PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Bone. Author manuscript; available in PMC 2013 April 1.
Published in final edited form as:
PMCID: PMC3439807
NIHMSID: NIHMS349379

The ubiquitin E3 ligase WWP1 decreases CXCL12-mediated MDA231 breast cancer cell migration and bone metastasis[star]

Abstract

Advanced breast cancers preferentially metastasize to bone where cells in the bone microenvironment produce factors that enhance breast cancer cell homing and growth. Expression of the ubiquitin E3 ligase WWP1 is increased in some breast cancers, but its role in bone metastasis has not been investigated. Here, we studied the effects of WWP1 and itch, its closest family member, on breast cancer bone metastasis. First, we immunostained a multi-tumor tissue microarray and a breast cancer tissue microarray and demonstrated that WWP1 and ITCH are expressed in some of breast cancer cases. We then knocked down WWP1 or itch in MDA-MB-231 breast cancer cells using shRNA and inoculated these cells and control cells into the left ventricle of athymic nude mice. Radiographs showed that mice given shWWP1 cells had more osteolytic lesions than mice given control MDA-MB-231 cells. Histologic analysis confirmed osteolysis and showed significantly increased tumor area in bone marrow of the mice. WWP1 knockdown did not affect cell growth, survival or osteoclastogenic potential, but markedly increased cell migration toward a CXCL12 gradient in vitro. Furthermore, WWP1 knockdown significantly reduced CXCL12-induced CXCR4 lysosomal trafficking and degradation. In contrast, itch knockdown had no effect on MDA-MB-231 cell bone metastasis. Taken together, these findings demonstrate that WWP1 negatively regulates cell migration to CXCL12 by limiting CXCR4 degradation to promote breast cancer metastasis to bone and highlight the potential utility of WWP1 as a prognostic indicator for breast cancer bone metastasis.

Keywords: WWP1, Breast cancer, Bone metastasis, CXCR4, Degradation

Introduction

The ubiquitin/proteasome system is involved in the regulation of a variety of normal cellular functions and pathologic processes, including carcinogenesis (1). Protein ubiquitination is carried out sequentially by three enzymes: ubiquitin activating enzyme (E1), ubiquitin-conjugase (E2), and ubiquitin ligase (E3). The E3 ligase is of particular importance because it typically comes in direct contact with protein substrates thereby playing a crucial role in defining substrate specificity. E3 ubiquitin ligases are classified into two main categories based on their ubiquitin transfer mechanisms. RING and U-box E3 ubiquitin ligases act as scaffolding proteins that indirectly facilitate the transfer of ubiquitin by bringing E2 and substrate proteins into close proximity. Conversely, HECT domain E3 ligases transfer ubiquitin directly to substrate proteins by acting as catalytic intermediates through a strictly conserved cysteine residue [1,2].

The Nedd4 sub-family of HECT domain E3 ligases shares a characteristic modular design, with an amino-terminal C2 domain, 2–4 WW domains and a catalytic HECT domain. The WW domains recognize proline-rich PY motifs, such as PPXY or PPLP, as well as phosphorylated serines and threonines [1,3]. The Nedd4 E3 ligases have nine members in humans, including Nedd4L, Nedd4, Smurf1, Smurf2, HecW1 (NedL1), HecW2 (NedL2), WWP1 (Tiul1), WWP2, and ITCH (Aip4) [49]. Some family members, such as Nedd4, Smurf1, Smurf2 and WWP1, are implicated in tumorgenesis through multiple mechanisms. For example, they are involved in degradation of a number of tumor suppressor molecules, and some of them have genetic aberrations or altered expression patterns in human cancers. However, their role in bone metastasis, a very common complication of breast and prostate cancers, has not been well investigated. One study has reported increased bone metastasis of breast cancer cells with Smurf2 deletion, but the mechanism mediating this effect is not known [10].

Among the members of the Nedd4 E3 ligase family, WWP1 seems most likely to be linked to breast cancer. The wwp1 gene is located at the q21 band of chromosome 8, a region frequently amplified in human prostate and breast cancer [11]. Manipulation of WWP1 protein levels in various breast cancer cell lines has only a small effect on cell proliferation and colony formation [12]. WWP1 regulates the protein stability of several important cancer-related factors such as epidermal growth factor receptor [13] and human epidermal growth factor receptor 4 (HER4) protein expression levels [14]. Two clinical studies investigated the association between WWP1 expression and clinical parameters of cancer using excised breast cancer specimens. One study reported that WWP1 immunoreactivity was observed in 76/187 (41%) tumors and correlated positively with estrogen receptor (ER) alpha and insulin-like growth factor 1 expression [15]. Another study reported that 80% of 419 breast cancer cases stained positively for WWP1, but found no significant association between WWP1 expression and ER status, tumor grade, tumor size, age, lymph node or HER2 status [16]. Surprisingly, a group with low/absent WWP1 expression had a consistently worse prognosis than patients with WWP1-expressing tumors. Importantly, the association with disease-free survival was independent of the status of other commonly used prognostic indicators [16]. This clinical observation argues that WWP1 itself may function as a negative regular of breast cancer and raises an important question regarding its role in breast cancer in vivo.

