PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Anesthesiology. Author manuscript; available in PMC Nov 1, 2013.
Published in final edited form as:
PMCID: PMC3482280
NIHMSID: NIHMS409606
Mineralocorticoid receptor blocker eplerenone reduces pain behaviors in vivo and decreases excitability in small diameter sensory neurons from local inflamed dorsal root ganglia in vitro
Fei Dong, M.D.,ab* Wenrui Xie, Ph.D.,a# Judith A. Strong, Ph.D.,a@ and Jun-Ming Zhang, M.D., M.Sc.a%
aPain Research Center, Department of Anesthesiology, University of Cincinnati College of Medicine, Cincinnati, OH 45267-0531
bDepartment of Orthopedic Surgery, The Second Affiliated Hospital School of Medicine, Xi’an Jiaotong University, Xi’an, Shaanxi 710004, China
Correspondence to: Jun-Ming Zhang, M.D., M.Sc., Department of Anesthesiology, University of Cincinnati, 231 Albert Sabin Way, Cincinnati, OH 45267-0531, Phone 513-558-2427 Fax 513-558-0995, Jun-Ming.Zhang/at/uc.edu
*Research Fellow
#Research Assistant Professor
@Research Associate Professor
%Professor
Background
Inflammation of the dorsal root ganglia (DRG) may contribute to low back pain, postherpetic neuralgia, and neuropathic pain. The mineralocorticoid receptor (MR) plays a pro-inflammatory role in many non-renal tissues, but its role in peripheral pain at the DRG level is not well studied.
Methods
Local inflammation of the L5 DRG with the immune activator zymosan rapidly leads to mechanical hypersensitivity and increased excitability of sensory neurons. Using this pain model, we applied the MR antagonist eplerenone locally to the inflamed DRG. Excitability of small diameter sensory neurons was examined in acute primary culture, using patch clamp techniques.
Results
Local eplerenone significantly reduced the mechanical hypersensitivity and shortened its duration. The same dose was ineffective systemically. Immunohistochemical studies showed the MR was present in most neurons, and rapidly translocated to the nucleus 1 day after local DRG inflammation. Activation of satellite glia (defined by expression of glial fibrillary acidic protein) in the inflamed DRG was also reduced by local eplerenone. Increased excitability of small diameter sensory neurons 1 day after inflammation could be observed in vitro. Eplerenone applied in vitro (8 – 12 hours) could reverse this increased excitability. Eplerenone had no effect in neurons isolated from normal, uninflamed DRG. The MR agonist aldosterone (10 nM) applied in vitro increased excitability of neurons isolated from normal DRG.
Conclusions
The MR may have a pro-nociceptive role in the DRG. Some of its effects may be mediated by neuronal MR. The MR may represent a novel therapeutic target in some pain syndromes.
Low back pain is an extremely common problem that remains difficult to treat 1,2. Although the underlying mechanisms are still not well understood, inflammatory irritation of lumbar dorsal root ganglion (DRG), either from direct chemical irritation or secondary to an immune response to the nucleus pulposus, may contribute to low back pain 35. Moreover, there is partial effectiveness of anti-inflammatory drugs in treating pain associated with inflammation.
The mineralocorticoid receptor (MR) was originally viewed only as the target of aldosterone, promoting Na and K transport in epithelial cells, best known for its role in the kidney and colon. However, more recently the MR has been detected in non-epithelial tissues, notably in the heart and brain. Corticosterone (in rodents; cortisol, in humans), and some steroid medications can activate not only the glucocorticoid receptor (GR) but also the MR; in most tissues MR may be physiologically activated primarily by corticosterone which has a much higher plasma concentration than aldosterone. In the kidney the MR is activated only by aldosterone due to the presence of enzymes that inactivate glucocorticoids. MR activation promotes M1 or classical inflammation (high levels of oxidative metabolites and pro-inflammatory cytokines, tissue destruction), while GR activation promotes MII or alternative inflammation (tissue remodeling and wound repair). Recent evidence shows that inflammation is associated with MR activation in kidney, heart and central nervous system. Further, blockers of MR not only suppressed the inflammatory reaction but also promoted wound healing and functional recovery after nerve injury (for review: 6). Some of these studies used the new MR antagonist eplerenone, which has much better selectivity for MR over GR than previous agents7. However, the significance of MR activation in pathological pain remains elusive, and there are few studies regarding its role in peripheral sensory ganglia.
In the present study, we examined the existence and localization of MR in the DRG in normal and locally inflamed DRG. We also examined effects of eplerenone on pain behavior and excitability of sensory neurons. We used our recently developed rat model in which long lasting pain is induced by locally inflaming sensory ganglia by depositing a drop of the immune activator zymosan over a single lumbar DRG. This results in prolonged mechanical pain, rapid upregulation of pro-inflammatory cytokines, and increased sensory neuron excitability 8,9. Excitatory effects on small diameter, presumptive nociceptors could be preserved in short term culture 10. We took advantage of this finding to study effects of eplerenone in vitro, where effects on neurons could be examined independently of possible in vivo eplerenone effects on immune or other cells.
Animals
All the surgical procedures and the experimental protocol were approved by the institutional animal care and use committee of the University of Cincinnati (Cincinnati, OH). All experiments adhered to the guidelines laid out in the Guide for the Care and Use of Laboratory Animals. Sprague-Dawley rats (Harlan Laboratories, Indianapolis, IN) were used for all behavioral experiments. Rats were housed one or two per cage under a controlled diurnal cycle of 12 h light and 12 h dark with free access to water and food. The ambient environment was maintained at constant temperature (22 ± 0.5°C) and relative humidity (60–70%).
