Role of Transcriptional Corepressor CtBP1 in Prostate Cancer Progression

Neoplasia. 2012 October; 14(10): 905–914.

PMCID: PMC3479836

Role of Transcriptional Corepressor CtBP1 in Prostate Cancer Progression^1,²

Rui Wang,^*^† Irfan A Asangani,^*^† Balabhadrapatruni VSK Chakravarthi,^*^† Bushra Ateeq,^*^† Robert J Lonigro,^*^‡ Qi Cao,^*^† Ram-Shankar Mani,^*^† Daniel F Camacho,^§ Natalie McGregor,^§ Taibriana EW Schumann,^§ Xiaojun Jing,^*^† Radhika Menawat,^¶ Scott A Tomlins,^*^† Heng Zheng,^*^† Arie P Otte,^# Rohit Mehra,^*^† Javed Siddiqui,^*^† Saravana M Dhanasekaran,^*^† Mukesh K Nyati,^‡^¶ Kenneth J Pienta,^*^§^** Nallasivam Palanisamy,^*^†^‡ Lakshmi P Kunju,^*^† Mark A Rubin,^†† Arul M Chinnaiyan,^*^†^‡^**^‡‡³ and Sooryanarayana Varambally^*^†^‡³

^*Michigan Center for Translational Pathology, Ann Arbor, MI

^†Department of Pathology, University of Michigan, Ann Arbor, MI

^‡Comprehensive Cancer Center, University of Michigan Medical School, Ann Arbor, MI

^§Department of Internal Medicine, University of Michigan, Ann Arbor, MI

^¶Department of Radiation Oncology, University of Michigan, Ann Arbor, MI

^#Swammerdam Institute for Life Sciences, University of Amsterdam, Amsterdam, The Netherlands

^**Department of Urology, University of Michigan, Ann Arbor, MI

^††Departments of Pathology and Laboratory Medicine, Weill Cornell Cancer Center, New York, NY

^‡‡Howard Hughes Medical Institute, University of Michigan Medical School, Ann Arbor, MI

Address all correspondence to: Sooryanarayana Varambally, PhD, Michigan Center for Translational Pathology, Department of Pathology, University of Michigan Medical School, 2900 Huron Parkway, Traverwood IV, Suite 100, Ann Arbor, MI 48109-0602. E-mail: soory/at/med.umich.edu

³Share senior authorship.

Received July 23, 2012; Revised August 22, 2012; Accepted August 24, 2012.

This article has been cited by other articles in PMC.

Abstract

Transcriptional repressors and corepressors play a critical role in cellular homeostasis and are frequently altered in cancer. C-terminal binding protein 1 (CtBP1), a transcriptional corepressor that regulates the expression of tumor suppressors and genes involved in cell death, is known to play a role in multiple cancers. In this study, we observed the overexpression and mislocalization of CtBP1 in metastatic prostate cancer and demonstrated the functional significance of CtBP1 in prostate cancer progression. Transient and stable knockdown of CtBP1 in prostate cancer cells inhibited their proliferation and invasion. Expression profiling studies of prostate cancer cell lines revealed that multiple tumor suppressor genes are repressed by CtBP1. Furthermore, our studies indicate a role for CtBP1 in conferring radiation resistance to prostate cancer cell lines. In vivo studies using chicken chorioallantoic membrane assay, xenograft studies, and murine metastasis models suggested a role for CtBP1 in prostate tumor growth and metastasis. Taken together, our studies demonstrated that dysregulated expression of CtBP1 plays an important role in prostate cancer progression and may serve as a viable therapeutic target.

Introduction

Transcriptional corepressor C-terminal binding protein 1 (CtBP1) is known to play a crucial role in cellular homeostasis by regulating the expression of numerous genes [1]. CtBP1 binds to and modulates the activities of several transcription factors such as BKLF, FOG 1 and 2, ZEB, EVI-1, and Zinc finger protein IKAROS among others [2]. DNA-binding proteins recruit CtBP1 through the PLDLS motif, originally identified in adenovirus early region 1A (E1A) protein [2,3]. Studies have shown that CtBP1 has NAD-dependent dehydrogenase activity and forms repressive complexes with other proteins [4,5]. The enzymatic function of CtBP1 makes it an attractive therapeutic target. Whereas the precise mechanism of CtBP1-mediated transcriptional repression is unclear, studies suggest that it may involve histone deacetylases (HDACs) that remove acetyl groups from histone tails, enabling chromatin condensation and repression of gene expression [6,7]. CtBP1 has also been shown to interact with the polycomb group (PcG) transcriptional repressor HPC2 [8]. In Drosophila, CtBP was reported to regulate the expression of intergenic transcripts that regulate DNA binding by PcG proteins [9], providing a link between CtBP1 and PcG member histone methyltransferase EZH2, which is overexpressed in a wide variety of aggressive tumors including prostate cancer [10]. A considerable amount of evidence suggests a critical role for CtBP1 in tumor growth and epithelial-mesenchymal transition [11]. One well-characterized target of CtBP1-mediated transcriptional repression is the tumor suppressor and cell adhesion molecule E-cadherin [12–15]. In myeloid leukemia cells, EVI-1-mediated transformation is abrogated when its CtBP1 binding motifs are mutated, implicating a role for CtBP1 in promoting oncogenesis in these cancers [16]. In breast cancer, CtBP1 suppresses apoptosis and promotes cell cycle progression [17], and a recent study indicated that most of the invasive ductal breast cancer cases were CtBP1-positive compared to normal breast tissue [18]. Furthermore, in pituitary tumor cells, knockdown of CtBP1 resulted in reduced cell proliferation [19]. Whereas these studies suggest an oncogenic role for CtBP1, a detailed molecular mechanism of CtBP1-mediated tumorigenesis has not been explored in prostate cancer.

