PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Virology. Author manuscript; available in PMC Nov 10, 2013.
Published in final edited form as:
PMCID: PMC3444662
NIHMSID: NIHMS396360
Identification and Characterization of a DNA Binding Domain on the Adenovirus IVa2 Protein
Joan B. Christensen, Sean G. Ewing, and Michael J. Imperiale*
Department of Microbiology and Immunology University of Michigan Medical School 1150 W Medical Center Dr 5724 Medical Science Building II Ann Arbor, MI 48109
* Corresponding author ; imperial/at/umich.edu 734-763-9162 Fax 734-615-6560
The adenovirus IVa2 protein has been implicated as a transcriptional activator of the viral major late promoter (MLP) and a key component in the packaging of the viral genome. IVa2 functions in packaging through its ability to form a complex with the viral L1 52/55 kDa protein, which is required for encapsidation. IVa2, alone and in conjunction with another viral protein, the L4 22K protein, binds to the packaging sequence on the viral genome and to specific elements in the promoter. To define the DNA binding domain on IVa2 and determine its contribution to the viral life cycle, we created a mutant protein that lacks a putative helix-turn-helix motif at the extreme C-terminus. Characterization of this mutant protein showed that while MLP activity is relatively unaffected, it is unable to bind to and package DNA.
Keywords: adenovirus, major late promoter, assembly, DNA packaging
Adenoviruses are believed to assemble through a stepwise process in which the structural proteins form an empty capsid, followed by recognition of the viral DNA genome by additional viral proteins that package it in a polar fashion into the empty capsid (D'Halluin et al., 1980; D'Halluin et al., 1978; Edvardsson et al., 1976; Ostapchuk and Hearing, 2005). The double-stranded, linear genome contains a cis-acting element at its left end called the packaging sequence, which directs DNA encapsidation (Hammarskjold and Winberg, 1980). In human adenovirus type 5 (HAd5), the packaging sequence contains seven functionally redundant A-T rich motifs, termed A repeats, that span 200 base pairs between the 5’ inverted terminal repeat and the E1A transcription unit (Grable and Hearing, 1990, 1992; Hearing et al., 1987; Schmid and Hearing, 1997). Several studies have shown that the viral IVa2, L4 22K, and L1 52/55 kDa proteins interact with the packaging sequence and are required for assembly of infectious particles (Ewing et al., 2007; Gustin and Imperiale, 1998; Ostapchuk et al., 2011; Ostapchuk et al., 2006; Perez-Romero et al., 2005; Zhang and Imperiale, 2003). The L1 52/55 kDa protein was the first of these proteins shown to be required for encapsidation. A mutant virus that produces a temperature sensitive L1 52/55 kDa protein only packages the left end of the genome at the restrictive temperature, and a mutant that cannot produce the protein forms only empty capsids (Gustin and Imperiale, 1998; Hasson et al., 1989). The finding that L1 52/55 kDa forms a complex with IVa2 (Gustin et al., 1996) prompted an examination of whether IVa2 is also involved in packaging. IVa2 forms specific complexes with the packaging sequence in vitro (Ostapchuk et al., 2005; Tyler et al., 2007; Zhang and Imperiale, 2000) and in vivo (Perez-Romero et al., 2005). While initial analysis of a mutant virus that cannot produce IVa2, pm8002, suggested that IVa2 is required for capsid assembly, more recent evidence demonstrates that while IVa2 is required for genome packaging, empty capsid assembly is IVa2-independent (Ostapchuk et al., 2011; Zhang and Imperiale, 2003). Recently the L4 22K protein, and possibly the related L4 33K protein (hereafter referred to as L4 22K/33K), were identified in electrophoretic mobility shift assays (EMSAs) as components of one of the two IVa2-containing complexes that are present in infected cells (Ali et al., 2007; Ewing et al., 2007; Ostapchuk et al., 2006). The high affinity binding of IVa2 to the packaging sequence with L4 22K, the interaction between IVa2 and L1 52/55 kDa proteins, and the observation that IVa2 is localized at a single vertex of the mature virion (Christensen et al., 2008), all underscore the importance of IVa2 in DNA packaging.
As is the case for many viral proteins, IVa2 is multifunctional. In addition to its role in encapsidation, IVa2 has been shown to bind to the major late promoter (MLP)(Lutz and Kedinger, 1996; Tribouley et al., 1994). In transfection assays, IVa2 binding to the promoter is required for transactivation of the promoter (Tribouley et al., 1994). However, mutant viruses that do not produce IVa2 or that contain mutations in the IVa2 binding sites on the MLP, called DE1 and DE2, show only modest decreases in MLP activity (Pardo-Mateos and Young, 2004b; Zhang and Imperiale, 2003). The two types of complexes that form at the MLP are the same as those that form on the packaging sequence: one is a homodimer of IVa2 and the other is a heterodimer of IVa2 and 22K/33K (Ali et al., 2007; Ewing et al., 2007; Lutz and Kedinger, 1996; Ostapchuk et al., 2006; Tribouley et al., 1994).