Surgical procedure for localized DRG inflammation (LID)
The surgery was performed as previously described 9. Male Sprague-Dawley rats weighing 200–250g (for behavioral and immunohistochemistry experiments) or female Sprague-Dawley rats weighing 80–100g (for electrophysiological experiments) were anesthetized by isoflurane. Our previous results using this model showed behavior changes in smaller female rats used for recording were similar to those in large male rats used for behavior 9. An incision was made along the spine from S1 to L4 vertebral level. For behavioral experiments, the L5 intervertebral foramen was visualized by exposing L5 and L4 transverse processes by separating the overlying back spine paraspinal muscles. The immune activator zymosan (2 mg/ml, 10 μl, in incomplete Freund’s adjuvant (IFA) was injected beneath the L5 inter-vertebral foramen, above the DRG, via a needle (30-G1/2″), which was bent into a 90 degree angle 1–2 mm from the tip. During injection, the bent part of needle was inserted into the intervertebral foramen and kept there for 1–2 minutes after injection to avoid leakage. With the same methods, both L4 and L5 DRG were inflamed for electrophysiological and immunostaining experiments. Eplerenone and other steroids are very insoluble in water. In order to apply eplerenone (Tocris, Bristol, United Kingdom) locally to the inflamed DRG, 500 μg of the drug was added to the oily IFA + zymosan used to inflame the L5 DRG (“Zym + Epl” group). Cholesterol was used as a chemically similar negative control (“Zym + Cho” group). The method was chosen based on a published study 11, in which steroid micropellets implanted into the brain had a diffusion radius of ~750 μm and duration of action of 5 – 7 days. In that study, aldosterone pellets in brain had behavioral effects at 15 and 30 μg but not at 3 μg 12; however, we chose to use 500 μg eplerenone in our study because eplerenone, though specific for MR over GR and other steroid receptors, has relatively low affinity for the MR (IC50 several of orders of magnitude higher than the EC50 for aldosterone or corticosterone 13,14). In some experiments, to control for possible systemic effects of eplerenone, the same amount was implanted subcutaneously under the skin of the back (“Zym + Epl (s.c.)”).
Behavioral testing
Animals were inspected and tested every other day for three trials prior to LID surgery (baseline), and after surgery as indicated.
von Frey testing
Mechanical sensitivity was tested by applying a series of von Frey filaments to the heel region of the paw, using the up-and-down method 15. A cutoff value of 15 grams was assigned to animals that did not respond to the highest filament strength used.
Rearing behavior
Rearing behavior in a novel environment was measured by taping animal behavior immediately after placing the animal in a 15.5″ × 15.5″ chamber, during the daytime but under dim red light illumination. Taping was done with the experimenter absent from the room. The incidence and duration of rears was scored offline.
Quantitative polymerase chain reaction
Quantitative polymerase chain reaction methods were as previously described 16. Primers designed with Primer-BLAST17 were chosen to anneal at 60°C, and to either sit on or amplify across an exon boundary to avoid amplifying genomic DNA. All amplicons were initially confirmed by agarose gel electrophoresis to determine if the amplicon was the predicted size and a single product. Oligonucleotide primers used in this study were synthesized by Invitrogen (Carlsbad, CA). Primer sequences were: GR (Nr3c1; gene ID 24413): forward: AGCCTGACTTCCTTGGGGGCT; reverse: AGCTTGGGAGGTGGTCCCGT. MR (Nr3c2; gene ID 25672): forward: GGAGAAGTGATGGGTATCCCGTCC, reverse: ACCCCATAGTGACACCCAGAAGCC. hypoxanthine guanine phosphoribosyl transferase (HPRT; gene ID 24465): forward: GCAGACTTTGCTTTCCTTGG, reverse: TACTGGCCACATCAACAGGA.
Immunostaining of MR and glial fibrillary acidic protein (GFAP) in the DRG and primary culture
Rats were anesthetized with pentobarbital sodium (40mg/Kg, intraperitoneal.) and perfused with 0.1 M phosphate buffer (PH=7.4) followed by 200–300 ml of Zamboni’s fixative (4% paraformaldehyde in 0.1 M phosphate buffer, PH=7.4) through the left ventricle of the heart. The inflamed L5/L4 DRG were removed, post-fixed in the perfusion fixative for 30 min at 4°C and then transferred in 20% sucrose overnight. 10-μm frozen sections were cut from the harvested DRGs. Rats were sacrificed between 5 p.m. and 7 p.m. For cultured cells, coverslips (after patch clamp experiments) were put into −20 °C acetone for 10 min. Sections or dried coverslips were permeabilized twice for 5 min in phosphate buffered saline with 0.3% Triton X-100 (PBST), blocked for 1.5 h with 10% normal goat serum in PBST, and incubated overnight at 4°C with rabbit anti-rat MR antibody (1:2000; Abcam, Cambridge, MA, catalog ab64457) plus mouse anti-rat NeuN antibody (1:1000; Abcam) or mouse anti-rat antibody to GFAP, used as a marker of satellite glia activation (1:1000; Abcam) dissolved in 1% bovine serum albumin and 3% normal goat serum in PBST. After washing in PBST, sections were incubated for 2h at room temperature with goat anti-rabbit (1:1000; Invitrogen, Grand Island, NY) and goat anti-mouse secondary antibody (1:1000; Invitrogen) dissolved in 3% normal goat serum in PBST. After drying, the sections were mounted on coverslips with Vector Hard Set mounting medium (Vector laboratories, Burlingame, CA). Using SlideBook Digital Microscopy Software (Intelligent Imaging Innovation, Santa Monica, CA), confocal images from multiple sections were digitized under a light microscope equipped with a color digital camera and stored in a computer. Additional experiments using a different, monoclonal antibody to the MR (antibody 1D5 in 18) were conducted with the same protocol in sections from normal DRG, except that the dilution used was 1:200, and the primary antibody incubation medium contained 0.1% bovine serum albumin instead of normal goat serum. To quantitate the expression of MR in neurons, we counted at least 6 non-sequential sections from each single DRG, scoring neurons as expressing MR in cytoplasm, plasma membrane, and nucleus. The fractions of cells in each group were averaged for each animal and statistical comparisons were done using the animal averages. To quantitate the effect of eplerenone on GFAP expression, we chose three sections from each DRG randomly, quantified the GFAP intensity in cellular areas, and then subtracted the background intensity to get relative intensity.