In the present study, we validated the overexpression of CtBP1 and characterized its role in prostate cancer progression. Gene expression studies using RNA from CtBP1-modulated prostate cell lines identified targets of CtBP1-mediated repression. Knockdown studies demonstrated that CtBP1 expression is essential for prostate cancer cell growth and proliferation as well as reactivation of the target tumor suppressors. Removal of CtBP1 reduced cell survival and sensitized aggressive prostate cancer cells to radiation. Importantly, our in vivo studies uncovered a critical role for CtBP1 in prostate cancer growth and tumor metastasis. Overall, our investigations indicate that CtBP1 plays an essential role in prostate cancer progression and warrants consideration as a valuable therapeutic target.

Materials and Methods

Expression Analysis

CtBP1 gene expression data were procured from cDNA microarray analysis [20]. To measure the CtBP1 transcript levels, total RNA was isolated from prostate cell lines and prostate tissue samples using the RNeasy Mini Kit (Qiagen, Valencia, CA). Quantitative polymerase chain reaction (qPCR) was performed as described [21]. All primers were synthesized by Integrated DNA Technologies, Coralville, IA. PCR reactions were performed in triplicates. Primer sequences used in the present study include CtBP1: F, TCACAGGCCGGATCCCAGACAG and R, GGTACCTATAGGCAGCCCCATTGAGC and F, CCGTCAAGCAGATGAGACAA and R, GGCTAAAGCTGAAGGGTTCC; E cadherin: F, GGAGGAGAGCGGTGGTCAAA and R, TGTGCAGCTGGCTCAAGTCAA; ARHGDIB: F, ACAGGACTGGGGTGAAAGTG and R, GAGCCTCCTCAACTGGAGTG; LCN2: F, CAAGGAGCTGACTTCGGAAC and R, TACACTGGTCGATTGGGACA.

For immunoblot analysis, 10 µg of normal and prostate cancer tissues as well as prostate cancer cell line lysates was boiled in sample buffer, separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and transferred onto polyvinylidene difluoride membrane (GE Healthcare, Piscataway, NJ). The membrane was incubated for 1 hour in blocking buffer (TBS, 0.1% Tween, 5% nonfat dry milk) and incubated overnight at 4°C with respective primary antibodies, and signals were visualized after incubating with secondary antibody conjugated with HRP. Densitometric scan of the immunoblot was performed using ImageJ. The following antibodies and dilutions were used for the immunoblots: anti-CtBP1 (1:2000 in blocking buffer, BD Biosciences [San Jose, CA], Cat. No. 612042,), anti-LCN2 (1:10,000, R&D Systems [Minneapolis, MN], Cat. No. AF1757), phospho-H2AX (1:2000, Millipore [Billerica, MA], Cat. No. 16-202A), anti-β-actin mouse monoclonal antibody (1:20,000, Sigma [St Louis, MO], Cat. No. A5316-500ul), glyceraldehyde 3-phosphate dehydrogenase (GAPDH) antibody (1:5000, Abcam [Cambridge, MA], Cat. No. ab8245), and β-tubulin (1:2000, Santa Cruz Biotechnology [Santa Cruz, CA], sc-9104).

Immunohistochemistry

Benign and prostate cancer tissues were obtained from the radical prostatectomy series at the University of Michigan and from the Rapid Autopsy Program, both part of the Michigan Prostate SPORE Tissue Core. Institutional Review Board approval was obtained to procure and analyze the tissues used in this study. Immunohistochemistry was carried out using standard biotin-avidin complex to evaluate CtBP1 expression using mouse monoclonal antibody against CtBP1 (BD Biosciences) as well as a rabbit polyclonal antibody [22].