To better understand the roles of IVa2 in transcriptional activation and virus assembly, we wished to define a DNA binding domain on the protein and assess the phenotype of a protein in which this domain was mutated. Here we identify a sequence at the IVa2 C-terminus that is required for DNA binding of IVa2, and show that loss of binding results in an inability to package DNA while retaining capsid assembly ability. Moreover, this mutation does not affect gene expression from the MLP. These data support a model in which the major role of the IVa2 protein is to package the adenovirus genome into the viral particle.
Purification and structural analysis of IVa2(wt) and IVa2(1-439)
To characterize the DNA binding domain of the IVa2 protein and the role of binding in replication and virus assembly, we sought to produce a mutant protein that does not bind DNA. Previous work had suggested the presence of a DNA binding domain in the C-terminus of the 449 amino acid protein (Lutz et al., 1996). Examination of the C-terminal sequence indicated the presence of a putative helix-turn-helix DNA binding motif starting at amino acid residue L421: LYHVLEKIHRTLNDRDRWSRAYRARKTPK (helices underlined). We therefore deleted the terminal ten amino acids from the IVa2 protein and assessed the properties of the resulting protein, IVa2(1-439). First, we expressed the IVa2(wt) and IVa2(1-439) proteins in E. coli with a C-terminal chitin binding domain tag for purification (Tyler et al., 2007). Following intein-mediated cleavage to remove the tag, the proteins were purified further by gel filtration. We estimated the purity of IVa2(wt) and IVa2(1-439) to be greater than 96% and 90%, respectively, based on densitometry following Coomassie Blue staining of SDS-PAGE gels (Fig.1A). A contaminating band could be detected that migrated slightly faster than each IVa2 protein. Previous mass spectrometry analysis of IVa2(wt) had revealed that this contaminant is a form of IVa2 that lacks a portion of the N terminus. The presence of this contaminant does not affect the DNA binding properties of the IVa2 protein (Ewing et al., 2007; Tyler et al., 2007).
Figure 1
Figure 1
Purification and characterization of IVa2 proteins
The chromatographic profiles of the two proteins during gel filtration were identical, suggesting that the C-terminal deletion does not affect the tertiary structure of IVa2(1-439) (Fig.1B). We also used limited protease digestion with chymotrypsin and trypsin to compare the tertiary structure of the two proteins. The major digestion fragments of both proteins with these proteases were the same (Fig.1C). Taken together, the gel filtration and protease digestion analyses indicate that the overall structure of the IVa2 protein was not affected by deletion of the ten C-terminal residues.
The IVa2 C-terminus is required for DNA binding but not for L1 52/55 kDa protein binding
To determine whether the putative DNA binding motif was involved in interactions with the Ad5 packaging sequence, the IVa2(wt) and IVa2(1-439) purified proteins were used in EMSAs with a probe encompassing the full length packaging sequence. While the IVa2(wt) protein formed a series of complexes as previously described (Tyler et al., 2007), the IVa2(1-439) protein exhibited a complete loss of DNA binding with the exception of a single faint complex formed at the highest concentrations tested, indicating that the ten C-terminal amino acids of IVa2 are required for efficient binding to the packaging sequence (Fig.2A). We also examined whether the ability of IVa2 to bind L1 52/55 kDa is retained by IVa2(1-439), using a GST-L1 52/55 kDa fusion protein in an in vitro pull down assay (Gustin et al., 1996). Both IVa2(wt) and IVa2(1-439) proteins bound L1 52/55 kDa (Fig.2B). Therefore the deletion of the ten C-terminal amino acids from the IVa2 protein specifically affected its DNA binding ability and did not prevent its interaction with a known protein partner, L1 52/55 kDa.
Figure 2
Figure 2
The IVa2 C-terminus is required for DNA binding but not L1 52/55 kDa binding
DNA binding-defective IVa2 cannot complement a IVa2 null genome
To determine if the inability of the IVa2(1-439) protein to bind the packaging sequence compromised its ability to function in virus assembly, a complementation assay for the production of infectious virions was performed with a HAd5 genomic plasmid that does not express IVa2, pTG3602ΔIVa2 (Zhang and Imperiale, 2003). Cells were co-transfected with the mutant genome and a vector expressing either the wild type or mutant IVa2 cDNA. Lysates were harvested at various times and assayed for the presence of viable virus (Fig. 3). While the IVa2(wt) protein was able to complement the mutant genome, the C-terminal mutant was not. Moreover, the IVa2(1-439) mutant did not interfere with the ability of the IVa2(wt) protein to complement. Similarly, the mutant did not interfere with wild type protein DNA binding (data not shown). IVa2 has been reported to be a transcriptional activator of the MLP in transfection assays (Lutz and Kedinger, 1996), although in the context of the viral genome loss of IVa2 expression has only minimal effects on late gene expression (Ostapchuk et al., 2011; Zhang and Imperiale, 2003). We therefore wished to determine whether mutating the DNA binding function resulted in an inability to produce viral structural proteins, thereby explaining the absence of progeny virions. Protein lysates were prepared from the co-transfected cells and assayed for viral protein expression by immunoblotting. Both IVa2(wt) and IVa2(1-439) proteins were expressed at equivalent levels, and late proteins were also produced at comparable levels during the first round of viral replication (i.e. until day 3; Fig.4). The increase in late proteins after day 3 in the presence of IVa2(wt) was likely due to a second round of replication, since the wt protein allows production of viable virus. Taken together, the data show that IVa2(1-439) was not able to complement a IVa2 null genome and form infectious virions.