Acute cell dissociation and whole-cell patch recording in small diameter cells
Cell culture
Rats were anesthetized by intraperitoneal injection of pentobarbital sodium (40mg/Kg). The bilateral L4 and L5 DRGs were isolated and the sheath was carefully removed in ice-cold normal artificial cerebrospinal fluid (composition below). The connective tissue was digested by exposure to Ca2+-free bath solution containing 1.0% collagenase type IA (Sigma-Aldrich, St. Louis, MO) for 30 min at 37°C followed by three washes in normal bath solution. DRGs were then dissociated by trituration with fire-polished Pasteur pipettes. Dissociated cells were plated onto poly-D-lysine coated glass coverslips in Neurobasal Medium (Life Technologies, Grand Island, NY) containing 1% glutamine, 2% B-27 supplement, and 1% penicillin-streptomycin. DRG cells were incubated at 37°C for at least 4 hours before recording.
Electrophysiological recording
After 4–12 hours culture, coverslips were transferred to a recording chamber and DRG cells were visualized under differential interference contrast using an inverted microscope (IX71; Olympus America Inc., Center Valley, PA). Whole cell current-clamp recordings of small DRG neurons were conducted at room temperature with an AxoPatch-200B amplifier (Molecular Devices Corp, Sunnyvale, CA). Patch pipettes (2.5–4.0 MΩ) were fabricated from borosilicate glass. The recording chamber was continuously perfused at room temperature with oxygenated bath solution at a flow rate of 2 ml/min. Data were acquired on a Pentium IV computer with Clampex 9.0 program (Molecular Devices). After GΩ-seal formation, the whole-cell configuration was obtained at room temperature under voltage-clamp with a holding potential of −60 mV, switched to current clamp mode. Data were low-pass filtered at 10 kHz and obtained only from small-sized neurons (< 30 μm diameter) which are primarily nociceptors. Cells were considered healthy and accepted for inclusion if they exhibited resting membrane potentials more negative than −40 mV and action potential (AP) overshoot above 20 mV.
Excitability measurements included the threshold current (rheobase), AP threshold, resting membrane potential (Vm), AP maximum rising rate (V/s), amplitude and duration of afterhyperpolarization, and input resistance. Vm was measured 1 min after a stable recording was obtained. Current pulses from −0.2 to 0.37 nA (80-ms pulse duration) were delivered in increments of 0.3 nA until one or more APs were evoked. Longer suprathreshold pulses (1 second) were then applied to determine whether cells could fire multiple action potentials. The threshold current (rheobase) was defined as the minimum current required to evoke an AP. The AP voltage threshold was defined as the first point on the upstroke of an AP at which dV/dt was 10% of the maximum. Action potential duration was measured at threshold.
Solutions and chemical application
The artificial cerebrospinal fluid used for dissection contained (in mM) NaCl 130, KCl 3.5, NaH2PO4 1.25, CaCl2 1.2, MgCl2 1.2, NaHCO3 24 and glucose 10, pH adjusted to 7.3 with NaOH, bubbled with 95% O2/5% CO2 before use. The normal bath solution for recording excitability parameters contained (in mM) 140 NaCl, 5 KCl, 2 CaCl2, 1 MgCl2, 10 HEPES, 25 Glucose. The pH was adjusted to 7.4 with NaOH. The pipette solution contained (in mM) KCl 140, CaCl2 1, MgCl2 2, NaOH 10, EGTA 11, Mg- adenosine triphosphate 2, Li-GTP 1, HEPES 10, adjusted to 7.3 with KOH, and the osmolarity was adjusted to ~ 90% of the bath solution. Voltages were corrected for the liquid junction potential, which was estimated to be 5.6 mV. For experiments in cultured cells, eplerenone was made up from a 10 mM dimethyl sulfoxide stock solution, and aldosterone (Sigma-Aldrich) was made up from a 10 mM 95% ethanol stock solution. Treated cells were compared with vehicle-treated controls.