RNA Interference

Small interfering RNA (siRNA) duplexes for RNA interference of CtBP1 was purchased from Dharmacon, Lafayette, CO (Thermo Scientific, Cat. No. LQ-008609-00-0002). Short hairpin RNA (shRNA) constructs were generated using pGreen-puro vector for two of the most efficient siRNA duplexes by SBI (System Biosciences, Mountain View, CA). Lentivirus for the stable knockdown of CtBP1 was generated by the University of Michigan Vector Core. To perform the siRNA knockdown, we plated prostate cancer cell lines DU145, PC3, and LNCaP at 2 x 10⁵ cells per well in a 6-well plate for immunoblot analysis and cell proliferation analysis and at 1.5 x 10³ cells per well in a 96-well plate for Cell Titer-Glo (Promega, Madison, WI) proliferation assays. Twelve hours after plating, the cells were transfected with siRNA duplex, using Oligofectamine (Invitrogen, Carlsbad, CA). A second identical transfection was performed 24 hours later. Sixty-four hours after the first transfection, the cells were harvested for RNA isolation or lysed for immunoblot analysis. For knockdown of LCN2 (NGAL), specific siRNA (Dharmacon, Cat. Nos J-003679-07 and J-003679-09) were used in DU145 and PC3 stable CtBP1 knockdown cells.

Gene Expression Analysis of CtBP1 Knockdown Cells

RNA isolated from shRNA knockdown DU145, PC3, and LNCaP as well as nontarget control cells were used for gene expression profiling. Expression profiling was performed using the Agilent Whole Human Genome Oligo Microarray (Agilent, Santa Clara, CA) according to the manufacturer's protocol. Statistical analysis of gene expression array was performed. Microarray probes were identified as differential on CtBP1 knockdown if the mean log₂(Cy5/Cy3) ratio across cell lines was significantly different from zero as measured by one-sample two-sided Student's t tests, using a P-value cutoff of .05. The list of differentially expressed genes was additionally filtered such that the mean log₂(Cy5/Cy3) ratio exceeded log₂(2.5) in absolute value. The resulting list of 155 genes are shown in Figure 3A as a heat map and listed in Table W1. Statistical analysis was performed using R (www.r-project.org), version 2.15.0.

Figure 3

CtBP1 knockdown reactivate tumor suppressors in prostate cancer. (A) Heat map of genes that are significantly altered by CtBP1 stable knockdown in LNCaP, PC3, and DU145 cells. Log₂(Cy5/Cy3) ratios are shown for each expression array. Red and green represent (more ...)

Cell Proliferation Assays

For cell counts at 96 and 120 hours, the cells were treated with trypsin and replated in six-well dishes 64 hours after the first transfection. Stable knockdown of CtBP1 was performed using shRNA strategy using lentiviral construct with specific duplex sequences targeting CtBP1. DU145 and PC3 cell lines were used for stable CtBP1 knockdown. LCN2 and ARHGDIB were knocked down in stable CtBP1 knockdown PC3 and DU145 cells. Sequence information of all the siRNA used in this study has been given in the Supplementary materials. Cell proliferation was determined using ATPase assay kit (Promega) as described [23]. Additionally, cell proliferation was measured by cell counting. For this, 10,000 cells/well (DU145 and PC3) were seeded in 24-well plates (n = 3), and cells were harvested and counted at specified time points by Coulter counter (Beckman Coulter, Fullerton, CA).

Basement Membrane Matrix Invasion Assay

For invasion assays, control shRNA stable cells or CtBP1 stable knockdown cells as well as wild-type DU145 and PC3 cells were used. Equal numbers of the indicated cells were seeded onto the basement membrane matrix (BD Biosciences) present in the insert of a 24-well culture plate. RPMI medium supplemented with 10% FBS was added to the lower chamber as a chemoattractant. After 48 hours, non-invading cells and extracellular matrix were removed with a cotton swab. Invaded cells were stained with crystal violet and photographed. The inserts were treated with 10% acetic acid, and absorbance was measured at 560 nm.

Chromatin Immunoprecipitation Assay

The ChIP assays were performed as described [24]. Briefly, DU145 cells at 60% confluency were cross-linked with 1% formaldehyde for 10 minutes, followed by quenching with 0.125 M glycine for 5 minutes at room temperature. Cells were lysed and sonicated to fragment the chromatin to an average size of 500 bp. This was followed by overnight incubation with the antibodies and protein A or G magnetic beads. Cross-links were reversed by incubating chromatin at 62°C for 2 hours, and DNA was isolated. Tri-Methyl-Histone H3 (Lys4) antibody was obtained from Cell Signaling Technology, Danvers, MA (Cat. No. 9751S). Rabbit IgG (Diagenode [Denville, NJ], Cat. No. kch-504-250) was used as a control. Purified DNA was analyzed by qPCR to determine fold enrichment relative to input DNA. The primer sequences for the promoters analyzed are provided as follows. Primers used for ChIP assay are LCN2: F, TGCAGAAATCTTGCCAAGTG and R, GGGATCTAGGGTGGGTTGAT; ARHGDIB: F, CCCAGGGTTTCCTCTTCAA and R, TCAGTGCTTCACGTCTCTGTC; GAPDH: F, TACTAGCGGTTTTACGGGCG and R, TCGAACAGGAGGAGCAGAGAGCGA.