Figure 3
Figure 3
IVa2(1-439) does not complement a IVa2 null genome
Figure 4
Figure 4
IVa2(1-439) activates the major late promoter
Finally, we determined whether the IVa2(1-439) mutant supported the production of empty capsids. While it has been shown that IVa2 is not required for capsid assembly (Ostapchuk et al., 2011), IVa2 is a component of empty capsids (Gustin and Imperiale, 1998) and we wished to confirm that ablating DNA binding by IVa2 did not interfere with the assembly process. We isolated viral particles from cells co-transfected as described above, or from cells that were infected with the IVa2-null pm8002 virus followed by transfection with each of the IVa2 expression vectors, using Adeno-X mini purification columns. We first validated the behavior of the columns by running CsCl-banded wild type HAd5 through the protocol. The results (Fig. 5A) demonstrated that mature virions, as indicated by the presence of the core protein pV, bind to these columns while empty capsids, indicated by the presence of the L1 52/55 kDa protein, fractionate in the washes. While particles that could bind to the column were recovered from the co-transfection with IVa2(wt), complementation with IVa2(1-439) only yielded empty capsids (Figure 5B) that did not bind the column.
Figure 5
Figure 5
IVa2(1-439) supports production of empty capsids
The experiments described here were undertaken to define the DNA binding domain of the adenovirus IVa2 protein, a key component of the viral genome encapsidation mechanism. While IVa2 was first described as a transcriptional activator of the MLP (Lutz and Kedinger, 1996; Tribouley et al., 1994) and as a minor component of the viral core (Goding and Russell, 1983; Winter and D'Halluin, 1991), more recent results from the Hearing and our labs have provided evidence that it has a critical role in viral genome encapsidation (Ostapchuk et al., 2011; Zhang and Imperiale, 2003). From an examination of the predicted structural motifs of the protein and from a previous report in which the effects of various IVa2 deletions on its ability to bind the DE1 and DE2 elements were examined (Lutz and Kedinger, 1996), we predicted that a putative helix-turn-helix motif at the C-terminus is required for DNA binding. We produced a mutant protein lacking the ten most C-terminal amino acids and demonstrated that its biophysical properties were indistinguishable from those of the wild type protein. Similar protein levels were also seen following transfection of expression vectors into 293 cells. Thus, the ten amino acid deletion did not affect the overall structure and expression of IVa2. EMSA analysis with a packaging sequence DNA probe confirmed that the DNA binding motif was disrupted by deletion of these ten amino acids. At concentrations at which IVa2(wt) formed a single complex with the probe, IVa2(1-439) formed none; only at a thousand-fold higher concentrations, at which IVa2(wt) forms multiple specific complexes on this probe (Tyler et al., 2007), was even a faint, single complex seen with IVa2(1-439).
While it is formally possible that the lack of DNA binding observed with IVa2(1-439) was due to the presence of inhibitory contaminants from the purification, concentrations up to at least 100 nM IVa2(1-439) have no effect on the binding of IVa2(wt) to the packaging sequence (data not shown). This result also implies that the multiple complexes observed on the packaging sequence probe as the concentration of IVa2(wt) increases depend upon interactions of the protein directly with the DNA, and not upon protein-protein interactions. It has also been reported that the C-terminus of IVa2 contains a nuclear localization sequence (Lutz et al., 1996); however, this maps to residues 432-437, which are retained in our mutant.
Having identified a DNA binding mutant of IVa2, we examined the consequences of the loss of DNA binding on IVa2 binding to a known protein partner, L1 52/55 kDa, which also has a role in genome packaging (21, 26). Like IVa2, L1 52/55 kDa is found in assembly intermediates, but unlike IVa2, it is not found in mature virions (Hasson et al., 1992). In contrast to the absence of DNA binding, the IVa2(1-439) protein bound L1 52/55 kDa, suggesting that this interaction is separable from the interaction with the genome. This result confirms that the ten amino acid deletion does not disrupt the overall structure of the IVa2 protein.
We conducted experiments to determine how abrogation of DNA binding affects the viral life cycle. Mutating the C-terminal DNA binding domain did not significantly affect late protein expression. While the MLP contains two binding sites for IVa2-containing complexes, DE1 and DE2, and can be activated by IVa2 in transfection assays (Tribouley et al., 1994), viruses that cannot express IVa2 or in which both the DE1 and DE2 sites on the MLP have been mutated show only a subtle decrease in late protein expression (Ostapchuk et al., 2011; Pardo-Mateos and Young, 2004b; Zhang and Imperiale, 2003). We therefore conclude that the major role for IVa2 in the viral life cycle is during assembly. Whereas IVa2(wt) was able to complement a mutant genome and produce infectious virions, IVa2(1-439) was not.