Statistical analysis
Statistical analyses were performed using Graphpad Prism software (Graphpad Prism, La Jolla, CA) and Sigmastat software (Systat Software, Chicago IL). Comparison of values between different experimental groups was done using nonparametric methods for data that did not show a normal distribution based on the D’Agostino and Pearson omnibus normality test. Comparison of multiple groups was done using ANOVA (parametric) or Kruskal-Wallis test (nonparametric). Comparison of two groups was done using Students t-test (parametric) or Mann-Whitney (nonparametric). Time course data were evaluated with repeated measure ANOVA. The statistical test used is indicated in the text or figure and table legends. Significance was ascribed for p value <0.05. Levels of significance are indicated by the number of symbols, e.g., *, p = 0.01 to <0.05; **, p = 0.001 to 0.01; ***, p < 0.001. Data are presented as average ± S.E.M.
The MR is expressed in the DRG neurons and translocates into the nucleus early after inflammation
Both MR and GR were detected in complimentary DNA from whole DRG from quantitative polymerase chain reaction experiments, but their expression was not significantly regulated after local inflammation on postoperative day (POD)3 at the message RNA level (p=0.61). Immunohistochemistry of DRG slices showed that the MR immunoreactivity was expressed in all neurons. In normal DRG, MR immunoreactivity was mainly observed in the cytoplasm (Fig. 1, ,2).2). As this localization was somewhat unexpected (see Discussion), the predominantly cytoplasmic location of the MR in normal DRG sections was confirmed using a different antibody, a monoclonal antibody (ID5; 18) directed against the A/B region in the N-terminal (n = 4 animals).
Figure 1
Figure 1
Examples of double immunostaining of mineralocorticoid receptor (MR) and NeuN in sections from normal and inflamed dorsal root ganglia. Asterisks show MR expression on the membrane of neurons and arrowheads show MR expression in the nucleus of neurons. (more ...)
Figure 2
Figure 2
Quantitative summary of mineralocorticoid receptor (MR) immunostaining results from experiments as shown in Figure 1. N = 4–8 animals per group; individual values for each animal are plotted; each value is based on measurements of 450 to 2800 (more ...)
After inflammation of the L4/L5 DRG, MR translocation to the nucleus of neurons in the L4/L5 DRG was observed. This translocation was maximal on POD1, gradually decreasing back to normal on POD 14 (Fig 1, ,2).2). This time course suggested that nuclear MR might be particularly important in initiating pain behaviors. The nuclear translocation on POD1 was unlikely to be entirely due to some systemic effect of the DRG inflammation: in DRG taken on POD1 from the T12 level (n = 4 animals), remote from the inflamed L4/L5 DRG, only 19 ± 4 % of cells showed nuclear localization, compared to 63± 13 % in the inflamed L5 DRG. The nuclear localization in T12 DRG was not significantly different from that observed in normal noninflamed L4/L5 DRG. We also found that MR immunoreactivity also sharply increased in the membrane on POD 7 in the inflamed DRG, and was still elevated on POD 14 (Fig. 1, ,22).
Eplerenone decreased satellite glia activation in the inflamed DRG
Satellite glia activation in the sensory ganglia often occurs under pathological conditions i.e. after peripheral nerve injury or local DRG inflammation 8, 19, 20. When compared to the normal DRG, we found that glia activation, as measured by increased immunoreactivity for GFAP, was significantly increased throughout inflamed DRG (POD1) without eplerenone. However, the inflamed DRG with local eplerenone treatment showed a significantly decreased satellite glial activation (Fig 3, ,44).
Figure 3
Figure 3
Examples of double immunostaining of mineralocorticoid receptor (MR) and glial fibrillary acidic protein (GFAP) in sections from normal and zymosan inflamed (“zym”) dorsal root ganglia (on postoperative day 1) with or without eplerenone (more ...)
Figure 4
Figure 4
Quantitative summary of glial fibrillary acidic protein (GFAP) staining results from experiments as shown in Fig 3. N=3–4 animals per group; individual values for each animal are shown along with the mean and SEM. Each individual animal value (more ...)
In vivo: local eplerenone reduced pain behaviors induced by DRG inflammation
To study the effects of MR blockade in vivo, in one group of animals eplerenone was included in the zymosan/IFA used to inflame the DRG. A second group received zymosan/IFA with cholesterol as a chemically similar control without hormonal activity. A third group received the same amount of eplerenone placed subcutaneously under the back, instead of locally in the DRG, to control for possible systemic effects of eplerenone. All three groups showed decreased withdrawal threshold with Von-Frey filament testing starting from POD1 (Fig. 5A). In the cholesterol and systemic eplerenone groups, the large rapid increase in mechanical sensitivity was similar to that previously observed with zymosan/IFA inflammation without cholesterol 9. The group with local eplerenone in the DRG had significantly less mechanical pain than the other two groups on all days tested, and after POD5 the threshold was not significantly different from baseline. This effect was not mimicked by applying the same amount systemically. The groups without local eplerenone were still hypersensitive at 15 days. Longer times were not tested but previously we have found that hypersensitivity in this model can be observed for over 8 weeks.
Figure 5
Figure 5
Local eplerenone treatment significantly reduced the pain behaviors induced by dorsal root ganglion inflammation. A: mechanical threshold (von Frey testing): animals locally treated with Eplerenone added to the zymosan/Incomplete Freund’s Adjuvant (more ...)
As a more complex, non-reflex behavioral measure, we previously demonstrated that LID caused a reduction in the rearing normally observed during the first few minutes after the rat is placed in a novel environment 9. This effect of LID was reversed by the anti-inflammatory drug naproxen, suggesting it is pain-related. In this study, a similar reduction in rearing was observed in the Zym + Cho group tested on POD1. This was largely reversed by local but not systemic eplerenone (Fig. 5B).