Clonogenic Survival Assay

Clonogenic survival assays were performed using standard techniques [25]. Cells were subcultured at clonal density immediately after irradiation. Cell survival curves were fitted using the linear quadratic equation, and the mean inactivation dose was calculated according to the method of Fertil and Malaise [26].

Chicken Embryo Chorioallantoic Membrane Assay

Chicken embryo chorioallantoic membrane (CAM) assay was performed as described previously [27]. To measure metastasis, we harvested lungs on day 18 of embryonic growth and analyzed for the presence of tumor cells by quantitative human Alu-specific PCR. Genomic DNA from lungs was prepared using the Puregene DNA purification system (Qiagen) and was quantified as previously described [28]. For measuring tumor growth, embryos were sacrificed on day 18 and extraembryonic xenografts were excised and weighed.

Prostate Tumor Xenograft Model

All procedures involving mice were approved by the University Committee on Use and Care of Animals at the University of Michigan and conform to their relevant regulatory standards. To evaluate the role of CtBP1 in tumor formation, we propagated stable CtBP1 knockdown DU145 pools, single clone, and vector control cells and inoculated 5 x 10⁶ cells subcutaneously into the dorsal flank of 5-week-old male nude athymic BALB/c nu/nu mice (n = 10 for each group; Charles River Laboratory, Wilmington, MA). Tumor size was measured weekly, and tumor volumes were calculated using the formula (π/6) (L x W²), where L = length of tumor and W = width.

Murine Tumor Metastasis Models and Bioluminescent Imaging

Experimental procedures were approved by the University Committee on Use and Care of Animals. Male CB17 severe combined immunodeficient mice (4–6 weeks of age) were bred in-house. CtBP1 knockdown PC3-Luc cell pools or nontargeting shRNA-transduced control cells were used for the metastasis model. Animals underwent intracardiac injections of 200,000 cells and were imaged once weekly by bioluminescent imaging (BLI) using a Xenogen IVIS 200 System at the University of Michigan's Center for Molecular Imaging as previously described [29]. Mice were injected with luciferin (100 µl at 40 mg/ml) by intraperitoneal injections. Ventral images were acquired 13 minutes after injection under 1.5% isoflurane anesthesia. Tumor burden of each animal was determined with Living Image software using regions of interest encompassing the entire animal. Animals with no tumor take were defined as those with bioluminescent flux less than 1.151 x 10⁶ p/s at week 8, and these animals were removed from subsequent analysis. Statistical significance was determined using one-sided two-sample t tests. Three animals closest in bioluminescent flux to each group's mean reading at week 8 were selected as representative images.

Results

CtBP1 Is Overexpressed in Metastatic Prostate Cancer

DNA microarray analysis indicated an up-regulation of CtBP1 in metastatic prostate cancer (Figure 1A). To validate this observation, we performed real-time qPCR using RNA from multiple prostate cancer and benign tissue samples. Real-time qPCR analysis confirmed the overexpression of CtBP1 in malignant prostate cancer tissues relative to benign prostate samples (Figure 1B). We next performed immunoblot analysis of prostate tissue using a CtBP1-specific mouse monoclonal antibody. Results indicated increased CtBP1 protein expression in metastatic prostate cancer relative to localized prostate cancer or benign prostate tissues (Figure 1C). Densitometric quantification of the immunoblot indicated significant overexpression of CtBP1 inmetastatic prostate cancer tissues (Figure W1A). Additionally, CtBP1 was mainly localized to the nucleus (Figure 1D) in benign tissue. However in aggressive prostate cancers, increased CtBP1 staining was observed in the cytoplasm by immunohistochemistry analysis (Figure 1D). This observation was confirmed using an independent rabbit polyclonal antibody against CtBP (Figure W1B). Immunostaining using secondary antibody alone did not show any specific staining of the prostate tissue (Figure W1C).

Figure 1

Identification of CtBP1 overexpression in prostate cancer (PCa). (A) CtBP1 expression in the prostate cancer gene expression profiling study. Data were obtained from benign, prostate cancer, and metastatic prostate cancer (MET) tissue expression profiling. (more ...)

CtBP1 Is Involved in Prostate Cancer Cell Proliferation and Invasion

Because CtBP1 is known to play an oncogenic role in other cancers, we examined the role of CtBP1 in prostate cancer cell proliferation and invasion. We used both transient RNA interference as well as stable knockdown strategy specifically targeting CtBP1 in aggressive prostate cell lines DU145 and PC3. The transient and stable knockdown of CtBP1 were confirmed by immunoblot analysis (Figures 2A and W2A). Using a commercially available cell proliferation assay reagent Cell Titer-Glo (Promega), we observed a decrease in cell proliferation on both transient and stable knockdown of CtBP1 relative to control cells (Figures 2, B and C, and W2B). Likewise, knockdown of CtBP1 in prostate cancer cells reduced the ability of these cancer cells to invade in a Boyden chamber matrigel invasion assay (Figures 2, D and E, and W2C). Together, these observations support the involvement of CtBP1 in the proliferation and invasion of prostate cancer cells in vitro.