Our recent demonstration that IVa2 is found at a single vertex (Christensen et al., 2008) led us to envisage a potential model for the role of IVa2 in adenovirus assembly in which IVa2 forms a structure at the unique vertex, alone or in concert with other viral proteins. This complex then associates with the viral genome through the A repeats of the packaging sequence and facilitates encapsidation of the DNA. This allows a role for IVa2 that is consistent with earlier studies that suggested the viral genome is inserted into a preformed empty capsid (Everitt et al., 1973; Sundquist et al., 1973; Tibbetts, 1977). If IVa2 and other viral proteins form a complex at a unique vertex, it is possible they associate with a portal structure. Such portals are used by a number of other viruses with dsDNA genomes, including HSV and several bacteriophages including PRD1, which has a number of remarkable structural similarities to adenovirus (Abrescia et al., 2004; Gowen et al., 2003; Newcomb et al., 2001; Wills et al., 2006). The portals studied so far are all dodecamers (Catalano, 2005); we have determined that there are approximately six copies of IVa2 per mature virion (Christensen et al., 2008), making it unlikely that IVa2 is itself the portal.
IVa2 almost certainly does not act alone during assembly. One candidate for a protein partner is L4 22K/33K. We have shown that while L4 22K cannot by itself bind packaging sequence DNA, it can form complexes on the DNA in the presence of IVa2 (Ewing et al., 2007); these same complexes are also present in infected cells (Ewing et al., 2007; Ostapchuk et al., 2006). It is also apparent that the presence of L4 22K enhances the binding of IVa2 to the packaging sequence (Ewing et al., 2007), and there is recent evidence from the study of an L4 22K null virus that IVa2 is stabilized by L4 22K (Morris and Leppard, 2009). It is interesting to note that the L4 22K null virus has a similar phenotype to a IVa2 null virus, i.e. it has normal viral gene expression and DNA replication, but it is unable to produce infectious particles (Ostapchuk et al., 2006). It is not known whether any empty particles are produced by this mutant virus.
It also remains to be elucidated what the exact role of L1 52/55 kDa is in adenovirus capsid assembly and genome encapsidation. An L1 52/55 kDa null virus is only able to produce empty capsids (Gustin and Imperiale, 1998) and a temperature sensitive L1 52/55 kDa mutant virus packages only a short segment of DNA, ~1,000 bp of the left end of the genome, at the restrictive temperature (Hasson et al., 1989). Both our lab and the Hearing lab have shown that L1 52/55 kDa can interact with the packaging sequence (40, 43), although L1 52/55 kDa protein has not been shown to bind to DNA directly in the absence of IVa2 (Ostapchuk et al., 2005; Perez-Romero et al., 2005), which does bind DNA directly. These data suggest L1 52/55 kDa has multiple roles in the encapsidation of the adenoviral genome. There must be a role at the initiation of packaging, because without L1 52/55 kDa no DNA is packaged. The results with the temperature sensitive L1 52/55 kDa virus suggest that L1 52/55 kDa has a second function in the completion of encapsidation, as virions with only short portions of the left end of the genome are detected. These two roles may reflect the two types of L1 52/55 kDa-containing complexes: one with DNA and one with IVa2.
If the unique IVa2-containing vertex identified on the adenovirus capsid represents the site on the virion where the viral genome is recognized and translocated into the capsid, then there should be proteins present at that vertex that provide energy for translocation. The packaging motors associated with the portals of the tailed bacteriophages T4, λ and ϕ29 are ATPases (Benson et al., 1999; Guo et al., 1986; Guo et al., 1987; Karhu et al., 2007; Rao and Mitchell, 2001; Yang et al., 1999; Yang et al., 1997). While a portal structure has not been defined for tailless icosahedral phage PRD1, it does contain a unique vertex (Stromsten et al., 2003). One of the proteins associated with the unique vertex is P9, a putative ATPase. IVa2 is a compelling candidate to possess ATPase activity because it contains Walker A and Walker B motifs, characteristic of ATPases in the ABC and AAA+ families (Aravind et al., 1999; Burroughs et al., 2007). These motifs are absolutely conserved in all adenoviruses whose sequences have been determined, although other parts of the protein are not. While there is not yet evidence of biochemical ATPase activity, IVa2 has been shown to bind ATP with low affinity (Ostapchuk and Hearing, 2008), and mutating a lysine residue in the Walker A motif that is predicted to be involved in ATP binding is lethal to the virus (Ostapchuk et al., 2011; Pardo-Mateos and Young, 2004a). Taken together, the data presented provide promising directions for further biochemical analysis of the adenovirus IVa2 protein and its partners with the goal of elucidating the mechanisms used for genome packaging in icosahedral eukaryotic viruses.
