PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
J Immunol. Author manuscript; available in PMC Sep 15, 2013.
Published in final edited form as:
PMCID: PMC3436983
NIHMSID: NIHMS393640
Genetically-driven target tissue over-expression of CD40: A novel mechanism in autoimmune disease
Amanda K. Huber, Fred D. Finkelman, Cheuk Wun Li, Erlinda Concepcion, Eric Smith,§ Eric Jacobson,§ Rauf Latif, Mehdi Keddache, Weijia Zhang, and Yaron Tomer
Division of Endocrinology, Mount Sinai School of Medicine New York, NY
Department of Medicine, Cincinnati Department of Veterans Affairs Medical Center, Cincinnati, OH
§Division of Endocrinology, the University of Cincinnati College of Medicine, Cincinnati, OH
Bronx VA Medical Center, Bronx, N.Y., USA
Genome Center, Cincinnati Children’s Hospital Medical Center
Address for Correspondence: Dr. Amanda K. Huber, PhD, Department of Medicine, Division of Endocrinology, mailbox 1055, Mount Sinai School of Medicine, 1468 Madison Ave. New York, NY 10029, Tel: (212) 241-5171, Fax: (212) 534-3488, hubera/at/umich.edu
The CD40 gene, an important immune regulatory gene, is also expressed and functional on non-myeloid derived cells, many of which are targets for tissue specific autoimmune diseases, including beta cells in type 1 diabetes, intestinal epithelial cells in Crohn’s disease, and thyroid follicular cells in Graves’ disease (GD). Whether target tissue CD40 expression plays a role in autoimmune disease etiology has yet to be determined. Here we show, that target-tissue over-expression of CD40 plays a key role in the etiology of autoimmunity. Using a murine model of GD, we demonstrated that thyroidal CD40 over-expression augmented the production of thyroid specific antibodies, resulting in more severe experimental autoimmune Graves’ disease (EAGD), whereas deletion of thyroidal CD40 suppressed disease. Using transcriptome and immune-pathway analyses we showed that in both EAGD mouse thyroids and human primary thyrocytes, CD40 mediates this effect by activating downstream cytokines and chemokines, most notably IL-6. To translate these findings into therapy, we blocked IL-6 during EAGD induction in the setting of thyroidal CD40 over-expression, and showed decreased levels of TSHR stimulating antibodies and frequency of disease. We conclude that target tissue over-expression of CD40 plays a key role in the etiology of organ specific autoimmune disease.
CD40, a member of the tumor necrosis factor receptor superfamily, is genetically associated with multiple autoimmune diseases including Graves’ disease (GD) (1), rheumatoid arthritis (RA) (2), multiple sclerosis (MS) (3), asthma (4), Crohn’s disease (CD) (5), and systemic lupus erythematosis (SLE) (6). In GD, the CC genotype of a C/T single nucleotide polymorphism (SNP) in CD40 at the −1 position of the Kozak sequence is strongly associated with disease, increasing the risk for GD by 30–80% (7). Functionally, it has been shown that the CC genotype induces a 15–32% increase in CD40 protein expression (8). Moreover, the association is significantly stronger in a subset of Graves’ disease patients having high titers of thyroid specific antibodies (i.e. anti-TSHR, anti-thyroglobulin (Tg), and/or anti-thyroid peroxidase (TPO)) (911).
While the CD40 gene is a general autoimmunity gene, it is unique among autoimmunity genes as it is expressed and functional in many non-immune tissues, where it has been shown to contribute to non-specific inflammatory responses (1217). Interestingly, many of the tissues that express CD40 are themselves targets for various tissue specific autoimmune conditions (1822), including thyroid follicular cells, the target of the autoimmune thyroid disease Graves’ disease (16,23). However, whether thyroid specific CD40 expression plays a role in Graves’ disease etiology has yet to be determined. The aim of this study was to test the hypothesis that thyroid specific expression of CD40 is critical to the development of autoimmunity using Experimental Autoimmune Graves’ disease (EAGD), as a model.