In vitro: inflammation-induced excitability effects on small DRG neurons were partially reversed by eplerenone
Membrane properties were recorded in acutely isolated (after 8 – 12 hours in primary culture) small-diameter DRG neurons using the current-clamp configuration of the whole-cell patch clamp (Fig. 6 and Table 1). Cells isolated from normal DRG (“control”) were compared to cells isolated on POD1 after inflammation (“Zym”). We observed: (1) Increased excitability of “Zym” cells compared to control cells: rheobase decreased, the number of action potentials evoked by suprathreshold current injections increased, and the resting potential was more depolarized; (2) These excitability parameters of cells isolated on POD1 were normalized by treating with eplerenone (10 μM) in vitro during the 8–12 hour culture period: mean rheobase and resting potential were restored to normal level; and the number of action potentials showed a trend (p = 0.1) towards normalization. After eplerenone treatment, the electrophysiological parameters measured were not significantly different from those in normal cells. (3) No significant effects on electrophysiological parameters were observed in cells from normal DRG treated with eplerenone (10 μM) in vitro during the 8–12 hour culture period.
Figure 6
Figure 6
Effects of prior dorsal root ganglion inflammation and in vitro eplerenone on excitability of acutely cultured small-diameter neurons. Cells were isolated from normal dorsal root ganglia (“control”) or from inflamed dorsal root ganglia (more ...)
Table 1
Table 1
Membrane properties of isolated small-diameter neurons treated with epleronone
Treatment of neurons (N = 14) from inflamed DRG with a lower dose of eplerenone, 1 μM, generally gave intermediate values (between those observed with 0 and 10 μM) for the variables shown in Fig. 6; however the differences between the 2 eplerenone doses was not statistically significant with the exception of the effect on Vm (p = 0.02, t-test).
In vitro: aldosterone induced the increased excitability of small DRG neurons
The above results could be interpreted most simply by assuming that some of the excitatory effects of LID were due to activation of the MR, which in normal DRG is inactive. This would explain why eplerenone could reverse most excitatory effects in neurons isolated from LID animals, but had no effect in normal animals. By this interpretation, activation of the MR in cells from normal DRG would be expected to have excitatory effects. To test this, we applied aldosterone, the natural high-affinity agonist of MR, in vitro (Fig. 7 and Table 2). Acutely isolated small diameter DRG neurons were recorded under the current-clamp configuration of the whole-cell patch clamp. Cells isolated from normal DRG neurons were incubated with or without aldosterone at 5 different doses (0, 1, 10, 100, and 1,000 nM) for 4 – 8 hours prior to recording. We observed that isolated neurons incubated with aldosterone showed a U-shaped dose-dependent response in the number of action potentials evoked by suprathreshold current injections. The evoked response to current injection peaked at 10 nM (p<0.05) with smaller responses at 1, 100, and 1000nM.
Figure 7
Figure 7
Effects of in vitro aldosterone (“aldo”) on excitability of acutely cultured small-diameter neurons. Cells were isolated from normal dorsal root ganglia and aldosterone was added during the culture period (4 to 8 hours before recording) (more ...)
Table 2
Table 2
Membrane properties of isolated small-diameter neurons treated with Aldosterone
Cultured neurons also show more nuclear MR when isolated from inflamed DRG
Immunostaining of coverslips confirmed that MR could be detected in neurons. The nuclear staining was more marked in cells isolated from inflamed DRG (POD1) (Fig. 8). Increased nuclear staining could also be observed after treating cells cultured from normal DRG with the MR agonist aldosterone.
Figure 8
Figure 8
Examples of mineralocorticoid receptor (MR) immunohistochemistry of cultured neurons under the same conditions as used for electrophysiological recordings. Neurons isolated from normal dorsal root ganglia showed less MR expression in the nucleus compared (more ...)
Inflammatory processes are important participants in the pathophysiology of low back pain. Previous studies implicated the MR in mediating the inflammation observed in vessels, heart, and renal cortex of rodent models of diabetes and hypertension. There is increasing evidence to suggest that MR activation increases the risk and severity of inflammation (for review see 6). Nonetheless, to our knowledge, few studies have examined the role of MR activation in pathological pain at the level of the DRG. In this study, we showed that local inflammation of the DRG with zymosan/IFA leads to enhanced pain behaviors starting as early as POD1, when mechanical hypersensitivity and reduced novelty-induced rearing are also observed. Interestingly, the local inflammation of the DRG is accompanied by the rapid nuclear translocation of MR in DRG neurons on POD1, which is generally considered to indicate MR activation. Pain behaviors persisted for at least two weeks in this study (Fig. 5), and were still evident at 8 weeks in our previous study 9. We evaluated the effect of adding eplerenone simultaneously with Zymosan/IFA, and found that eplerenone partially reversed these pain behaviors: eplerenone-treated animals returned to the pre-inflammation baseline after one week. Consistent with previous reports, these results suggest that MR activation is involved in the local inflammatory process in the DRG, which triggers pain in this model, hence MR blockade has an analgesic function.