Plasmids and bacteria
The ORF (open reading frame) encoding amino acids 1-439 of the 449 residue IVa2 protein was amplified from pBK-IVa2 (Zhang and Imperiale, 2003) by PCR using the 5’ primer catgccatggaaaccagagggcgaagaccggca containing a NcoI site (underlined) and the 3’ primer cgctcgagggaccagcggtctcggtcgttg containing a XhoI site. The product was cloned into pTYB4 (New England Biolabs [NEB]) using NcoI and XhoI, yielding pTYB4-IVa2-1-439. pTYB4-IVa2, containing the full length IVa2 ORF inserted at the same restriction sites, was described previously (Tyler et al., 2007). pTG3602ΔIVa2 is a genomic clone of the pm8002 mutant viral genome that does not express IVa2 (Zhang and Imperiale, 2003). For mammalian expression, the wt and 1-439 ORFs were amplified from pBK-IVa2 using the 5’ primer cgacgcgtatggaaaccagagggcgaagaccggca containing an Mlu1 site and 3’ primers ataagaatgcggccgcttatttaggggttttgcgcgcgcggt and ataagaatgcggccgctttaggaccagcggtctcggtcgttg containing the NotI site, respectively. These were inserted into the corresponding sites in pCI-trip (Perez-Romero et al., 2005) to produce pCI-trip-IVa2(wt) and pCI-trip-IVa2(1-439). The integrity of the inserts for each plasmid was confirmed by DNA sequencing. E. coli strains TOP10 (Invitrogen) and BL21-Codon-Plus RIL (Stratagene) were used for cloning and recombinant protein expression, respectively.
Cells and viruses
Low passage 293 cells, HeLa cells, and N52-Cre-IVa2 cells (gift of Pat Hearing, Stony Brook University) were maintained in Dulbecco's modified Eagle's medium (DMEM) with 10% fetal bovine serum (FBS), 100 U/ml penicillin and 100 μg/ml streptomycin, and were grown at 37°C in a 5% CO2 environment in a humidified incubator. Wild-type HAd5 (American Type Culture Collection) was propagated on either HeLa or 293 cells and purified by CsCl gradient centrifugation (Graham and Prevec, 1991; Gustin and Imperiale, 1998). The IVa2 null virus, pm8002, was prepared by transfection of N52-Cre-IVa2 cells with pTG3602ΔIVa2.
EMSA
The electrophoretic mobility shift assay (EMSA) was performed as described (Ewing et al., 2007).
Western blotting
Whole cell extracts were prepared from cells using E1A lysis buffer (Harris et al., 1996). Proteins in these extracts and from pull down assays were analyzed by electrophoresis on 8% SDS-polyacrylamide gels followed by Western blotting. Proteins were transferred to nitrocellulose on a Bio-Rad semidry transfer apparatus as previously described (Christensen et al., 2008). Primary antibodies used were rabbit anti-HAd5 capsid (Abcam), goat anti-IVa2 (Perez-Romero et al., 2005), mouse anti-GAPDH (Abcam), mouse anti-adenovirus protein V (gift of Jane Flint), and rabbit anti-L1 52/55 kDa (Gustin and Imperiale, 1998). Horseradish peroxidase-conjugated secondary antibodies used were donkey anti-rabbit IgG, sheep anti-mouse IgG (GE Healthcare), or donkey anti-goat IgG (Santa Cruz).
Protein expression, purification, and structural characterization
The IVa2(wt) and IVa2(1-439) proteins were expressed using the IMPACT-CN E. coli expression system (NEB) and purified as previously described (Ewing et al., 2007; Tyler et al., 2007). The elution times of IVa2(wt) and IVa2(1-439) were compared to continuous absorbance readings at 280 nM of runs with Bio-Rad standards to estimate the globular size of each protein. For limited proteolytic digestion, 5 μg IVa2 were digested in a 20 μl reaction at 4°C with either 0.1μg trypsin in 100 mM Tris-HCl, pH 8.5, or 0.25 μg chymotrypsin in 10 mM CaCl2-100 mM Tris-HCl, pH 7.8. Digestion was stopped at the indicated time points by addition of PMSF to 160 μg/mL and 10 μl of 3X SDS sample buffer (175 mM Tris/HCl, pH 6.8, 300 mM DTT, 5% SDS, 15% glycerol). The reactions were immediately incubated for 5 minutes at 100°C, cooled on ice and analyzed by 12% SDS-PAGE and silver staining with a Bio-Rad kit.
One step growth curves
293 cells were plated in twelve-well tissue culture plates and transfected at 70% confluence with 1 μg/well PacI-digested pTG3602ΔIVa2 plus 0.1 μg of either pCI-trip-IVa2(wt) or pCI-trip-IVa2(1-439) using Effectene according to the manufacturer's instructions (Qiagen). The contents of the wells were harvested for the infectivity assay by scraping cells and media into centrifuge tubes and then pelleting the cells at 2500 × g for 10 minutes. The cells were resuspended in 150 μl of DMEM with 2% FBS and freeze-thawed three times. The viral titer of the freeze-thaw lysates was determined by a fluorescent focus assay (Zhang and Imperiale, 2003). Capsid protein production was determined by Western blotting of whole cell extracts from duplicate wells.