Generation of TG-CD40 mice
Studies were approved by The University of Cincinnati and Mount Sinai School of Medicine institutional animal care and use committees. Mouse CD40 cDNA, obtained from Dr. David Wagner (University of Colorado, Denver CO), was cloned into a pSG5 plasmid using BamHI and PacI sites, inserting CD40 downstream of the β-globin intron. The StuI/SalI fragment from pSG5/CD40, containing the β-globin intron and CD40, was then cloned into the EcoRI/SalI site of the pSKbTg plasmid downstream of the bovine thyroglobulin (bTg) promoter (obtained from Dr. James Fagin, Memorial Sloan Kettering Cancer Center, NY see ref. (24). This pSKbTg-CD40 construct was cut using XbaI and XhoI, and this fragment was micro-injected into fertilized C57BL/6 mouse eggs, which were implanted into pseudopregnant female mice. The pups were confirmed by PCR and southern blotting to have integrated the transgene. Lines were continued from the founders by crossing them with wild type C57BL/6 mice.
Southern Blotting
Genomic DNA from mouse tails was digested sequentially with SpeI and SalI. Digested DNA product was run on a 1% agarose gel. DNA was then transferred onto Hybond XL nylon membrane (GE Healthcare Piscataway, NJ) and probed for CD40 using the SpeI and SalI digested pSKbTg plasmid fragment (containing the bovine thyroglobulin promoter and CD40) that was radio-labeled. The expected size of the band is 3.8kb.
PCR genotyping
Briefly, DNA was amplified using the following primer pairs: pSKbTg plasmid specific primers: forward primer GTTTGGGGACCCTTGATTGTTCTT; reverse primer AGGGGCCCGGTTTGGACTC and the following primers for control gene TSH-β (to check for presence of genomic DNA): forward primer TCCTCAAAGATGCTCATTAG and reverse primer GTAACTCACTCATGCAAAGT. PCR was performed in 20 ul reaction mixtures containing 0.3 ul of genomic DNA; 2 ul of each primer (5uM stock); 2 ul PCR buffer containing 50 mmol/L KCl; 10 mmol/L Tris-HCl (pH 8.3); 1.5 mmol/L MgCl2; 0.5ul of dNTPs (200 umol/L of dATP, dGTP, dTTP, and dCTP); and 1ul of REDTaq DNA polymerase (Sigma St. Louis, MO). Reaction mixtures were heated to 95 °C for 5 min, and then cycled 35 times as follows: 30 s at 95°C, 30 s at 55 °C, and 50 s at 72 °C, and finally one cycle for 50 s at 72 °C before being cooled to 4 °C. Products were run on a 1% agarose gel. A band of 533bp (pSKbTg plasmid specific product) indicated that the transgene was expressed, and a band of 386bp (TSH-β product) confirmed that DNA was present in the reaction.
F1 hybrid mice
TG-CD40 mice were generated on a C57BL6 background. F1 hybrids were used in all experiments (except the chimeric experiments). These were the first generation of offspring from a TG-CD40 C57BL6 crossed with a wild type BALB/c mate (CXB). These have been shown to be susceptible to EAGD with about 50% of immunized mice developing disease (26,47).
Immunohistochemistry
Thyroid tissue was removed from both wild type and CD40 transgenic mice and placed in Optimal Cutting Temperature (OCT) compound in plastic base molds; these were immediately frozen with dry ice. Sections were cut 4 microns thick, placed on a slide, and fixed for 10 minutes in ice cold acetone. Slides were blocked for 10 minutes with avidin block, for 10 minutes with biotin block, for 30 minutes with Beat A block, and for 10 minutes with Beat B block (all from Invitrogen Carlsbad, CA). Anti-CD40 (clone 3/23 BD bioscience, San Jose, CA) primary antibody was added at a 1:250 dilution in 2% mouse serum and incubated for 60 minutes. Rabbit anti-rat Ig secondary antibody, mouse adsorbed (Vector Labs Burlingame, CA), was then added at a dilution of 1:250 for 10 minutes. Slides were incubated for 15 minutes in HRP-streptavidin (Invitrogen) followed by DAB (Dako Denmark) for 3 minutes, counterstained with hematoxylin (Dako) for 1 minute, and then mounted. All rinses were with PBS/Tween. Sections were visualized using an Olympus BX51 microscope, digital image captured using a Diagnostic Instruments digital camera, Model 74 Slider and image saved digitally using Spot Advanced Diagnostic Instruments software Windows version 4.6.