The mechanisms by which selective MR blockers such as eplerenone are anti-nociceptive are not completely understood. Eplerenone was only effective when applied locally to the inflamed DRG; the same amount given systemically did not affect pain behaviors, implicating MR receptors in the DRG. Eplerenone may exert its anti-inflammatory effects indirectly by inhibiting the release of pro-inflammatory cytokines from neurons, glia, or immune cells. The MR is known to promote M1 inflammation characterized by high levels of oxidative metabolites and proinflammatory cytokines as well as tissue damage; in a previous study, microarray experiments on POD3 showed upregulation of 6 out of 10 selected M1 markers 21 in locally inflamed DRG. However, our results also suggest that at least some eplerenone effects may be mediated by direct effects on sensory neurons because eplerenone effects were also observed in cultured neurons, where effects of other cell types should be reduced or diluted. We found marked increases in excitability (decreased rheobase, increased number of action potentials during a suprathreshold current injection) of small sensory neurons that could be observed in neurons removed from the inflamed DRG on POD1 and maintained in primary culture for 8 – 12 hours. These were similar to effects previously reported for cells isolated on POD3 10. The nuclear translocation of MR in inflamed DRG was also preserved in cells cultured on POD1. The increased excitability could be partially reversed by treating the cells in vitro with eplerenone. These results suggest that the MR located in neurons may play important roles in establishing pain directly through excitability increases as are seen following DRG inflammation. One possible mechanism is the activation of the pro-inflammatory nuclear factor-κB transcription factor, which has been shown to mediate pro-inflammatory effects of MR in some other tissues 2224; nuclear factor-κB has excitatory and pro-nociceptive effects in DRG neurons (e.g. see25,26 and refs therein).
The finding that eplerenone reduced GFAP expression in satellite glia (generally used as a marker of activation) in inflamed DRG might be attributed to indirect general anti-inflammatory effects, since GFAP upregulation is observed in inflammatory conditions. Activity-dependent somatic release (especially of adenosine triphosphate) from sensory neurons provides a mechanism for neuron-satellite glia communication 27 that may be enhanced in the inflamed DRG, where excitability and spontaneous activity are increased. Since experiments with activity blockers show that abnormal neuronal activity plays a role in satellite glia activation 28,29, the observed eplerenone effects on neurons could also play a role in the reduced GFAP expression. Alternatively or in addition, eplerenone could also have had a direct effect on the satellite glia. In the central nervous system, glia have been shown to express the GR 30
Our immunohistochemistry results indicated that the MR was not primarily located in the nucleus in normal DRG, translocating there only early after DRG inflammation. For the classical nuclear actions of the MR receptor, such translocation is generally taken as evidence for activation. The observations in normal DRG may seem to contradict the general view that the MR in most tissues should be chronically activated by basal plasma levels of corticosterone (except in tissues such as kidney where corticosterone is enzymatically degraded) – the affinity of the MR for corticosterone is higher than its affinity for aldosterone, so the (much higher) basal plasma levels of corticosterone should chronically activate the MR. RNA for the enzyme that degrades corticosterone in classical aldosterone-sensitive tissues, 11 -hydroxysteroid dehydrogenase type II, is present in DRG 21 though it is not known if this is neuronal or perhaps associated with vascular cells. In addition, the MR can apparently have forms that are less sensitive to corticosterone. For example, studies of MR in brain 31 as well as other tissues 32 suggest that the MR that is in or closely associated with the plasma membrane has a lower affinity for corticosterone; hence this form of the receptor is not chronically activated. This form may mediate some of the fast, excitatory nongenomic effects of the MR in neurons 33. Further studies are needed to understand what endogenous agonist causes the MR translocation to the nucleus after DRG inflammation in our model. One possibility is that systemic corticosteroid levels increase due to the pain model (as observed in some other pain models, e. g. 3436), enough to activate the MR. However, if this were the case, translocation should have occurred in all DRG, but we found that DRGs several levels above the inflamed DRG did not show nuclear translocation on POD1. Alternatively, locally produced endogenous steroids could activate the receptor, or the local inflammation process could somehow modify the MR receptor or associated proteins so that it has sensitivity to basal corticosterone levels more like that observed in other tissues. Finally, it is worth noting that the apparent subcellular localization of the MR can vary depending on what antibody is used, presumably because ligand or interacting proteins may interfere with binding of a particular antibody, or because a given antibody may only recognize certain conformations of the protein18. The antibody used in this study was derived from an antigen based on the last (C-terminal) 20 amino acids of the MR sequence, which is in the ligand-binding domain. The unexpected pattern of MR localization we observed in normal DRG neurons was somewhat similar to that described in amygdala neurons using an antibody that, like the one we used, recognizes the ligand-binding domain 37.
The above discussion assumes that the MR effects studied in the patch clamp experiments were genomic, nuclear effects. Our studies were designed to examine such effects; aldosterone and eplerenone were applied for at least 4 – 8 hours (pretreatment) but were not present during the recording. In addition, our electrophysiological studies were consistent with these assumptions: no effect of eplerenone was observed in normal cells (which had little nuclear receptor), but aldosterone applied to normal cells had excitatory effects. In hippocampal neurons the rapid nongenomic effects of steroids mediated by plasma membrane MR can be rapidly washed out 33 and hence even if present should not have been observed in our recordings. However, in other systems some of the membrane-MR effects can be prolonged, often tending to reinforce the genomic effects 32. We cannot completely rule out the possibility that longlasting but non-genomic effects contributed to our findings.
The dose-response curve for aldosterone effects in electrophysiological experiments appeared to be an inverted U-shaped, with excitatory effects at 1 and 10 nM. The declining effects at higher doses could be due to activation of the GR receptor. In some tissues including macrophages and microglia 6 and some brain regions 31, MR and GR have opposing effects. This may also be true at the level of the spinal cord where neuronal MR is also found. In one study, using intrathecal injection, agonists of GR but antagonists of MR had antinociceptive effects 35, however, the role of spinal GR in pain is controversial ( e. g. 34,36 and references therein).