Figure 2

CtBP1 plays a role in cell proliferation and invasion. (A) Knockdown of CtBP1 in prostate cancer cell lines. Immunoblot analysis using lysates from aggressive prostate cell lines DU145 and PC3 treated with two CtBP1-specific shRNA lentivirus and nontargeting (more ...)

Regulation of Gene Expression by CtBP1 in Prostate Cancer Cells

To dissect the functional role of CtBP1 in prostate cancer progression and transcriptional repression in prostate cancer cells, we performed global gene expression analysis using RNA from CtBP1 knockdown prostate cell lines. We generated stable CtBP1 knockdown DU145, PC3, and LNCaP prostate cancer cell lines using lentivirus-based shRNA. We identified multiple molecular targets of CtBP1 that became activated on CtBP1 knockdown including tumor suppressors and metastasis suppressors (Figure 3A and Table W1). We validated the reactivation of known CtBP1 repression target E-cadherin in CtBP1 knockdown cells (Figure 3B) as well as novel targets LCN2 and ARHGDIB (RhoGDI2) that are implicated in invasion and metastasis suppression [30,31] (Figures 3, C and D, and W3, A and B). Chromatin immunoprecipitation analysis at the promoter region of these genes in CtBP1 stable knockdown cells suggested an increase in the activating histone H3-trimethyl lysine 4 methylation mark compared to control GAPDH (Figure W3, C–E). Additionally, we performed the knockdown of the reactivated LCN2 in PC3-CtBP1 stable knockdown cell lines using two independent duplex targeting LCN2 (Figure 3E). Whereas knockdown of CtBP1 reduced the invasion along with reactivation of LCN2, subsequent knockdown of LCN2 in these cells led to reversion to invasive phenotype (Figure 3F), indicating a critical role for LCN2 in CtBP1-mediated invasion.

Knockdown of CtBP1 Renders Prostate Cancer Cells Sensitive to Radiation

CtBP1 has been shown to play a role in chemoresistance in breast cancer cells [32]. Furthermore, homeodomain-interacting protein kinase 2 is known to phosphorylate CtBP1, leading to its degradation on UV stimulation and causing apoptosis of cells [33,34]. To determine if CtBP1 also plays a role in regulating radiation resistance and DNA damage repair processes, we assessed the effect of CtBP1 on radiation-induced cell death. CtBP1 knockdown DU145 cells showed considerable reduction in clonogenic survival fraction (enhancement ratio, 1.4 ± 0.15) (Figure 4A), which correlated with the slower resolution of H2AX phosphorylation (Figure 4B).

Figure 4

Role of CtBP1 in radiation resistance. Effects of CtBP1 knockdown on clonogenic survival of DU145 cells. (A) Stable clones of CtBP1 along with controls were radiated with clinically relevant doses of radiation and immediately plated for clonogenic survival. (more ...)

CtBP1 Is Essential for Prostate Tumor Growth and Metastasis

To study the effect of CtBP1 on tumor growth and metastasis in vivo, we employed a chicken CAM model. CAM was performed as described previously [27] using CtBP1 knockdown DU145 and PC3 prostate cancer cells. Depletion of CtBP1 results in significantly reduced tumor weight compared to nontarget transfected control cells in both DU145 and PC3 cells (Figure 5, A and B). Further, the lungs of chicken embryos displayed attenuated metastasis in the CtBP1 knockdown group compared to the control group (Figure 5C).

Figure 5

CtBP1 knockdown reduces prostate tumor growth in vivo. (A, B) Chicken CAM assay. Tumor growth was measured in CAM models using DU145 and PC3 stable CtBP1 knockdown cells or control nontargeting shRNA stable cells. Tumors were harvested and tumor weights (more ...)

We next examined CtBP1-mediated tumorigenesis in a murine xenograft model. Single clone of CtBP1 knockdown cells as well as pooled CtBP1 knockdown DU145 cells showed significantly reduced tumor growth in mice (Figure 5D). We also employed a murine metastasis model using PC3 luciferase cells. CtBP1 stable knockdown in PC3 luciferase cells was confirmed by qPCR as well as immunoblot analysis (Figure W4A). Mice injected with CtBP1 knockdown prostate cancer cells showed reduced metastasis compared to nontargeting shRNA-transduced control PC3 luciferase cells (Figures 5E and W4B). These data provide compelling evidence for critical role of CtBP1 in prostate tumor growth and metastasis.