In this study, we investigated the effect of WWP1 and ITCH, its closest Nedd4 family member, on bone metastasis in a murine model of metastatic breast cancer. We found that in MDA-MB-231 breast cancer cells, WWP1, but not ITCH, is an inhibitor of bone metastasis. WWP1 knockdown significantly increased the number of osteolytic lesions and metastatic area in bones. WWP1 knockdown did not affect tumor cell growth, survival or osteoclastogenic potential or the expression levels of known WWP1 substrate proteins. Rather, it increased the expression level of CXCR4, a critical chemokine receptor for metastasis of breast and other cancers to bone [17,18]. WWP1 knockdown markedly decreased CXCL12-induced CXCR4 degradation and lysosomal trafficking. Thus, WWP1 may serve as a prognostic marker for breast cancer bone metastasis and the factors that affect WWP1 expression or activity may affect the capacity of cancer cells to metastasize to bone [16].

Materials and methods

Generation of WWP1 and itch knockdown cell lines

The human breast cancer cell line MDA-MB-231 was originally generated by Dr. Theresa Guise. These cells have high capacity to metastasize to bone after the cardiac injection and have been extensively used in bone metastasis study [19]. To knockdown WWP1, lentiviral particles containing WWP1 or control shRNA were purchased from Sigma (SHCLNV-NM-007013 for WWP1 shRNA and SHC002V for control shRNA). The sequence of WWP1 shRNA is CCGGATTGCTT ATGAACGCGGCTTTCTCGAGAAAGCC and that of control shRNA is CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTT GTTTTT. Cells were infected with WWP1 shRNA or control shRNA viral particles and selected with puromycin (1 μg/ml) according to the manufacturer’s instruction. To knockdown itch, MDA-MB-231 cells were infected with a retroviral vector (pRetro-H1G) encoding itch or control shRNA (Cellogenetics, Inc) and GFP. The sequence of itch shRNA is GGTGACAAAGAGCCAACAGAG and of control shRNA is GTTCT CCGAACGTGTCACG. GFP+ cells were sorted using FACS. Knockdown efficiency was determined by real time RT-PCR and Western blot analysis.

Real-time RT-PCR

Quantitative real-time RT-PCR was performed as described previously [20,21] using iQ SYBR Green supermix (Bio-Rad) in an iCycler (Bio-Rad) real-time PCR machine. The specificity of detected signals was confirmed by a dissociation curve consisting of a single peak. All samples were run in triplicate. Fold increases were determined by dividing the value of each sample by the value from control shRNA-infected cells and using the latter value as 1. The primer sequences for human wwp1, itch and gapdh are: wwp1, forward 5′-CAGGAGGTTGACTTGGCAGA-3′ and reverse 5′-AAACTGTGTCCAAAAGCAGTCTC-3′; itch, forward 5′-GAATCCGTCCGGAACTATGA-3′ and reverse 5′-TCTG CCATTGCTGTCTGTTC-3′; and gapdh, forward 5′-GGTCGGTGTGAACGGATTTG-3′ and reverse 5′-ATGAGCCCTTCCACAATG-3′.

Western blot analysis

Whole cell lysates were harvested and samples (40 μg protein/lane) were fractionated by SDS-PAGE and transferred to nitrocellulose membranes. Immunoblotting was carried out using antibodies to ITCH (BD Transduction Lab), WWP1 (Novus Biological), CXCR4 (Calbiochem), Smurf1 (Abcam), Runx2, JunB, KLF5 and GAPDH (Santa Cruz Biotechnology Inc). Bands were visualized using ECL chemiluminescence (Amersham) and quantitated by Scion Image Beta 4.02 (Scion Corporation, NIH).

Intracardiac bone metastasis model

All animal procedures were conducted using procedures approved by the University of Rochester Committee for Animal Resources. Female athymic nude mice (4 weeks old) were purchased from the National Cancer Institute. Mice were maintained under specific pathogen-free conditions. MDA-MB-231 cells (1×10 [5]) were suspended in 100 μl of sterile PBS and injected into the left ventricle of the heart with a 27-gauge needle under general anesthesia. Mice were monitored by X-ray radiography before and 4 weeks after cancer cell injection using a Faxitron instrument. The numbers and area of osteolytic lesions per mouse were assessed with ImagePlus (version 1.8) software.

Cell migration assay

Cells were labeled with Calcein AM (Molecular Probes) at a final concentration of 2 μg/ml, and 100 μl (10 [6] cells) cell suspensions were loaded into the upper chamber of a transwell insert (5 μm, Corning Costar). The transwell inserts were immediately moved to wells of a 24-well tissue culture dish containing different doses of CXCL12 (1, 10 or 100 ng/ml). After 3 h of incubation, the migrated cells in the bottom wells were collected, centrifuged and solubilized (in 100 μl Hank’s Buffered Salt Solution with 1% SDS/0.2 N NaOH). The calcein label was read in a 96-well FluoroNunc plate (Nalge Nunc International) and quantified in a Gemini XS microplate spectrofluorometer (Molecular Devices) at 485 nm/530 nm.

Cell proliferation and apoptosis assays

Cell proliferation was examined by MTT assay (MTT based Cell Growth Determination Kit, Sigma) according to the manufacturer’s instructions. In brief, cells were seeded at a density of 5×10 [3] cells/well in 96-well plates in triplicate. At different times (24 to 96 h), cells were incubated with 20 μl of MTT solution at 37 °C for 4 h and followed by 200 μl of MTT solvent to terminate the reaction. The plates were read at 570 nm using a benchmark microplate reader (BioRad). Cell apoptosis was assessed by an Annexin V FITC kit (BD Biosciences) according to the manufacturer’s instructions. Analysis was conducted on a FACSCalibur flow cytometer using FlowJo 7.6 software.