Protein Binding Assays
Expression of GST and GST-L1 fusion proteins and in vitro binding assays were performed essentially as previously described (Gustin et al., 1996; Perez-Romero et al., 2006). Aliquots of clarified bacterial lysates were analyzed by SDS-PAGE and Coomassie brilliant blue staining. Lysates containing equivalent amounts of GST or GST-L1 were incubated for 30 minutes at room temperature with glutathione Sepharose CL-4B beads (GE Healthcare) equilibrated in ABC buffer (50 mM Tris HCl, pH 7.5, 50 mM NaCl, 5 mM MgCl2, 0.1% β-mercaptoethanol, 0.1 mM EDTA). Bound proteins were washed three times with ABC buffer before addition of 293 cell lysates. To prepare lysates, 293 cells in 10 cm dishes were transfected with 10 μg of either pCI-trip-IVa2(wt) or pCI-trip-IVa2(1-439) using Effectene. Twenty four hours post-transfection, the cells were infected with 0.1 ml per plate of a passage 2 (P2) viral lysate of pm8002. Four days post-infection, whole cell extracts were prepared as described above. As a positive control, extracts were prepared 48 hours after infecting 293 cells with HAd5 at an MOI of 5 plaque forming units/cell. One milligram of the transfected lysates or 100 μg of the infected cell lysate were incubated with the immobilized GST or GST-L1 protein for 2 hours at 4°C. The beads were washed three times with ABC buffer and proteins were released in SDS sample buffer and analyzed by SDS-PAGE followed by Western blotting.
Analysis of Viral Particles
The formation of viral particles was examined in 293 cells from 10 cm dishes, co-transfected as above with 10 μg pTG3602ΔIVa2 plus 1 μg either pCI-trip-IVa2(wt) or pCI-trip-IVa2 (1-439). Six days post-transfection freeze-thawed lysates were prepared and processed using Adeno-X mini purification columns according to the manufacturer's instructions (Clontech). The columns were characterized using mature and empty wild-type HAd5 particles purified by CsCl density sedimentation (Gustin and Imperiale, 1998). Aliquots of fractions from the columns were analyzed by SDS-PAGE and Western blotting for viral proteins and by transmission electron microscopy (TEM) for the presence of particles. For TEM, 20 μl samples diluted 1:5 in 10 mM Tris HCl, pH 7.5, 250 mM NaCl, 0.5 mM EDTA (0.5X TNE) were applied to glow discharged 300 mesh carbon coated copper electron microscopy grids (Electron Microscopy Science). Unabsorbed material was washed off with 0.5X TNE, then the grids were fixed with 2.5% glutaraldehyde in 0.1M Sorensen's buffer, pH 7.4, and negatively stained with 1% uranyl acetate (Christensen et al., 2008). Dried grids were examined on a Phillips CM 100 electron microscope in the Microscopy and Image Analysis Laboratory at the University of Michigan, and images were captured with a high resolution (2K pixels X 2K pixels) digital camera driven by AMT software.
ACKNOWLEDGMENTS
We thank members of the Imperiale lab for help with this work; Pat Hearing for useful discussion, suggestions, and cells; Kathy Spindler, Jason Weinberg and Mengxi Jiang for critical reading of the manuscript; Jane Flint for antisera; and the Microscopy and Image Analysis Laboratory at the University of Michigan for help with the TEM.
This work was supported by NIH grant AI052150 to M.J.I. and in part by NIH grant CA46592 to the University of Michigan Cancer Center.
Footnotes
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
  • Abrescia NG, Cockburn JJ, Grimes JM, Sutton GC, Diprose JM, Butcher SJ, Fuller SD, San Martin C, Burnett RM, Stuart DI, Bamford DH, Bamford JK. Insights into assembly from structural analysis of bacteriophage PRD1. Nature. 2004;432:68–74. [PubMed]
  • Ali H, LeRoy G, Bridge G, Flint SJ. The adenovirus L4 33-kilodalton protein binds to intragenic sequences of the major late promoter required for late phase-specific stimulation of transcription. J Virol. 2007;81:1327–1338. [PMC free article] [PubMed]
  • Aravind L, Walker DR, Koonin EV. Conserved domains in DNA repair proteins and evolution of repair systems. Nucleic Acids Res. 1999;27:1223–1242. [PMC free article] [PubMed]
  • Benson SD, Bamford JK, Bamford DH, Burnett RM. Viral evolution revealed by bacteriophage PRD1 and human adenovirus coat protein structures. Cell. 1999;98:825–833. [PubMed]
  • Burroughs AM, Iyer LM, Aravind L. Comparative genomics and evolutionary trajectories of viral ATP dependent DNA-packaging systems. Genome Dyn. 2007;3:48–65. [PubMed]
  • Catalano CE. Viral Genome Packaging Machines: Genetics, Structure, and Mechanism. Kluwer Academic/Plenum; New York: 2005.