Inflammation is a component of many different models of both inflammatory and neuropathic pain, not just low back pain models. This study presents evidence that the MR may play important roles in pain acting at the level of peripheral sensory neurons. It will be of interest to determine the possible effects of MR antagonists in other types of pathological pain. The MR is a potentially novel target for pain therapeutics, particularly since drugs targeting MR are already approved by the United States Food and Drug Administration for other clinical uses.
What we already know about this topic
  • Inflammatory processes are important participants in the pathophysiology of low back pain
  • The mineralocortocoidreceptor (MR) plays a proinflammatory role in many nonrenal tissues, but its role in peripheral pain at the dorsal root ganglia (DRG) level remains unknown
What this article tells us that is new
  • Eplerenone, a blocker of the MR receptor, reduces pain behavior and neuronal excitability induced by DRG inflammation
  • Drugs targeting at the MR receptor may have potential for pain therapy
Acknowledgments
Supported by National Institutes of Health grants NS55860 and NS45594, Bethesda, MD.
We thank Mark Baccei, Ph.D., Assistant Professor, Dept. of Anesthesiology, and James Herman, Ph.D., Professor, Dept. of Psychiatry, both at the University of Cincinnati College of Medicine, for helpful discussions. 1D5 antibody was the kind gift of Elise Gomez-Sanchez, Ph.D., Professor, Dept. of Endocrinology, University of Mississippi Medical Center, Jackson, Mississippi.
1. Badley EM, Rasooly I, Webster GK. Relative importance of musculoskeletal disorders as a cause of chronic health problems, disability, and health care utilization: Findings from the 1990 Ontario Health Survey. J Rheumatol. 1994;21:505–14. [PubMed]
2. Waddell G. Low back pain: A twentieth century health care enigma. Spine (Phila Pa 1976) 1996;21:2820–5. [PubMed]
3. Kawaguchi S, Yamashita T, Yokogushi K, Murakami T, Ohwada O, Sato N. Immunophenotypic analysis of the inflammatory infiltrates in herniated intervertebral discs. Spine. 2001;26:1209–14. [PubMed]
4. Satoh K, Konno S, Nishiyama K, Olmarker K, Kikuchi S. Presence and distribution of antigen-antibody complexes in the herniated nucleus pulposus. Spine. 1999;24:1980–4. [PubMed]
5. Gertzbein SD, Tait JH, Devlin SR. The stimulation of lymphocytes by nucleus pulposus in patients with degenerative disk disease of the lumbar spine. Clin Orthop Related Res. 1977:149–54. [PubMed]
6. Rickard AJ, Young MJ. Corticosteroid receptors, macrophages and cardiovascular disease. J Mol Endocrinol. 2009;42:449–59. [PubMed]
7. Rogerson FM, Yao Y, Smith BJ, Fuller PJ. Differences in the determinants of eplerenone, spironolactone and aldosterone binding to the mineralocorticoid receptor. Clin Exp Pharmacol Physiol. 2004;31:704–9. [PubMed]
8. Xie WR, Deng H, Li H, Bowen TL, Strong JA, Zhang J-M. Robust increase of cutaneous sensitivity, cytokine production and sympathetic sprouting in rats with localized inflammatory irritation of the spinal ganglia. Neuroscience. 2006;142:809–22. [PMC free article] [PubMed]
9. Xie W, Strong JA, Kim D, Shahrestani S, Zhang JM. Bursting activity in myelinated sensory neurons plays a key role in pain behavior induced by localized inflammation of the rat sensory ganglion. Neuroscience. 2012;206:212–23. [PMC free article] [PubMed]
10. Wang JG, Strong JA, Xie W, Zhang J-M. Local inflammation in rat dorsal root ganglion alters excitability and ion currents in small-diameter sensory neurons. Anesthesiology. 2007;107:322–32. [PMC free article] [PubMed]
11. Shepard JD, Barron KW, Myers DA. Stereotaxic localization of corticosterone to the amygdala enhances hypothalamo-pituitary-adrenal responses to behavioral stress. Brain Res. 2003;963:203–13. [PubMed]
12. Myers B, Greenwood-Van Meerveld B. Divergent effects of amygdala glucocorticoid and mineralocorticoid receptors in the regulation of visceral and somatic pain. Am J Physiol Gastrointest Liver Physiol. 2010;298:G295–303. [PubMed]
13. Sica DA. Pharmacokinetics and pharmacodynamics of mineralocorticoid blocking agents and their effects on potassium homeostasis. Heart Fail Rev. 2005;10:23–9. [PubMed]
14. Fagart J, Hillisch A, Huyet J, Barfacker L, Fay M, Pleiss U, Pook E, Schafer S, Rafestin-Oblin ME, Kolkhof P. A new mode of mineralocorticoid receptor antagonism by a potent and selective nonsteroidal molecule. J Biol Chem. 2010;285:29932–40. [PubMed]
15. Chaplan SR, Bach FW, Pogrel JW, Chung JM, Yaksh TL. Quantitative assessment of tactile allodynia in the rat paw. J Neurosci Methods. 1994;53:55–63. [PubMed]