Osteoclast formation assay

Bone marrow cells (2×10 [5] cells/ml) from 2-month-old C57/B6 WT mice were seeded in 96-well-plates in quadruplicate and cultured with conditioned medium from a M-CSF-producing cell line (1:100 dilution) as we used previously [22] and 2 ng/mL RANKL for 2 days. Cells were then cultured with M-CSF and RANKL plus 10% conditioned medium from control shRNA- or WWP-1 shRNA-infected cells for another 5 days. Cells were fixed and stained for TRAP activity. The number of TRAP+osteoclasts per well was counted.

Immunohistochemical staining

Tissue sections were deparaffinized and rehydrated. No unmasking of antigenic determinant sites was required for WWP1 staining. ITCH staining required antigen retrieval that involved a quenching step with a 3% hydrogen peroxide solution followed by 30 min in a heated citrate buffer solution. Mouse anti-WWP1 (1:1000 to 1:2000, ABNOVA), mouse anti-ITCH (1:75, BD Transduction Lab) or rabbit anti-CXCR4 antibodies (1:200, EMD Chemicals, Inc) were incubated overnight at 4 °C. The sections were incubated with secondary antibody (biotinylated horse anti-mouse or goad anti-rabbit, 1:200 Vector) at 37 °C for 45 min and then incubated with a streptavidin enzyme conjugate. The complex was visualized using a Vectastain Elite AEC Chromogen Kit (Vector) and followed by counterstaining with Mayer’s hematoxylin. To confirm the specificity of both of the primary antibodies, negative control slides were run with every batch.

Immunofluorescence staining

Cells were cultured on chamber slides (Lab-Tek II Chamber Slide system, Naperville, IL) with PBS or CXCL12 (50 ng/ml) for 3 h at 37 °C. Cells were then fixed by 10% formalin, permeabilized by acetone and stained with rabbit anti-CXCR4 followed by Alexa Fluor-568-goat anti-rabbit secondary antibody (Invitrogen), and FITC-anti-LAMP2. The images were taken at ×100 magnification using a confocal microscope (FV1000 Olympus).

Tissue microarray (TMA)

Three TMAs that were constructed previously in the Department of Pathology, University of Rochester Medical Center were used for immunostaining WWP1 and ITCH. A multi-tumor TMA contains 34 cores of 19 different types of tumors, including breast ductal carcinoma, breast mucinous carcinoma, squamous cell carcinoma, melanoma, small cell carcinoma of lung, papillary thyroid carcinoma, conventional renal cell carcinoma, mesothelioma, ameloblastoma, Ewing’s sarcoma, seminoma, embryonal carcinoma, rhabdomyosarcoma, lung adenocarcinoma, thyroid adenoma, prostate adenocarcinoma, hepatocellular carcinoma, GIST, and colon adenocarcinoma. A breast cancer and a normal breast TMAs contain cores of triplicate samples of malignant and normal breast tissue from 126 consecutive breast cancer patients at University of Rochester Medical Center were constructed previously. Subjects had been diagnosed with infiltrating breast carcinoma and underwent primary excision between October 1999 and July 2001. The average age was 61.6 years. Histologic types were as follows: 73.6% infiltrating ductal NOS; 13.2% infiltrating lobular; 3.9% mixed infiltrating ductal and lobular; 2.3% infiltrating tubular; 1.6% infiltrating colloid; 0.85 infiltrating papillary; 6% ductal with features of special type. Prognostic markers: ER 82% positive; progesterone receptor (PR) 75% positive; ER negative, PR positive 2.5%; HER2 positive, PR negative 13.9%; and ER/PR/HER2 triple negative 12.3%. For histologic analysis, the staining for both WWP1 and ITCH was given two scores for intensity and distribution. The breast TMAs were constructed in triplicate. All three slides were stained and evaluated. The intensity of cytoplasmic staining was graded semi-quantitatively as “−” = absent; “+” =low; “++” =moderate; and “+++” =strong.

Statistics

Data are presented as means±SD. Statistical analyses were performed with Stat View statistical software. Differences between 2 groups were compared using a Student t-test and among more than 2 groups using one-way ANOVA, followed by a Bonferroni/Dunnet test. Data from TMAs were analyzed with Fisher’s exact test. p values <0.05 were considered to be statistically significant.

Results

Expression pattern of ITCH and WWP1 proteins in a multi-tumor TMA

To investigate the expression levels of ITCH and WWP1 in cancer specimens, we first performed immunohistochemistry (IHC) to stain for ITCH and WWP1 proteins in a multi-tumor TMA containing 33 cases of primary tumors from various tissue sources (Supplemental table). The strongest ITCH expression was observed in thyroid adenoma (2/2) and breast mucinous carcinoma (1/1) where it was localized mainly in the cytoplasm (Fig. 1). ITCH was moderately expressed in hepatocellular carcinoma (2/2), small cell carcinoma of lung (2/2), colon adenocarcinoma (1/2), and clear cell renal cell carcinoma (1/2). WWP1 expression overlapped with ITCH in thyroid adenoma (2/2), hepatocellular carcinoma (2/2) and small cell carcinoma (2/2), but was different in other cancers. For example, WWP1 expression was high in breast mucinous carcinoma, but low in breast ductal carcinoma compared to ITCH (Fig. 1).