EAGD induction
Mice were induced with EAGD according to the Nagayama model (27), with the modifications by Rapoport (25,28). Adenoviral vector containing the A-subunit of the TSH receptor (AdTSHR-289) or the control LacZ (AdLacZ) cDNA, acquired from Dr. Basil Rapoport (Cedars Sinai Medical Center Las Angeles CA) was propagated by Viraquest Inc (North Liberty, IA) to give stock solutions of 1.2×1012 particles per mL. Mice were injected intramuscularly with 5.0 × 109 particles in 50 ul of 10% glycerol (in PBS) in the thigh muscle. A series of three intramuscular injections were given at three week intervals (Figure 1A). Blood was drawn for T4 and TSHR antibody (TRAb) levels one week after the second injection and at the time of sacrifice, three weeks after the third injection. Criteria used to classify a mouse as having experimental autoimmune GD were: the presence of higher than normal (mean ± 2 standard deviations (SD) of the pooled control AdLacZ mice levels) TRAb, and T4 levels. There was no significant increase in TRAb or T4 levels in WT and TG AdLacZ immunized mice.
Figure 1
Figure 1
Comparing Experimental Autoimmune Graves’ disease (EAGD) in Wild Type (WT) and Transgenic (TG) Mice
Anti-IL-6 treatment of EAGD
To test the effects of anti-IL-6 treatment on EAGD, we used a modified Nagayama model. Mice were immunized at day 0 and at day 21. Before the boost at day 21, mice were bled for a baseline TRAb and T4 measurement and then treated with 1 mg rat IgG1 anti-mouse IL-6 antibody (P7) or isotype control (GL113) (both purified by ammonium sulfate fractionation and cation exchange chromatography from ascites grown in Pristane-primed athymic nude mice). Since the half-life of the antibody is about 5–7 days, mice were re-treated with antibody 5 days later, at day 26. Additionally, mice were bled at days 26, 31, and at sacrifice on day 35 (Figure 4A). Blood was used to determine TRAb and T4 levels.
Figure 4
Figure 4
Effect of Anti-IL-6 treatment on TSHR Antibodies in EAGD
Creation of Chimeric Mice
BALB/c and BALB/cBy mice used for chimera experiments were purchased from Taconic Farms Inc (Hudson NY), while the CD40 knockout mice were purchased from the Jackson Laboratory (Bar Harbor, ME). 4–8 week old BALB/cBy and CD40KO mice were given two doses of 475 RAD of irradiation 3 hours apart. Within one hour after the second round of irradiation, mice were reconstituted with 5–6 × 106 cells of donor bone marrow recovered from the femurs and fibulas of 5–12 week old donor (BALB/c) mice. One donor mouse engrafts 2–4 recipient mice. Engraftment was confirmed 4 weeks post reconstitution by flow cytometry of mouse lymphocytes, checking for the expression of non-classical MHC molecule Qa2 in the BALB/cBy mice and CD40 in the knock-out mice. Once engraftment was confirmed, mice were immunized to induce EAGD.
Quantitative PCR (QPCR)
RNA was extracted from mouse thyroids using the MELT total RNA isolation kit (Applied Biosystems/Ambion Austin, TX). cDNA was synthesized by reverse transcription using the superscript III first strand synthesis kit (Invitrogen Carlsbad, CA). Gene expression of CD40, IL-6, and TNF-alpha was assessed using Taqman gene expression assays from Applied Biosystems (Foster City, CA).
Primary thyroid cell cultures
Studies were approved by UC and MSSM institutional review boards. Normal human thyroids (healthy lobe in patients undergoing surgery for thyroid tumors) were obtained from University Hospital (University of Cincinnati Cancer Center Human Tissue Procurement Facility, Cincinnati, OH) and Mount Sinai Medical Center Department of Pathology (New York, NY). Tissue was minced and digested in a 50 ml falcon tube with type II collagenase (Worthington Biochem Lakewood, NJ) at a concentration of 5 mg/ml (u/vial between 18,000–20,000) for three hours at 37°C. After three hours, 10ml of medium [DMEM, 4.0 mM L-glutamine and sodium pyruvate, 10% FBS, 1% antibiotic anti-mycotic solution (all from Hyclone/Thermo Fisher Waltham, MA)] was added to the tube, and the product was strained through a 70 um cell strainer (BD falcon San Jose, CA) into another 50 ml falcon tube. The tube was centrifuged at 1000 rpm for 5 minutes. The supernatant was carefully removed from the pellet and the pellet was washed with another 10 ml of medium. Again, the tube was spun at 1000 rpm for 5 minutes. The medium was removed from the pellet. The pellet was suspended in 10 ml of medium, and the cells were plated in a 25 cm2 flask (Corning), and placed in an incubator at 37°C with 5% CO2.