Discussion

In this study, we measured the expression level of transcriptional corepressor CtBP1 in prostate cancer and investigated the mechanism of its oncogenic action. It is becoming increasingly clear that dysregulated transcriptional repression plays a crucial role in tumorigenesis. Several epigenetic modifiers including HDACs and PcG proteins mediate transcriptional repression in cancer cells through posttranslational modification of histones. CtBP1 is known to act as a corepressor that binds to histone modifiers such as HDACs, G9A, as well as LSD1 [35] and recruits repressive complexes to promoters of tumor suppressors to inhibit their expression. Our study uncovers the role of CtBP1 in prostate cancer progression and its molecular targets. We demonstrated the overexpression and mislocalization of CtBP1 to cytoplasm in aggressive prostate cancers. The mechanism of CtBP1 mislocalization in aggressive cancer and the functional significance of cytoplasmic CtBP1 are yet to be elucidated. CtBP1 acts as a transcriptional repressor in prostate cancer, and gene expression profiling studies using multiple prostate cancer cell lines indicated derepression of numerous target genes on CtBP1 knockdown, many of which are tumor suppressors. Rescue experiments underscored the role of these transcriptional targets in prostate cancer progression. Moreover, LCN2, a target of CtBP1-mediated repression is known to function as an invasion and angiogenesis suppressor in pancreatic cancer [30]. Mice injected with MIAPaCa-2 pancreatic cells overexpressing LCN2 showed reduced tumor volume, local and distant metastasis, and angiogenesis. Our data show that LCN2 plays a similar role in prostate cancer cells. A recent study has shown that ARHGDIB, identified here as a CtBP1-mediated repression target, reduces tumor metastasis by altering inflammation in the tumor microenvironment [36]. Our in vitro and in vivo studies suggest that these targets are involved in CtBP1-mediated oncogenesis in prostate cancer cells. Knockdown of CtBP1 sensitized DU145 cells to radiation, suggesting an important role for CtBP1 in radiation-induced DNA repair. Interestingly, our preliminary mass spectrometry data suggest that CtBP1 binds to DNA damage repair pathway proteins (Varambally et al., unpublished observations). Importantly, these results have implications for patient overexpressing CtBP1 that undergo radiation therapy.

Here, we propose a model of CtBP1-mediated corepression and tumor suppressor axis in prostate cancer, wherein CtBP1 represses multiple tumor suppressors in prostate cancer. However, further studies are required to elucidate the mechanism of CtBP1-mediated radiation resistance to determine whether CtBP1 overexpression predicts aggressive disease and if it has a functional role in the cytoplasm. The NAD-dependent dehydrogenase activity of CtBP1 makes it an attractive therapeutic target. Small-molecule inhibitors targeting CtBP1 enzymatic activity or its interaction with downstream targets and binding proteins could potentially serve as an effective strategy to inhibit its oncogenic activity.

Supplementary Material

Supplementary Figures and Tables

Click here to view.^{(1.6M, pdf)}

Acknowledgments

We thank Jyoti Athanikar for critical reading of themanuscript. We also thank John Prensner, Xuhong Cao, and Jacob Scherba for assistance in experiments; the University of Michigan Vector Core for generation of CtBP1 shRNA lentivirus; and Prof. G. Chinnadurai (Institute for Molecular Virology, Saint Louis University Health Sciences Center, Doisy Research Center, St Louis, MO) for helpful discussions.

Abbreviations


PCa	prostate cancer

CtBP1	C-terminal binding protein 1

HDAC	histone deacetylase

siRNA	small interfering RNA

Footnotes

¹Research reported in this publication was supported in part by grants from the Department of Defense to A.M.C. (PC020322) and the National Cancer Institute of the National Institutes of Health to S.V. (R01CA154980). S.V. is also supported by a grant from the National Cancer Institute of the National Institutes of Health (R01CA157845). This work was also supported in part by the Prostate Cancer Foundation (A.M.C.), NIH Prostate Specialized Program of Research Excellence P50CA69568, and Early Detection Research Network UO1 CA111275 (A.M.C.). A.M.C. is also supported by the Doris Duke Charitable Foundation Clinical Scientist Award and the Howard Hughes Medical Institute. A.M.C. is an American Cancer Society Research Professor and a Taubman Scholar of the University of Michigan.

²This article refers to supplementary materials, which are designated by Table W1 and Figures W1 to W4 and are available online at www.neoplasia.com.