Fig. 1
Expression of ITCH and WWP1 proteins in a multi-tumor TMA. Slides from a multi-tumor TMA (supplemental table 1) was stained with H&E (A, D, G), and also immunohistochemically with anti-ITCH (B, E, H) and anti-WWP1 (C, F, I) antibodies. Medium ...

Expression of WWP1 proteins in primary breast cancers

Because ITCH and WWP1 proteins were expressed in breast cancer tissues in our multi-tumor TMA, we next examined their expression in a TMA containing cores of breast cancers from 126 consecutive patients at Strong Memorial Hospital, University of Rochester Medical Center. ITCH and WWP1 staining was exclusively in the cytoplasm (Fig. 2A). Histological types and ITCH and WWP1 staining intensity were indicated in Table 1A. Statistical analysis indicated that there is a significant difference between ITCH positive staining intensity and tumor classification. It appears that more ITCH positive tumors are ductal and lobular sub-types. However, there is no difference between WWP1 positive staining intensity and tumor classification. More than half of tumors are WWP1 negative/weak staining. Tables 1B and and1C1C compared ITCH or WWP1 negative/weak and moderate/strong positive groups and to ER or PR status. More ITCH moderate/strong tumors were ER positive than ITCH negative/weak tumors (p < 0.001), while more WWP1 negative/weak tumors are ER positive (p=0.021). WWP1 and ITCH expression appears not to be associated with PR status. WWP1 and ER staining was seen predominantly in the same cells.

Fig. 2
Expression of WWP1 protein in breast cancer, but not normal breast tissue. Sections from breast cancer (A) and normal (B) breast TMAs were stained immunohistochemically with anti-ITCH (A: a, b, c; B: a) and anti-WWP1 (A: d, f, i: B: b) antibodies. Both ...
Table 1A
WWP1 and ITCH expression in breast cancer TMA.
Table 1B
Correlation between ITCH and ER/PR positive staining.
Table 1C
Correlation between WWP1 and ER/PR positive staining.

To examine if ITCH and WWP1 are specifically expressed by breast cancer tissues, we immunostained a normal breast TMA, which was constructed using adjacent normal breast tissue from the same patient samples in the breast cancer TMA. We found that ITCH protein was also expressed very strongly in normal breast tissues. This was similar to Smurf1 E3 ligase staining, which was also expressed by normal breast tissues (our unpublished observations). In contrast, WWP1 stained negatively in all normal breast sections (Fig. 2B).

Knocking down WWP1, but not ITCH, increases breast cancer bone metastasis

Our IHC findings that WWP1 expression is altered in some breast cancer tissues are consistent with two published clinical studies [15,16]. However, the role of WWP1 or ITCH in tumorigenesis and metastasis in vivo has not been investigated. We are interested in breast cancer bone metastasis because bone metastasis becomes a major complication of later stages of the disease [23]. We knocked down WWP1 or ITCH in human MDA-MB-231 breast cancer cells using a shRNA approach and established control shRNA and specific shRNA knockdown MDA-MB-231 cell lines (Fig. 3A). We inoculated control or shRNA WWP1- or shRNA ITCH-expressing cells into the left ventricle of athymic nude mice using a well-established breast cancer bone metastasis model. Radiographs were taken the day before and 4 weeks after cancer cell inoculation. Mice that received the control or shRNA ITCH-expressing MDA-MB-231 cells had the same number of osteolytic lesions in bones (data not shown). However, mice given shRNA WWP1-expressing MDA-MB-231 cells had a 2–3 fold increase in osteolytic lesions in two separate experiments (Figs. 3B–D). Histologic analysis of bone sections confirmed increased bone destruction and showed increased tumor area in mice given shRNA WWP1-expressing MDA-MB-231 cells (Figs. 4A and B). TRAP staining indicated no increase in osteoclast numbers per bone-tumor interface (mm) (Fig. 4C), but total osteoclast numbers around and within WWP1 shRNA tumors was significantly increased (Fig. 4D). Reduced WWP1 expression in WWP1 shRNA cells after they metastasized to bone was confirmed by IHC with anti-WWP1 antibody (Fig. 4E). Thus, WWP1 appears to negatively regulate the growth and osteolytic activity of MDA-MB-231 breast cancer cells in bone, while ITCH does not appear to play an important role in the same setting.

Fig. 3
WWP1 shRNA knockdown increased osteolysis of MDA-MB-231 breast cancer cells. (A) WWP1 was knocked down with shRNA retroviral infection in MDA-MB-231 breast cancer cells. The expression levels of WWP1 were examined by Western blot and real time RT-PCR. ...
Fig. 4
WWP1 shRNA knockdown increased MDA-MB-231 breast cancer metastasis to bone. (A) H&E-stained sections (upper panels, ×2 objective lens) show increased tumor area (outlined in black color) in mice that received WWP1 shRNA cells. (B) Histomorphometric ...