Cytokine analysis
Primary thyroid cell cultures were washed with 10ml PBS after 24 hours, and then 10mL of medium [DMEM, 4.0 mM L-glutamine and sodium pyruvate, 10% FBS, 1% antibiotic anti-mycotic solution (all from Hyclone/Thermo Fisher Waltham, MA)] were added to the flask. This was allowed to incubate at 37°C with 5% CO2 overnight. The next day, primary thyroid cells were washed with PBS, and plated evenly in a 12 well plate. Cells were incubated 24 hours to allow for adherence to the wells. Again, the cells were washed and at this time the cells were treated for 0–3 days with 1 ug of anti-CD40 stimulating antibody (G28.5). At the end of three days, the medium was removed from the cells, and used to analyze the presence of cytokines IL-6, IL-8, TNF-alpha, IL-12, IL-1, and IFN-gamma. Cytokines were assayed using a Millipore multiplex bead based array (Millipore Billerica, MA) as described by the manufacturer. Assays were read on a bio-plex reader (Bio-Rad Hercules, CA) which detects individual beads by flow cytometry. Standards were run in parallel to samples to determine cytokine concentration.
T4 Assay
T4 was measured using an RIA kit for neonatal T4 (Coat-a-Count/Siemens). Blood samples from mice were collected as a blood drop on filter paper. Assays were performed according to manufacturer’s protocol, and analyzed using a gamma counter. Calibrators run simultaneously with mouse serum samples were used to create a standard curve that was used to determine sample concentrations.
TSHR antibodies (TRAb) measurements
A commercial RIA kit (Kronus, Star, ID) was used to measure TRAb levels in mice. Serum was collected by allowing whole mouse blood to clot and then centrifuging to separate. Assay was performed according to the manufacturer’s protocol, and analyzed using a gamma counter. Calibrators run simultaneously with mouse serum samples were used to create a standard curve that was used to determine sample concentrations.
Thyroid transcriptome analysis in CD40 transgenic thyroids and in CD40 stimulated primary human thyroid cells
High throughput next generation sequencing for mRNA quantitation
Human thyroid primary cells were grown and treated for 1–3 days with 1 ug of stimulating anti-CD40 antibody (G28.5) as described above. Total RNA was purified from cells of thyroids using TRIzol and was then DNAse treated. For the analysis of mouse thyroid tissues, we collected thyroids at the time of sacrifice from wild type non-EAGD, wild type EAGD, transgenic non-EAGD, and transgenic EAGD mice either 5 or 9 weeks after the initiation of TSHR immunization,. Because of constraints related to cost and amount of RNA needed for RNAseq, extracted thyroid RNA was pooled (WT non-EAGD n=3, WT EAGD n=4, TG non-EAGD n=6, and TG EAGD n=6).
RNAseq is a method of transcriptome analysis that consists of sequencing a cDNA library by high throughput next generation sequencing. The number of reads aligning to a specific gene sequence is proportional to the abundance of that gene in the sample from which the cDNA library was prepared. We used the mRNA-Seq Sample Preparation Kit from Illumina (San Diego, CA) according to the manufacturer’s recommendation. Briefly, mRNA was extracted from 2 ug of total RNA using oligo-dT magnetic beads and fragmented at high temperature using divalent cations. A cDNA library compatible with the Illumina next generation sequencing technology was then prepared from the fragmented mRNA by reverse transcription, second strand synthesis, and ligation of specific adapters. The amount of dsDNA in each library was accurately quantified by spectrofluorometric analysis using the Qbit system from Invitrogen (Carlsbad, CA) and diluted to a 10nM concentration. Next generation sequencing was performed on an Illumina Genome Analyzer IIx according to the manufacturer’s recommendations using the Single-Read Cluster Generation Kit v2 and the SBS Sequencing Kit v3. Image analysis and base calling was conducted in real-time by the SDS 2.5/RTA1.5 software. The reads with good quality were aligned to reference sequence databases of human (ucsc hg18) or mouse (mm9) genome, RefSeq exons, splicing junctions, and contamination databases, including ribosome and mitochondria sequences using BWA, and alignment files in SAM format were generated. After filtering reads that mapped to contamination databases, the reads that were uniquely aligned to each exon and splicing-junction sites were extracted and counted. The read count for each RefSeq transcript was calculated by combining the counts for exons and splicing junctions of corresponding transcript normalized to relative abundance in Fragments Per Kilobase of exon model per Million (FPKM) in order to compare transcription levels among samples.