  • Christensen JB, Byrd SA, Walker AK, Strahler JR, Andrews PC, Imperiale MJ. Presence of the adenovirus IVa2 protein at a single vertex of the mature virion. J Virol. 2008;82:9086–9093. [PMC free article] [PubMed]
  • D'Halluin JC, Milleville M, Boulanger P. Effects of novobiocin on adenovirus DNA synthesis and encapsidation. Nucleic Acids Res. 1980;8:1625–1641. [PMC free article] [PubMed]
  • D'Halluin JC, Milleville M, Boulanger PA, Martin GR. Temperature-sensitive mutant of adenovirus type 2 blocked in virion assembly: accumulation of light intermediate particles. J Virol. 1978;26:344–356. [PMC free article] [PubMed]
  • Edvardsson B, Everitt E, Jornvall H, Prage L, Philipson L. Intermediates in adenovirus assembly. J Virol. 1976;19:533–547. [PMC free article] [PubMed]
  • Everitt E, Sundquist B, Pettersson U, Philipson L. Structural proteins of adenoviruses. X. Isolation and topography of low molecular weight antigens from the virion of adenovirus type 2. Virology. 1973;52:130–147. [PubMed]
  • Ewing SG, Byrd SA, Christensen JB, Tyler RE, Imperiale MJ. Ternary complex formation on the adenovirus packaging sequence by the IVa2 and L4 22-kilodalton proteins. J Virol. 2007;81:12450–12457. [PMC free article] [PubMed]
  • Goding CR, Russell WC. Adenovirus cores can function as templates in in vitro DNA replication. EMBO J. 1983;2:339–344. [PubMed]
  • Gowen B, Bamford JK, Bamford DH, Fuller SD. The tailless icosahedral membrane virus PRD1 localizes the proteins involved in genome packaging and injection at a unique vertex. J Virol. 2003;77:7863–7871. [PMC free article] [PubMed]
  • Grable M, Hearing P. Adenovirus type 5 packaging domain is composed of a repeated element that is functionally redundant. J Virol. 1990;64:2047–2056. [PMC free article] [PubMed]
  • Grable M, Hearing P. cis and trans requirements for the selective packaging of adenovirus type 5 DNA. J Virol. 1992;66:723–731. [PMC free article] [PubMed]
  • Graham FL, Prevec L. Manipulation of adenovirus vectors. Methods Mol.Biol. 1991;7:109–128. [PubMed]
  • Guo P, Grimes S, Anderson D. A defined system for in vitro packaging of DNA-gp3 of the Bacillus subtilis bacteriophage phi 29. Proc Natl Acad Sci U S A. 1986;83:3505–3509. [PubMed]
  • Guo P, Peterson C, Anderson D. Prohead and DNA-gp3-dependent ATPase activity of the DNA packaging protein gp16 of bacteriophage phi 29. J Mol Biol. 1987;197:229–236. [PubMed]
  • Gustin KE, Imperiale MJ. Encapsidation of viral DNA requires the adenovirus L1 52/55-kilodalton protein. J Virol. 1998;72:7860–7870. [PMC free article] [PubMed]
  • Gustin KE, Lutz P, Imperiale MJ. Interaction of the adenovirus L1 52/55-kilodalton protein with the IVa2 gene product during infection. J Virol. 1996;70:6463–6467. [PMC free article] [PubMed]
  • Hammarskjold ML, Winberg G. Encapsidation of adenovirus 16 DNA is directed by a small DNA sequence at the left end of the genome. Cell. 1980;20:787–795. [PubMed]
  • Harris KF, Christensen JB, Imperiale MJ. BK virus large T antigen: interactions with the retinoblastoma family of tumor suppressor proteins and effects on cellular growth control. J Virol. 1996;70:2378–2386. [PMC free article] [PubMed]
  • Hasson TB, Ornelles DA, Shenk T. Adenovirus L1 52- and 55-kilodalton proteins are present within assembling virions and colocalize with nuclear structures distinct from replication centers. J Virol. 1992;66:6133–6142. [PMC free article] [PubMed]
  • Hasson TB, Soloway PD, Ornelles DA, Doerfler W, Shenk T. Adenovirus L1 52-and 55-kilodalton proteins are required for assembly of virions. J Virol. 1989;63:3612–3621. [PMC free article] [PubMed]
  • Hearing P, Samulski RJ, Wishart WL, Shenk T. Identification of a repeated sequence element required for efficient encapsidation of the adenovirus type 5 chromosome. J Virol. 1987;61:2555–2558. [PMC free article] [PubMed]
  • Karhu NJ, Ziedaite G, Bamford DH, Bamford JK. Efficient DNA packaging of bacteriophage PRD1 requires the unique vertex protein P6. J Virol. 2007;81:2970–2979. [PMC free article] [PubMed]
  • Lutz P, Kedinger C. Properties of the adenovirus IVa2 gene product, an effector of late-phase-dependent activation of the major late promoter. J Virol. 1996;70:1396–1405. [PMC free article] [PubMed]
  • Lutz P, Puvion-Dutilleul F, Lutz Y, Kedinger C. Nucleoplasmic and nucleolar distribution of the adenovirus IVa2 gene product. J Virol. 1996;70:3449–3460. [PMC free article] [PubMed]