WWP1 knock down increases CXCR4 protein expression

To investigate the mechanisms that may be responsible for the increased bone metastatic potential of shRNA WWP1-expressing MDA-MB-231 cells, we first examined their growth and survival. We found that WWP1 shRNA cells had the same growth and apoptosis as control shRNA cells (Figs. 5A and B). To examine if WWP1 affects osteoclast formation, we cultured wild-type osteoclast precursors with conditioned medium from control or WWP1 shRNA cells. As expected, conditioned medium from MDA-MB-231 cells increased RANKL-induced osteoclast formation. However, conditioned medium from WWP1 shRNA cells induced the same number of osteoclasts as the control medium (Fig. 5C). In vitro studies have reported several WWP1 target proteins with biologic effects involving either breast cancer bone metastasis or growth. For example, in osteoblast-like cell lines, WWP1 promoted degradation of Runx2 through the adaptor protein Schnurri-3 [24], and Runx2 expression is positively associated with breast and prostate cancer bone metastasis [25,26]. However, we found decreased Runx2 protein levels in WWP1 shRNA cells (Fig. 5D). Recently, we found that WWP1 increases JunB protein degradation in osteoblasts [27] and JunB protein represses MMP9 expression [28], which is critical for breast cancer bone metastasis [29]. However, JunB protein expression levels were similar in WWP1 shRNA and control cells (Fig. 5D). Kruppel-like factor 5 is another target protein of WWP1 [30] that promotes breast cancer cell growth [31]. Smurf1, a member of the Nedd4 E3 ligase family, is also involved in breast cancer bone metastasis [10]. Similar to Runx2, the expression levels of Kruppel-like factor 5 and Smurf1 were decreased in WWP1 shRNA cells (Fig. 5D). These negative results suggest that WWP1 does not mediate bone metastasis by promoting degradation of these proteins.

Fig. 5
WWP1 does not affect proliferation, apoptosis, osteoclastogenic potential or expression of known WWP1 targets in breast cancer cells. (A) Cell growth curves were determined by MTT assay. The values are the mean+SD of 4 wells. (B) Apoptosis was assessed ...

The CXCL12/CXCR4 chemokine system plays a critical role in tumor metastasis, including breast cancer [17]. Endothelial cells and osteoblasts within the bone marrow compartment produce high levels of CXCL12, making bone a preferred site for tumor metastasis. Interestingly, itch promotes CXCL12-mediated CXCR4 degradation in Hela cells [32]. In view of these findings, we examined if WWP1 affects CXCR4 degradation as a molecular mechanism of increased bone metastasis. First, we examined if CXCL12-induced CXCR4 degradation occurs in MDA-MB-231 cells by Western blot analysis. CXCL12 significantly induced CXCR4 protein degradation, starting at 1 h and peaking at 3 h (Fig. 6A). Interestingly, CXCL12-induced CXCR4 degradation was not observed in WWP1 shRNA cells (Fig. 6B). To examine the functional consequence of this lack of CXCR4 degradation, we tested the movement of WWP1 shRNA cells toward a CXCL12 gradient in a transwell assay and found that the cells had 1–2-fold increase in mobility compared to control cells (Fig. 6C). Finally, we examined the expression of CXCR4 protein in bone metastases using IHC and observed stronger CXCR4 positive staining in WWP1 shRNA-expressing cells compared to control cells (Fig. 6D).

Fig. 6
WWP1 inhibits CXCL12-induced CXCR4 degradation and breast cancer cell migration. (A) Control MDA-MB-231 cells were treated with CXCL12 and the expression level of CXCR4 was determined by Western blot analysis. The percentage of CXCR4 degradation was calculated ...

WWP1 affects CXCR4 lysosomal localization

Protein degradation occurs in the proteasome or lysosomes. To determine if CXCL12-induced CXCR4 degradation is through proteasome or lysosome mechanism, we treated cells with lysosomes inhibitor Chloroquine or proteasome inhibitor MG132 in the presence of CXCR12. Chloroquine partially prevented CXCR4 down-regulation while MG132 had no effect (Fig. 7A). CXCL12 induces CXCR4 internalization into the cytosol followed by lysosomal degradation [32,33]. To examine if WWP1 affects the movement of CXCR4 to lysosomes in response to CXCL12, we examined if CXCR4 co-localizes with the lysosomal marker, LAMP-2, in the control and WWP1 shRNA cells in the presence of CXCL12 by co-focal microscopy. CXCL12 treatment increased the co-localization of CXCR4 and LAMP2 in control cells, but induced co-localization in fewer WWP1 shRNA cells (Fig. 7B). This observation was confirmed by FACS analysis in which we stained cells with PE-anti-CXCR4 and FITC-anti-LAMP2 and examined LAMP2 intensity in CXCR4 positive cells (data not shown). In control cells, 39% were CXCR4/LAMP2 double positive, which increased to 61% by CXCL12 treatment. In WWP1 shRNA cells, the % of basal CXCR4/LAMP2 double positive cells was similar to control cells, which was not changed significantly by CXCL12 treatment (41% in PBS- vs 47% in CXCL12-treated cells).

Fig. 7
WWP1 reduces CXCL12-induced CXCR4 lysosomal localization. (A) Cells were pre-treated with the lysosomes inhibitor chloroquine or proteasome inhibitor and then treated with CXCL12. The expression levels of CXCR4 were determined by Western blot analysis. ...

Discussion

In this study, we have demonstrated that the E3 ligase, WWP1, functions as an inhibitor of breast cancer metastasis to bone in vivo. At the molecular level, we found that WWP1 negatively regulates CXCL12-induced CXCR4 lysosomal degradation, leading to increased breast cancer cell migration to the bone marrow cavity, a primary site for CXCL12 biosynthesis.