To compare the expression levels of transcripts across samples, the read counts of transcripts in each sample were normalized by leveling the total read counts in each sample to the maximum number of the read counts in all samples. The read count data were then formatted into microarray-like data that could be analyzed using a variety of microarray statistical analysis tools. Differentially expressed transcripts were identified using M-A based random sampling method implemented in DEGseq package in BioConductor (http://bioconductor.org/packages/2.5/bioc/html/DEGseq.html). The transcripts were further filtered at > 2-fold change and a minimum read count of 50 in either condition.
Ingenuity pathway analysis (IPA)
The differentially expressed transcripts were subjected to pathway analysis by Ingenuity Pathway Analysis (IPA) system, version 8.6 (http://www.ingenuity.com/). The IPA program identifies biological networks and/or pathways representing interactions between the differentially expressed genes in the tested samples and/or with other genes in the database. The fold changes of these genes were converted to log2Ratio and then imported into the IPA tool along with gene symbols. Fisher’s exact test was used to calculate a p-value for the probability that a pathway was significantly enriched in input genes compared to the genome, and the pathways/networks were ranked by the p-values.
cAMP measurement using CRE luciferase
30,000 cells per well of stable HEK-TSHR cells, which express the TSHR on the surface, were seeded into a 96 well plate in media [DMEM, 4.0 mM L-glutamine and sodium pyruvate, 10% FBS, 1% antibiotic anti-mycotic solution (all from Hyclone/Thermo Fisher Waltham, MA)] and incubated at 37°C with 5% CO2. The following day, the cells were transfected using 0.3ug of PGl4.29[luc2P/CRE/Hygro] (a gift from Dr. Frank Fan, Promega) per well using Xfectamine (Clontech, Mountain View, CA) as per the manufacturer’s protocol. After 4hrs at 37°C, the medium was removed and replaced by 200ul complete DMEM and incubated for 48hrs prior to testing the samples. Mouse IgG was purified from pooled serum samples of WT isotype treated controls, WT anti-IL-6 treated mice, TG isotype treated controls, and TG anti-IL-6 treated mice, using a melon gel IgG spin purification kit (Thermo Scientific Rockford, IL) as per the manufacturer’s protocol. IgG samples were quantified and diluted in media [DMEM, 4.0 mM L-glutamine and sodium pyruvate, 10% FBS, 1% antibiotic anti-mycotic solution (all from Hyclone/Thermo Fisher Waltham, MA)] to a concentration of 10 ug/mL. HEK-TSHR cells, described above, were treated with 70 ul purified mouse IgG, and allowed to incubate at 37°C with 5% CO2. After 5 hours, 70 ul of Bright Glo luciferase substrate (Promega, Madison, WI) was added to each well. To lyse the cells, the plate was shaken for two minutes, and immediately read using the FLUOstart Omega (BMG Labtech, Cary, NC).
Mouse Ig Isotyping
Serum was collected by allowing whole mouse blood to clot and then centrifuged to separate. Mouse Ig isotypes were determined using a Millipore multiplex bead based array (Millipore Billerica, MA) as described by the manufacturer. Assays were read on a bio-plex reader (Bio-Rad Hercules, CA) which detects individual beads by flow cytometry. Standards were run in parallel to samples to determine the concentration of each Ig isotype per sample.
Statistical analysis and Power Calculations
The severity of EAGD was analyzed using a one tailed student’s T-test, since our hypothesis was that TG mice would have more severe disease (i.e. higher T4 and TRAb levels). Frequency of EAGD was compared between TG and WT mice using the nonparametric χ2 test. A p-value of <0.05 was considered statistically significant for both tests.
1. Generation of CD40 transgenic mice
To test the effects of thyroidal CD40 expression on the development of EAGD, we over-expressed CD40 in the thyroid of mice, using CD40 cDNA placed under the control of the bovine thyroglobulin promoter, as described in the Methods section. This promoter has been shown to specifically target transgene expression to the thyroid in mice (24). The final plasmid, designated bTg-CD40 (Supplemental Figure 1A), was confirmed by digestion and sequencing.
