. Differential requirement for Plexin-A3 and -A4 in mediating responses of sensory and sympathetic neurons to distinct class 3 Semaphorins. Neuron. 2005;45:513–523. [PubMed]
  • Zou Y, Stoeckli E, Chen H, Tessier-Lavigne M. Squeezing axons out of the gray matter: a role for slit and semaphorin proteins from midline and ventral spinal cord. Cell. 2000;102:363–375. [PubMed]