Many factors contribute to breast cancer metastasis to bone. In a direct microarray comparison of a mRNA expression profile of samples of metastases to brain, lung and bones from the same breast cancer cell line, only 5 genes differed significantly when bone metastases were compared with brain or lung metastases: TGFβ, MMP1, PDGF, VEGF-C and CXCL12 [34]. Previous studies suggested that WWP1 may regulate some of these pathways directly or indirectly. For example, WWP1 negatively regulates TGF-β pathway signaling by enhancing binding of Smad7 to the TGFβ type I receptor to cause ubiquitination and degradation of the receptor [35]. Regulation of TGFβ signaling is considered a common function of Nedd4 E3 ligases because Smurf1, Smurf2, ITCH, and Nedd4L all promote the degradation of TGFβ signaling proteins when they are over-expressed in cells [13]. However, there have been no reports showing that these in vitro cellular events also occur in vivo as a biological function of a given E3 ligase. A recent study has suggested that the effect of Smurfs on the TGFβ/Smad pathways is lost in breast cancer cells because Smurf1 does not interfere with Smad signaling in these cells. In addition to inhibitory effects in the TGFβ pathway, WWP1 promotes the degradation of human Kruppel-like factor 5 in prostate cancer cells. Kruppel-like factor 5 influences the migration of prostate cancer cells [36]. However, we did not observe significant up-regulation of Kruppel-like factor 5 in WWP1 shRNA MDA-MB-231 cells.

To attempt to identify new targets for WWP1 in breast cancer cells to explain why they have increased bone metastatic potential, we searched known target proteins for itch because WWP1 and itch are the closest members in the Nedd4 HECT E3 sub-family phylogenetic tree [37]. Their target proteins have some degree of similarity. ITCH negatively regulates JunB and CXCR4 protein stability. However, we found that JunB protein expression levels were similar, but CXCR4 levels are markedly increased in WWP1 shRNA cells compared to control shRNA cells.

CXCR4 is a G-protein-coupled receptor (GPCR) and the major receptor for the chemokine CXCL12, a CXC chemokine constitutively produced in the bone marrow mainly by immature osteoblasts, stromal cells and endothelial cells [38]. CXCL12 is a potent chemoattractant for stem cells [39,40] and also plays a critical role in cancer cell metastasis. It is now emerging that GPCR down-regulation is mediated by lysosomal degradation in response to ligand binding. We found that the expression of WWP1 shRNA in MDA-MB-231 cells prevented CXCL12-induced CXCR4 degradation and increased CXCL12-induced cell migration, which could be responsible for the increased bone metastasis of the WWP1 knockdown cells. The ubiquitin moiety on CXCR4 serves as a signal for long-term attenuation or down-regulation of signaling [41]. Our data strongly indicate that WWP1 may have a similar role to regulate cell migration through the regulation of CXCL12-induced CXCR4 degradation. Interestingly, the Nedd4 HECT E3 ligases are mainly localized in membranes, in the endosomal compartment, and in lysosomes. Thus, it is likely that they will function in different cellular locations. Investigation of the sub-cellular localization of WWP1 in breast cancer cells will help to determine if it also localizes in the lysosome.

Recently, we reported that breast carcinomas that metastasize to bone are typically ER positive/PR negative [42], confirming previous findings that most breast cancer bone metastases are ER positive. However, recent studies have also demonstrated that combinations of multiple molecular markers are required to accurately predict bone metastatic potential, reflecting breast cancer heterogeneity [43,44]. Furthermore, one challenge of breast cancer treatment is to identify bone metastasis at early stages of the disease. A clinical study reported that ER status did not correlate with detection of tumor cells in bone marrow in 260 patients with primary breast cancer [45]. Thus, it will be interesting to see if WWP1 negative status can be used as a predicator for bone metastasis along with other biomarkers.

WWP1 does not affect osteogenic potential of MDA231 cancer cells because conditioned medium from WWP1 shRNA cells do not have increased capacity to stimulate osteoclast formation in vitro. However, we found that total number of osteoclasts around and within tumor mass is significantly increased in mice receiving WWP1 shRNA cells, which have more osteolytic lesions. We speculate that increased osteolytic lesion in WWP1 shRNA tumor is because more tumor cells metastasize to bone marrow cavity to promote more osteoclast formation. It is not due to individual WWP1 shRNA tumor cells produce more osteoclastogenitic factors.

In summary, we demonstrate that the WWP1 is a negative regulator of breast cancer bone metastasis in vivo. It works through CXCR4 post-translational modification. Our findings suggest that WWP1-negative tumors may have a high potential for metastasis and thereby a poor prognosis. This idea is consistent with a published clinical report in which the WWP1 negative tumor tends to have a worse prognosis [16]. Thus identification of patients with WWP1-negative breast cancers could help in the development more appropriate treatment regimens.

Supplementary Material

Acknowledgments

The authors thank Ms. Yanyun Li for technical assistance with the histology, Dr. Theresa A. Guise (Indiana University) for providing MDA-MB-231 breast cancer cells, and Dr. JuanJuan Yin (National Cancer Institute) for helpful discussion.

Grant support

This work was supported by research grants from the National Institutes of Health PHS awards (AR48697 to LX, AR43510 to BFB). Kristina Subik was supported by a research fellowship from the Department of Pathology and Laboratory Medicine, University of Rochester Medical Center. Portion of statistical analysis was supported by the CTSI grant (UL1 RR024160-01 to University of Rochester Medical Center).

Footnotes

[star]Disclosure: The authors have nothing to disclose.

Supplementary materials related to this article can be found online at doi:10.1016/j.bone.2011.12.022.