The bTg-CD40 construct was microinjected into fertilized C57BL/6 mouse eggs, which were implanted into pseudo-pregnant female mice. Founders and positive offspring were screened by PCR, using primers targeting the rabbit intron of the construct, which is expressed only in the transgene insert (Supplemental Figure 1B). Expression was confirmed by Southern blotting (Supplemental Figure 1C), using a probe specific to the entire insert. High levels of CD40 expression in the thyroid was confirmed both by quantitative RT-PCR (Supplemental Figure 1D), as well as by immunohistochemistry (Supplemental Figure 1E) of thyroid sections from mice. From here on, mice over-expressing CD40 in the thyroid are referred to as transgenic or TG mice (not to be confused with the abbreviation for thyroglobulin, Tg). TG mice did not show any phenotype when followed for up to a year.
2. Thyroidal CD40 over-expression and Experimental Autoimmune Graves’ disease (EAGD)
Transgenic mice over-expressing CD40 in the thyroid (TG) were generated in a C57BL/6 mouse background. This background is resistant to EAGD; however, crossing these mice with BALB/c for one generation (F1hybrid (F1H) or CxB) makes these F1 hybrid mice susceptible to EAGD, with 50–65% of mice developing disease (25,26). All EAGD experiments performed in this study used F1H transgenic CD40 (TG) and wild type (WT) F1H littermates. EAGD was induced as previously described (25,27,28; Figure 1A).
Total Autoantibody levels
Since CD40 has been implicated in the development of thyroid specific antibodies in Graves’ patients (9,11), we first analyzed the effects of CD40 over-expression on the development of TSHR binding antibodies (TRAb) in all immunized mice. There was no difference in the incidence of TRAb in TG and WT mice immunized with adenoviral vector containing the A-subunit of the TSH receptor (AdTSHR-289, see methods) (97.3% of TG mice and 100% of WT mice developed TSHR antibodies; p=0.3827 Table I). However, mice that over-expressed CD40 in the thyroid displayed significantly higher serum levels of TRAb compared to WT (p=0.026) (Figure 1B).
Table I
Table I
Number of TSHR antibodies positive mice and frequency of EAGD after immunization with adenovirus-TSHR.
Frequency of Experimental Autoimmune Graves’ disease
We analyzed whether the increase in serum levels of TRAb resulted in an increased frequency of disease in TG mice. Interestingly, there was no significant difference in the frequency of disease between TG mice (52.8%) and WT littermates (62.96%) (p=0.32) (Table I), suggesting that tissue specific expression of CD40 is not required to trigger clinical disease. However, in view of the higher TRAb levels in immunized TG mice, we tested whether severity of disease differed between TG and WT mice.
Severity of Disease
TG mice that developed EAGD had significantly higher titers of TRAb in their serum compared to WT mice with EAGD (p=0.004) (Figure 1C). Additionally, there was a significant increase in thyroid hormone (T4) levels in TG mice with EAGD compared to WT littermates with EAGD (p=0.005) (Figure 1D), indicating that TG mice produced more stimulating antibodies than WT mice. These data demonstrated that thyroidal CD40 expression not only augmented TRAb levels, but that these antibodies were pathogenic in nature, resulting in increased thyroid hormone release, i.e. more severe disease. These data are consistent with our previous findings that CD40 is associated with pathogenic thyroid specific antibodies (11).
3. EAGD in mice lacking thyroidal CD40
So far we have shown that thyroidal CD40 plays a role in autoantibody production and severity of Graves’ disease. However, our experiments did not test whether thyroidal CD40 expression is necessary for the development of GD in mice. To investigate whether thyroidal CD40 expression is necessary for disease development, we knocked-out thyroidal CD40 expression using a chimeric approach. We lethally irradiated CD40-KO mice, and reconstituted them with WT BALB/c bone marrow to generate mice with normal expression of CD40 in marrow-derived cells, and no CD40 expression in the thyroid, as well as in other non-marrow derived tissues. It should be noted that our chimeric mice did not have a deletion of CD40 only in the thyroid since CD40 was not expressed in all non-BM derived cells. However, deleting CD40 in all non BM derived cells was actually advantageous to our model. CD40 is expressed in endothelial cells and the thyroid is highly vascular. Therefore, KO of CD40 only in thyroid follicular cells might have still allowed the endothelial CD40 to have a significant effect on triggering EAGD. By deleting CD40 in all non-BM derived tissues we ensured that CD40 expression in endothelial and other non-follicular cells within the thyroid did not mask thiseffect (note that from here on we refer to the chimeric mice with deletion of CD40 in all non BM cells as chimeric-KO mice). Since the CD40-KO mice were on a BALB/cBy background, the controls for these experiments were wild-type BALB/cBy mice reconstituted with BALB/c bone marrow. Experiments performed by us have shown that BALB/c and BALB/cBy mice are both susceptible to EAGD with a similar frequency of disease (Supplemental Figure 2). Reconstitution of control and KO mice was confirmed by flow cytometry of mouse lymphocytes. For WT mice the presence of a non-classical MHC molecule Qa2, found in BALB/c mice and not BALB/cBy mice was used (Figure 2A, top), and in KO mice, the presence of CD40 was used, as markers of reconstituted cells (Figure 2A, bottom).