References

1. Grooteclaes M, Deveraux Q, Hildebrand J, Zhang Q, Goodman RH, Frisch SM. C-terminal-binding protein corepresses epithelial and proapoptotic gene expression programs. Proc Natl Acad Sci USA. 2003;100:4568–4573. [PubMed]

2. Chinnadurai G. CtBP, an unconventional transcriptional corepressor in development and oncogenesis. Mol Cell. 2002;9:213–224. [PubMed]

3. Schaeper U, Boyd JM, Verma S, Uhlmann E, Subramanian T, Chinnadurai G. Molecular cloning and characterization of a cellular phosphoprotein that interacts with a conserved C-terminal domain of adenovirus E1A involved in negative modulation of oncogenic transformation. Proc Natl Acad Sci USA. 1995;92:10467–10471. [PubMed]

4. Kumar V, Carlson JE, Ohgi KA, Edwards TA, Rose DW, Escalante CR, Rosenfeld MG, Aggarwal AK. Transcription corepressor CtBP is an NAD⁺-regulated dehydrogenase. Mol Cell. 2002;10:857–869. [PubMed]

5. Balasubramanian P, Zhao LJ, Chinnadurai G. Nicotinamide adenine dinucleotide stimulates oligomerization, interaction with adenovirus E1A and an intrinsic dehydrogenase activity of CtBP. FEBS Lett. 2003;537:157–160. [PubMed]

6. Sundqvist A, Sollerbrant K, Svensson C. The carboxy-terminal region of adenovirus E1A activates transcription through targeting of a C-terminal binding protein-histone deacetylase complex. FEBS Lett. 1998;429:183–188. [PubMed]

7. Koipally J, Georgopoulos K. Ikaros interactions with CtBP reveal a repression mechanism that is independent of histone deacetylase activity. J Biol Chem. 2000;275:19594–19602. [PubMed]

8. Sewalt RG, Gunster MJ, van der Vlag J, Satijn DP, Otte AP. C-terminal binding protein is a transcriptional repressor that interacts with a specific class of vertebrate polycomb proteins. Mol Cell Biol. 1999;19:777–787. [PMC free article] [PubMed]

9. Basu A, Atchison ML. CtBP levels control intergenic transcripts, PHO/YY1 DNA binding, and PcG recruitment to DNA. J Cell Biochem. 2010;110:62–69. [PubMed]

10. Varambally S, Dhanasekaran SM, Zhou M, Barrette TR, Kumar-Sinha C, Sanda MG, Ghosh D, Pienta KJ, Sewalt RG, Otte AP, et al. The polycomb group protein EZH2 is involved in progression of prostate cancer. Nature. 2002;419:624–629. [PubMed]

11. Chinnadurai G. The transcriptional corepressor CtBP: a foe of multiple tumor suppressors. Cancer Res. 2009;69:731–734. [PubMed]

12. Grooteclaes ML, Frisch SM. Evidence for a function of CtBP in epithelial gene regulation and anoikis. Oncogene. 2000;19:3823–3828. [PubMed]

13. Comijn J, Berx G, Vermassen P, Verschueren K, van Grunsven L, Bruyneel E, Mareel M, Huylebroeck D, van Roy F. The two-handed E box binding zinc finger protein SIP1 downregulates E-cadherin and induces invasion. Mol Cell. 2001;7:1267–1278. [PubMed]

14. Shi Y, Sawada J, Sui G, Affarel B, Whetstine JR, Lan F, Ogawa H, Luke MP, Nakatani Y, Shi Y. Coordinated histone modifications mediated by a CtBP co-repressor complex. Nature. 2003;422:735–738. [PubMed]

15. Zhou BP, Hung MC. Wnt, hedgehog and snail: sister pathways that control by GSK-3β and β-Trcp in the regulation of metastasis. Cell Cycle. 2005;4:772–776. [PubMed]

16. Palmer S, Brouillet JP, Kilbey A, Fulton R, Walker M, Crossley M, Bartholomew C. Evi-1 transforming and repressor activities are mediated by CtBP co-repressor proteins. J Biol Chem. 2001;276:25834–25840. [PubMed]

17. Bergman LM, Birts CN, Darley M, Gabrielli B, Blaydes JP. CtBPs promote cell survival through the maintenance of mitotic fidelity. Mol Cell Biol. 2009;29:4539–4551. [PMC free article] [PubMed]

18. Deng Y, Deng H, Liu J, Han G, Malkoski S, Liu B, Zhao R, Wang XJ, Zhang Q. Transcriptional down-regulation of Brca1 and E-cadherin by CtBP1 in breast cancer. Mol Carcinog. 2012;51:500–507. [PubMed]

19. Dorman K, Shen Z, Yang C, Ezzat S, Asa SL. CtBP1 interacts with Ikaros and modulates pituitary tumor cell survival and response to hypoxia. Mol Endocrinol. 2012;26:447–457. [PubMed]

20. Tomlins SA, Mehra R, Rhodes DR, Cao X, Wang L, Dhanasekaran SM, Kalyana-Sundaram S, Wei JT, Rubin MA, Pienta KJ, et al. Integrative molecular concept modeling of prostate cancer progression. Nat Genet. 2007;39:41–51. [PubMed]

21. Kleer CG, Cao Q, Varambally S, Shen R, Ota I, Tomlins SA, Ghosh D, Sewalt RG, Otte AP, Hayes DF, et al. EZH2 is a marker of aggressive breast cancer and promotes neoplastic transformation of breast epithelial cells. Proc Natl Acad Sci USA. 2003;100:11606–11611. [PubMed]