References

1. Ingham RJ, Gish G, Pawson T. The Nedd4 family of E3 ubiquitin ligases: functional diversity within a common modular architecture. Oncogene. 2004;23(11):1972–84. [PubMed]
2. Kerscher O, Felberbaum R, Hochstrasser M. Modification of proteins by ubiquitin and ubiquitin-like proteins. Annu Rev Cell Dev Biol. 2006;22:159–80. [PubMed]
3. Lu PJ, Zhou XZ, Shen M, Lu KP. Function of WW domains as phosphoserine- or phosphothreonine-binding modules. Science. 1999;283(5406):1325–8. [PubMed]
4. Liu YC. The E3 ubiquitin ligase Itch in T cell activation, differentiation, and tolerance. Semin Immunol. 2007;19(3):197–205. [PMC free article] [PubMed]
5. Bai Y, Yang C, Hu K, Elly C, Liu YC. Itch E3 ligase-mediated regulation of TGF-beta signaling by modulating smad2 phosphorylation. Mol Cell. 2004;15(5):825–31. [PubMed]
6. Flores SY, Debonneville C, Staub O. The role of Nedd4/Nedd4-like dependant ubiquitylation in epithelial transport processes. Pflugers Arch. 2003;446(3):334–8. [PubMed]
7. Kavsak P, Rasmussen RK, Causing CG, et al. Smad7 binds to Smurf2 to form an E3 ubiquitin ligase that targets the TGF beta receptor for degradation. Mol Cell. 2000;6(6):1365–75. [PubMed]
8. Zhu H, Kavsak P, Abdollah S, Wrana JL, Thomsen GH. A SMAD ubiquitin ligase targets the BMP pathway and affects embryonic pattern formation. Nature. 1999;400(6745):687–93. [PubMed]
9. Abriel H, Loffing J, Rebhun JF, et al. Defective regulation of the epithelial Na+ channel by Nedd4 in Liddle’s syndrome. J Clin Invest. 1999;103(5):667–73. [PMC free article] [PubMed]
10. Fukunaga E, Inoue Y, Komiya S, et al. Smurf2 induces ubiquitin-dependent degradation of Smurf1 to prevent migration of breast cancer cells. J Biol Chem. 2008;283(51):35660–7. [PubMed]
11. Knuutila S, Bjorkqvist AM, Autio K, et al. DNA copy number amplifications in human neoplasms: review of comparative genomic hybridization studies. Am J Pathol. 1998;152(5):1107–23. [PubMed]
12. Chen C, Zhou Z, Sheehan CE, et al. Overexpression of WWP1 is associated with the estrogen receptor and insulin-like growth factor receptor 1 in breast carcinoma. Int J Cancer. 2009;124(12):2829–36. [PubMed]
13. Chen C, Zhou Z, Liu R, Li Y, Azmi PB, Seth AK. The WW domain containing E3 ubiquitin protein ligase 1 upregulates ErbB2 and EGFR through RING finger protein 11. Oncogene. 2008;27(54):6845–55. [PubMed]
14. Feng SM, Muraoka-Cook RS, Hunter D, et al. The E3 ubiquitin ligase WWP1 selectively targets HER4 and its proteolytically derived signaling isoforms for degradation. Mol Cell Biol. 2009;29(3):892–906. [PMC free article] [PubMed]
15. Chen C, Zhou Z, Ross JS, Zhou W, Dong JT. The amplified WWP1 gene is a potential molecular target in breast cancer. Int J Cancer. 2007;121(1):80–7. [PubMed]
16. Nguyen Huu NS, Ryder WD, Zeps N, et al. Tumour-promoting activity of altered WWP1 expression in breast cancer and its utility as a prognostic indicator. J Pathol. 2008;216(1):93–102. [PubMed]
17. Benovic JL, Marchese A. A new key in breast cancer metastasis. Cancer Cell. 2004;6(5):429–30. [PubMed]
18. Bohn OL, Nasir I, Brufsky A, et al. Biomarker profile in breast carcinomas presenting with bone metastasis. Int J Clin Exp Pathol. 2009;3(2):139–46. [PMC free article] [PubMed]
19. Yoneda T, Sasaki A, Dunstan C, et al. Inhibition of osteolytic bone metastasis of breast cancer by combined treatment with the bisphosphonate ibandronate and tissue inhibitor of the matrix metalloproteinase-2. J Clin Invest. 1997;99(10):2509–17. [PMC free article] [PubMed]
20. Guo R, Yamashita M, Zhang Q, et al. Ubiquitin ligase Smurf1 mediates tumor necrosis factor-induced systemic bone loss by promoting proteasomal degradation of bone morphogenetic signaling proteins. J Biol Chem. 2008;283(34):23084–92. [PubMed]
21. Zhang D, Fan GC, Zhou X, et al. Over-expression of CXCR4 on mesenchymal stem cells augments myoangiogenesis in the infarcted myocardium. J Mol Cell Cardiol. 2008;44(2):281–92. [PMC free article] [PubMed]
22. Yamashita T, Yao Z, Li F, et al. NF-kappaB p50 and p52 regulate receptor activator of NF-kappaB ligand (RANKL) and tumor necrosis factor-induced osteoclast precursor differentiation by activating c-Fos and NFATc1. J Biol Chem. 2007;282(25):18245–53. [PubMed]
23. Mundy GR. Metastasis to bone: causes, consequences and therapeutic opportunities. Nat Rev Cancer. 2002;2(8):584–93. [PubMed]
24. Jones DH, Nakashima T, Sanchez OH, et al. Regulation of cancer cell migration and bone metastasis by RANKL. Nature. 2006;440(7084):692–6. [PubMed]