Figure 2
Figure 2
Comparing Antibody levels in Wild Type (WT) and Thyroidal CD40 Knock-out (KO) Mice
Autoantibody levels
EAGD was induced in 40 chimeric CD40-KO (chimeric-KO) and 51 chimeric control mice (WT BALB/cBy mice reconstituted with BALB/c bone marrow) by intramuscular injection of AdTSHR-289. All mice were analyzed for autoantibody and T4 production. While nearly all control mice immunized with AdTSHR-289 developed TRAb (94.1%), only 52.5% of chimeric-KO mice developed TRAb (p=1.6×10−5, Table I).
These data support both our TG CD40 mouse data and data from human GD (911) showing that thyroidal CD40 may be important for the production of thyroid specific antibodies, albeit not necessary as 52.5% of chimeric-KO mice did develop TRAb. Interestingly, chimeric-KO mice that did develop antibodies had a trend toward lower levels of TRAb compared to WT (438.3 U/L and 532.08 U/L respectively); however, this difference was not significant (p=0.179) (Figure 2B). Taken together, our data suggest that CD40 expression in the thyroid augments the production of thyroid specific antibodies, and in combination with other genetic and non-genetic factors increases the likelihood of these becoming pathogenic antibodies, and triggering the development of clinical Graves’ disease.
Frequency of Graves’ disease
There was a significant decrease in the incidence of EAGD in thyroid chimeric- KO mice compared to control chimeric mice (13/40, 32.5% in chimeric-KO vs. 32/51, 62.7% in WT mice; p=0.004) (Table I). This demonstrates that expression of CD40 by non-bone marrow-derived cells (including thyrocytes) enhances, but is not absolutely required for the development of EAGD.
Severity of disease
Disease severity was determined by TRAb and T4 levels in the serum. In mice that developed EAGD, mean levels of TRAb were lower in chimeric-KO mice (586.813 U/L) compared to control chimeric mice (625.056 U/L). However, this difference was not statistically significant (p=0.179) (Figure 2C). There was also no difference in the level of T4 in chimeric-KO and WT mice (Figure 2D), demonstrating that even though the chimeric-KO mice had a significant decrease in disease frequency, those mice that developed disease had similar disease severity to the WT mice.
4. Effect of thyroidal CD40 expression on thyroid transcriptome
To elucidate potential mechanisms by which thyroidal CD40 over expression causes a more severe disease in EAGD mice, we used a discovery approach and performed a transcriptome analysis comparing the entire thyroid transcriptome in TG and WT mice with and without EAGD at acute stage of disease (5 weeks after initiation) and chronic stage of disease (9 weeks after initiation). EAGD and non-EAGD cohorts from TG and WT mice were sacrificed and their thyroids were collected. RNA was isolated and the transcriptome was analyzed by RNAseq (see Methods). Ingenuity pathway analysis was performed to examine pathways associated with EAGD in general and those specific to the more severe EAGD observed when there is thyroidal CD40 over-expression (Table II). Bioinformatic pathway analysis of the RNAseq data was performed by the Ingenuity Pathway Analysis (IPA) program (Ingenuity Systems, Redwood City, CA) and the data is available for viewing using GEO accession number GSE39081 at URL http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE39081.