22. Dukers DF, van Galen JC, Giroth C, Jansen P, Sewalt RG, Otte AP, Kluin-Nelemans HC, Meijer CJ, Raaphorst FM. Unique polycomb gene expression pattern in Hodgkin's lymphoma and Hodgkin's lymphoma-derived cell lines. Am J Pathol. 2004;164:873–881. [PubMed]

23. Ateeq B, Tomlins SA, Laxman B, Asangani IA, Cao Q, Cao X, Li Y, Wang X, Feng FY, Pienta KJ, et al. Therapeutic targeting of SPINK1-positive prostate cancer. Sci Transl Med. 2011;3:72ra17. [PMC free article] [PubMed]

24. Varambally S, Cao Q, Mani RS, Shankar S, Wang X, Ateeq B, Laxman B, Cao X, Jing X, Ramnarayanan K, et al. Genomic loss of microRNA-101 leads to overexpression of histone methyltransferase EZH2 in cancer. Science. 2008;322:1695–1699. [PMC free article] [PubMed]

25. Ahsan A, Hiniker SM, Davis MA, Lawrence TS, Nyati MK. Role of cell cycle in epidermal growth factor receptor inhibitor-mediated radiosensitization. Cancer Res. 2009;69:5108–5114. [PMC free article] [PubMed]

26. Fertil B, Malaise EP. Intrinsic radiosensitivity of human cell lines is correlated with radioresponsiveness of human tumors: analysis of 101 published survival curves. Int J Radiat Oncol Biol Phys. 1985;11:1699–1707. [PubMed]

27. Brenner JC, Ateeq B, Li Y, Yocum AK, Cao Q, Asangani IA, Patel S, Wang X, Liang H, Yu J, et al. Mechanistic rationale for inhibition of poly(ADP-ribose) polymerase in ETS gene fusion-positive prostate cancer. Cancer Cell. 2011;19:664–678. [PMC free article] [PubMed]

28. van der Horst EH, Leupold JH, Schubbert R, Ullrich A, Allgayer H. TaqMan-based quantification of invasive cells in the chick embryo metastasis assay. Biotechniques. 2004;37:940–942. 944–946. [PubMed]

29. Mizutani K, Sud S, McGregor NA, Martinovski G, Rice BT, Craig MJ, Varsos ZS, Roca H, Pienta KJ. The chemokine CCL2 increases prostate tumor growth and bone metastasis through macrophage and osteoclast recruitment. Neoplasia. 2009;11:1235–1242. [PMC free article] [PubMed]

30. Tong Z, Kunnumakkara AB, Wang H, Matsuo Y, Diagaradjane P, Harikumar KB, Ramachandran V, Sung B, Chakraborty A, Bresalier RS, et al. Neutrophil gelatinase-associated lipocalin: a novel suppressor of invasion and angiogenesis in pancreatic cancer. Cancer Res. 2008;68:6100–6108. [PMC free article] [PubMed]

31. Gildea JJ, Seraj MJ, Oxford G, Harding MA, Hampton GM, Moskaluk CA, Frierson HF, Conaway MR, Theodorescu D. RhoGDI2 is an invasion and metastasis suppressor gene in human cancer. Cancer Res. 2002;62:6418–6423. [PubMed]

32. Birts CN, Harding R, Soosaipillai G, Halder T, Azim-Araghi A, Darley M, Cutress RI, Bateman AC, Blaydes JP. Expression of CtBP family protein isoforms in breast cancer and their role in chemoresistance. Biol Cell. 2010;103:1–19. [PMC free article] [PubMed]

33. Zhang Q, Yoshimatsu Y, Hildebrand J, Frisch SM, Goodman RH. Homeodomain interacting protein kinase 2 promotes apoptosis by downregulating the transcriptional corepressor CtBP. Cell. 2003;115:177–186. [PubMed]

34. Zhang Q, Nottke A, Goodman RH. Homeodomain-interacting protein kinase-2 mediates CtBP phosphorylation and degradation in UV-triggered apoptosis. Proc Natl Acad Sci USA. 2005;102:2802–2807. [PubMed]

35. Kuppuswamy M, Vijayalingam S, Zhao LJ, Zhou Y, Subramanian T, Ryerse J, Chinnadurai G. Role of the PLDLS-binding cleft region of CtBP1 in recruitment of core and auxiliary components of the corepressor complex. Mol Cell Biol. 2008;28:269–281. [PMC free article] [PubMed]

36. Said N, Sanchez-Carbayo M, Smith SC, Theodorescu D. RhoGDI2 suppresses lung metastasis in mice by reducing tumor versican expression and macrophage infiltration. J Clin Invest. 2012;122:1503–1518. [PMC free article] [PubMed]

Articles from Neoplasia (New York, N.Y.) are provided here courtesy of
Neoplasia Press