25. Pratap J, Wixted JJ, Gaur T, et al. Runx2 transcriptional activation of Indian Hedgehog and a downstream bone metastatic pathway in breast cancer cells. Cancer Res. 2008;68(19):7795–802. [PMC free article] [PubMed]
26. Akech J, Wixted JJ, Bedard K, et al. Runx2 association with progression of prostate cancer in patients: mechanisms mediating bone osteolysis and osteoblastic metastatic lesions. Oncogene. 2010;29(6):811–21. [PMC free article] [PubMed]
27. Zhao L, Huang J, Zhang H, et al. Tumor necrosis factor inhibits mesenchymal stem cell differentiation into osteoblasts via the ubiquitin E3 ligase Wwp1. Stem Cells. 2011;29(10):1601–10. [PMC free article] [PubMed]
28. Rylski M, Amborska R, Zybura K, et al. JunB is a repressor of MMP-9 transcription in depolarized rat brain neurons. Mol Cell Neurosci. 2009;40(1):98–110. [PubMed]
29. Stark AM, Anuszkiewicz B, Mentlein R, Yoneda T, Mehdorn HM, Held-Feindt J. Differential expression of matrix metalloproteinases in brain- and bone-seeking clones of metastatic MDA-MB-231 breast cancer cells. J Neurooncol. 2007;81(1):39–48. [PubMed]
30. Chen C, Sun X, Guo P, et al. Human Kruppel-like factor 5 is a target of the E3 ubiquitin ligase WWP1 for proteolysis in epithelial cells. J Biol Chem. 2005;280(50):41553–61. [PubMed]
31. Zheng HQ, Zhou Z, Huang J, Chaudhury L, Dong JT, Chen C. Kruppel-like factor 5 promotes breast cell proliferation partially through upregulating the transcription of fibroblast growth factor binding protein 1. Oncogene. 2009;28(42):3702–13. [PubMed]
32. Marchese A, Raiborg C, Santini F, Keen JH, Stenmark H, Benovic JL. The E3 ubiquitin ligase AIP4 mediates ubiquitination and sorting of the G protein-coupled receptor CXCR4. Dev Cell. 2003;5(5):709–22. [PubMed]
33. Marchese A, Benovic JL. Agonist-promoted ubiquitination of the G protein-coupled receptor CXCR4 mediates lysosomal sorting. J Biol Chem. 2001;276(49):45509–12. [PubMed]
34. Zhang XH, Wang Q, Gerald W, et al. Latent bone metastasis in breast cancer tied to Src-dependent survival signals. Cancer Cell. 2009;16(1):67–78. [PMC free article] [PubMed]
35. Komuro A, Imamura T, Saitoh M, et al. Negative regulation of transforming growth factor-beta (TGF-beta) signaling by WW domain-containing protein 1 (WWP1) Oncogene. 2004;23(41):6914–23. [PubMed]
36. Frigo DE, Sherk AB, Wittmann BM, et al. Induction of Kruppel-like factor 5 expression by androgens results in increased CXCR4-dependent migration of prostate cancer cells in vitro. Mol Endocrinol. 2009;23(9):1385–96. [PubMed]
37. Bernassola F, Karin M, Ciechanover A, Melino G. The HECT family of E3 ubiquitin ligases: multiple players in cancer development. Cancer Cell. 2008;14(1):10–21. [PubMed]
38. Ponomaryov T, Peled A, Petit I, et al. Induction of the chemokine stromal-derived factor-1 following DNA damage improves human stem cell function. J Clin Invest. 2000;106(11):1331–9. [PMC free article] [PubMed]
39. Lapidot T, Petit I. Current understanding of stem cell mobilization: the roles of chemokines, proteolytic enzymes, adhesion molecules, cytokines, and stromal cells. Exp Hematol. 2002;30(9):973–81. [PubMed]
40. Trubiani O, Isgro A, Zini N, et al. Functional interleukin-7/interleukin-7Ralpha, and SDF-1alpha/CXCR4 are expressed by human periodontal ligament derived mesenchymal stem cells. J Cell Physiol. 2008;214(3):706–13. [PubMed]
41. Marchese A. Ubiquitination of chemokine receptors. Methods Enzymol. 2009;460:413–22. [PubMed]
42. Wei B, Wang J, Bourne P, et al. Bone metastasis is strongly associated with estrogen receptor-positive/progesterone receptor-negative breast carcinomas. Hum Pathol. 2008;39(12):1809–15. [PubMed]
43. Wu JM, Fackler MJ, Halushka MK, et al. Heterogeneity of breast cancer metastases: comparison of therapeutic target expression and promoter methylation between primary tumors and their multifocal metastases. Clin Cancer Res. 2008;14(7):1938–46. [PMC free article] [PubMed]
44. Park SY, Lee HE, Li H, Shipitsin M, Gelman R, Polyak K. Heterogeneity for stem cell-related markers according to tumor subtype and histologic stage in breast cancer. Clin Cancer Res. 2010;16(3):876–87. [PMC free article] [PubMed]
45. Diel IJ, Kaufmann M, Goerner R, Costa SD, Kaul S, Bastert G. Detection of tumor cells in bone marrow of patients with primary breast cancer: a prognostic factor for distant metastasis. J Clin Oncol. 1992;10(10):1534–9. [PubMed]