  • Morris SJ, Leppard KN. Adenovirus serotype 5 L4-22K and L4-33K proteins have distinct functions in regulating late gene expression. J Virol. 2009;83:3049–3058. [PMC free article] [PubMed]
  • Newcomb WW, Juhas RM, Thomsen DR, Homa FL, Burch AD, Weller SK, Brown JC. The UL6 gene product forms the portal for entry of DNA into the herpes simplex virus capsid. J Virol. 2001;75:10923–10932. [PMC free article] [PubMed]
  • Ostapchuk P, Almond M, Hearing P. Characterization of empty adenovirus particles assembled in the absence of a functional adenovirus IVa2 protein. Journal of virology. 2011;85:5524–5531. [PMC free article] [PubMed]
  • Ostapchuk P, Anderson ME, Chandrasekhar S, Hearing P. The L4 22-kilodalton protein plays a role in packaging of the adenovirus genome. J Virol. 2006;80:6973–6981. [PMC free article] [PubMed]
  • Ostapchuk P, Hearing P. Control of adenovirus packaging. J Cell Biochem. 2005;96:25–35. [PubMed]
  • Ostapchuk P, Hearing P. Adenovirus IVa2 protein binds ATP. J Virol. 2008;82:10290–10294. [PMC free article] [PubMed]
  • Ostapchuk P, Yang J, Auffarth E, Hearing P. Functional interaction of the adenovirus IVa2 protein with adenovirus type 5 packaging sequences. J Virol. 2005;79:2831–2838. [PMC free article] [PubMed]
  • Pardo-Mateos A, Young CS. A 40 kDa isoform of the type 5 adenovirus IVa2 protein is sufficient for virus viability. Virology. 2004a;324:151–164. [PubMed]
  • Pardo-Mateos A, Young CS. Adenovirus IVa2 protein plays an important role in transcription from the major late promoter in vivo. Virology. 2004b;327:50–59. [PubMed]
  • Perez-Romero P, Gustin KE, Imperiale MJ. Dependence of the encapsidation function of the adenovirus L1 52/55-kilodalton protein on its ability to bind the packaging sequence. J Virol. 2006;80:1965–1971. [PMC free article] [PubMed]
  • Perez-Romero P, Tyler RE, Abend JR, Dus M, Imperiale MJ. Analysis of the interaction of the adenovirus L1 52/55-kilodalton and IVa2 proteins with the packaging sequence in vivo and in vitro. J Virol. 2005;79:2366–2374. [PMC free article] [PubMed]
  • Rao VB, Mitchell MS. The N-terminal ATPase site in the large terminase protein gp17 is critically required for DNA packaging in bacteriophage T4. J Mol Biol. 2001;314:401–411. [PubMed]
  • Schmid SI, Hearing P. Bipartite structure and functional independence of adenovirus type 5 packaging elements. J Virol. 1997;71:3375–3384. [PMC free article] [PubMed]
  • Stromsten NJ, Bamford DH, Bamford JK. The unique vertex of bacterial virus PRD1 is connected to the viral internal membrane. J Virol. 2003;77:6314–6321. [PMC free article] [PubMed]
  • Sundquist B, Everitt E, Philipson L, Hoglund S. Assembly of adenoviruses. J Virol. 1973;11:449–459. [PMC free article] [PubMed]
  • Tibbetts C. Viral DNA sequences from incomplete particles of human adenovirus type 7. Cell. 1977;12:243–249. [PubMed]
  • Tribouley C, Lutz P, Staub A, Kedinger C. The product of the adenovirus intermediate gene IVa2 is a transcriptional activator of the major late promoter. J Virol. 1994;68:4450–4457. [PMC free article] [PubMed]
  • Tyler RE, Ewing SG, Imperiale MJ. Formation of a multiple protein complex on the adenovirus packaging sequence by the IVa2 protein. J Virol. 2007;81:3447–3454. [PMC free article] [PubMed]
  • Wills E, Scholtes L, Baines JD. Herpes simplex virus 1 DNA packaging proteins encoded by UL6, UL15, UL17, UL28, and UL33 are located on the external surface of the viral capsid. J Virol. 2006;80:10894–10899. [PMC free article] [PubMed]
  • Winter N, D'Halluin JC. Regulation of the biosynthesis of subgroup C adenovirus protein IVa2. J Virol. 1991;65:5250–5259. [PMC free article] [PubMed]
  • Yang Q, de Beer T, Woods L, Meyer JD, Manning MC, Overduin M, Catalano CE. Cloning, expression, and characterization of a DNA binding domain of gpNu1, a phage lambda DNA packaging protein. Biochemistry. 1999;38:465–477. [PubMed]
  • Yang Q, Hanagan A, Catalano CE. Assembly of a nucleoprotein complex required for DNA packaging by bacteriophage lambda. Biochemistry. 1997;36:2744–2752. [PubMed]
  • Zhang W, Imperiale MJ. Interaction of the adenovirus IVa2 protein with viral packaging sequences. J Virol. 2000;74:2687–2693. [PMC free article] [PubMed]
  • Zhang W, Imperiale MJ. Requirement of the adenovirus IVa2 protein for virus assembly. J Virol. 2003;77:3586–3594. [PMC free article] [PubMed]