16. Wang JG, Strong JA, Xie W, Yang RH, Coyle DE, Wick DM, Dorsey ED, Zhang JM. The chemokine CXCL1/growth related oncogene increases sodium currents and neuronal excitability in small diameter sensory neurons. Mol Pain. 2008;4:38. [PMC free article] [PubMed]
17. Rozen S, Skaletsky H. Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol. 2000;132:365–86. [PubMed]
18. Gomez-Sanchez CE, de Rodriguez AF, Romero DG, Estess J, Warden MP, Gomez-Sanchez MT, Gomez-Sanchez EP. Development of a panel of monoclonal antibodies against the mineralocorticoid receptor. Endocrinology. 2006;147:1343–8. [PubMed]
19. Stephenson JL, Byers MR. GFAP immunoreactivity in trigeminal ganglion satellite cells after tooth injury in rats. Exp Neurol. 1995;131:11–22. [PubMed]
20. Woodham P, Anderson PN, Nadim W, Turmaine M. Satellite cells surrounding axotomised rat dorsal root ganglion cells increase expression of a GFAP-like protein. Neurosci Lett. 1989;98:8–12. [PubMed]
21. Strong JA, Xie W, Coyle DE, Zhang JM. Microarray analysis of rat sensory ganglia after local inflammation implicates novel cytokines in pain. Plos One. 2012:e40779. [PMC free article] [PubMed]
22. Neves MF, Amiri F, Virdis A, Diep QN, Schiffrin EL. Role of aldosterone in angiotensin II-induced cardiac and aortic inflammation, fibrosis, and hypertrophy. Can J Physiol Pharmacol. 2005;83:999–1006. [PubMed]
23. Li X, Meng Y, Wu P, Zhang Z, Yang X. Angiotensin II and Aldosterone stimulating NF-kappaB and AP-1 activation in hepatic fibrosis of rat. Regul Pept. 2007;138:15–25. [PubMed]
24. Leroy V, De Seigneux S, Agassiz V, Hasler U, Rafestin-Oblin ME, Vinciguerra M, Martin PY, Feraille E. Aldosterone activates NF-kappaB in the collecting duct. J Am Soc Nephrol. 2009;20:131–44. [PubMed]
25. Niederberger E, Geisslinger G. The IKK-NF-kappaB pathway: A source for novel molecular drug targets in pain therapy? Faseb J. 2008;22:3432–42. [PubMed]
26. Zang Y, He XH, Xin WJ, Pang RP, Wei XH, Zhou LJ, Li YY, Liu XG. Inhibition of NF-kappaB prevents mechanical allodynia induced by spinal ventral root transection and suppresses the re-expression of Nav1.3 in DRG neurons in vivo and in vitro. Brain Res. 2010;1363:151–8. [PubMed]
27. Gu Y, Chen Y, Zhang X, Li GW, Wang C, Huang LY. Neuronal soma-satellite glial cell interactions in sensory ganglia and the participation of purinergic receptors. Neuron Glia Biol. 2010;6:53–62. [PMC free article] [PubMed]
28. Xie W, Strong JA, Li H, Zhang J-M. Sympathetic sprouting near sensory neurons after nerve injury occurs preferentially on spontaneously active cells and is reduced by early nerve block. J Neurophysiol. 2007;97:492–502. [PMC free article] [PubMed]
29. Xie W, Strong JA, Zhang JM. Early blockade of injured primary sensory afferents reduces glial cell activation in two rat neuropathic pain models. Neuroscience. 2009;160:847–57. [PMC free article] [PubMed]
30. Tanaka J, Fujita H, Matsuda S, Toku K, Sakanaka M, Maeda N. Glucocorticoid- and mineralocorticoid receptors in microglial cells: The two receptors mediate differential effects of corticosteroids. Glia. 1997;20:23–37. [PubMed]
31. Joels M, Karst H, DeRijk R, de Kloet ER. The coming out of the brain mineralocorticoid receptor. Trends Neurosci. 2008;31:1–7. [PubMed]
32. Grossmann C, Gekle M. New aspects of rapid aldosterone signaling. Mol Cell Endocrinol. 2009;308:53–62. [PubMed]
33. Karst H, Berger S, Turiault M, Tronche F, Schutz G, Joels M. Mineralocorticoid receptors are indispensable for nongenomic modulation of hippocampal glutamate transmission by corticosterone. Proc Natl Acad Sci U S A. 2005;102:19204–7. [PubMed]
34. Wang S, Lim G, Zeng Q, Sung B, Ai Y, Guo G, Yang L, Mao J. Expression of central glucocorticoid receptors after peripheral nerve injury contributes to neuropathic pain behaviors in rats. J Neurosci. 2004;24:8595–605. [PubMed]
35. Gu X, Peng L, Yang D, Ma Q, Zheng Y, Liu C, Zhu B, Song L, Sun X, Ma Z. The respective and interaction effects of spinal GRs and MRs on radicular pain induced by chronic compression of the dorsal root ganglion in the rat. Brain Res. 2011;1396:88–95. [PubMed]
36. Uesugi K, Sekiguchi M, Kikuchi S, Konno S. The effect of repeated restraint stress in pain-related behavior induced by nucleus pulposus applied on the nerve root in rats. Eur Spine J. 2011;20:1885–91. [PMC free article] [PubMed]
37. Prager EM, Brielmaier J, Bergstrom HC, McGuire J, Johnson LR. Localization of mineralocorticoid receptors at mammalian synapses. PLoS One. 2010;5:e14344. [PMC free article] [PubMed]