Table II
Table II
Pathways based on comparisons of WT and TG, non-EAGD and EAGD, mice from ingenuity pathway analysis of RNAseq data
In WT mice with EAGD at acute stage of disease, up-regulated pathways included those associated with non-specific inflammation including those found in the oxidative stress response pathway (p=5.62×10−5), complement pathway (p=2.04×10−3), and IL-10 signaling pathway (p=6.6×10−3). This differed in WT chronic EAGD, where up-regulated pathways were associated with the adaptive immune response. These included dendritic cell maturation (p=1.51×10−5), IL-8 signaling (p=0.004), CD28 signaling in T helper cells (p=0.002), and antigen presentation pathways (p=0.005). These findings are consistent with a shift from non-specific inflammation to adaptive immune response activation as the disease progresses. Next, to examine the difference in disease development between TG and WT mice, we compared acute EAGD in TG mice (where CD40 was over-expressed on thyroid follicular cells) to acute EAGD in WT mice. Two interesting pathways were significantly up-regulated, IGF-1 and IL-6 signaling pathways (Table II). In chronic EAGD, TG vs. WT, two immune pathways were up-regulated, CXCR4 signaling (p=0.002) and IL-1 signaling (p=0.03) in TG mice compared to WT mice (Table II).
Interestingly, both in acute and chronic EAGD in TG and WT mice, the PTH/vitamin D receptor pathways were up-regulated. While vitamin D has been shown to play many roles in the immune system and disease (reviewed in 29,30), we believe this could be an artifact from our mouse thyroid samples being slightly contaminated with parathyroid cells.
To determine whether the transcriptome results in the TG mice reflected acute or chronic stimulation of CD40 on thyrocytes, we performed RNAseq and pathway analysis in human thyroid follicular cells exposed for 24 hours to G28.5, a monoclonal CD40 stimulating antibody. Human thyroid follicular cells in primary cultures were exposed to G28.5 (1 ug) for 0 and 24 hours and RNA was isolated (see Methods). The samples for each time point were pooled. Not unexpectedly, this intervention, reflecting an acute stimulation of CD40, provoked a marked increase in the C40 signaling pathway (p=6.16×10−4). In addition, Ingenuity pathway analysis showed other pathways that were significantly up-regulated by acute stimulation of CD40 (Table III). Of interest to the pathogenesis of Graves’ disease, CD40 stimulation in human primary cells triggered an increase in signaling pathways for the pro-inflammatory cytokines IL-17 (p=0.001), IL-8 (p=0.01), and IL-6 (p=0.02). The IL-6 pathway is of particular interest, as it was also up-regulated in the thyroids of TG mice with acute EAGD compared to WT mice with acute EAGD (Table II). Additionally, the increase in transcripts for the cytokines IL-6, IL-8, and IL-1B indicate a role for thyroidal CD40 stimulation and communication between the innate and adaptive immune responses in the thyroid (p=0.017) (Table III).
Table III
Table III
Pathways based on comparisons of anti-CD40 treated and untreated primary human thyroid cell cultures from ingenuity pathway analysis of RNAseq data
5. Confirmation of transcriptome data: Effects of thyroidal CD40 on cytokine/chemokine production by thyroid follicular cells
Thyroid cells themselves are not capable of producing antibodies. Thus, tissue specific CD40 expression must be influencing TRAb production through other mechanisms. Since RNAseq analysis showed up-regulation of IL-6 in thyroids of TG mice with acute EAGD compared to WT, we hypothesized that tissue specific B-cell responses are being activated through a bystander mechanism secondary to increased local inflammation in the thyroid triggered by IL-6. Increased thyroidal expression and stimulation of CD40 drives pro-inflammatory cytokine production and could augment this process.
Analysis of cytokine expression in vivo in EAGD thyroids
To confirm RNAseq data, mRNA was purified from AdTSHR and AdLacZ immunized TG and WT mice. Quantitative RT-PCR (QPCR) analysis showed that both TG and WT mice that developed EAGD had significantly increased IL-6 expression compared to TG and WT mice that were immunized with TSHR but did not develop EAGD (non-EAGD) (p=0.023 and p=0.037 respectively) (Figure 3A). These data suggested that IL-6 expression may be involved in the pathogenesis of EAGD. Moreover, confirming RNAseq results from above, TG mice that developed EAGD had significantly increased levels of IL-6 compared to WT mice developing EAGD (p=0.047) (Figure 3A). These findings provide an attractive mechanism for the role of thyroidal CD40, through IL-6 secretion, in EAGD. Increased thyroidal CD40 expression can induce increased IL-6 levels in the thyroid which in turn can augment B-cell activation and TRAb production.
Figure 3
Figure 3
Cytokine Production in EAGD thyroid and Human Primary Thyroid Cultures
Effect of CD40 stimulation on cytokine secretion from primary thyroid cell cultures
We next confirmed the RNAseq results from mouse thyroids and human primary thyroid cells stimulated with G28.5, by analyzing cytokine secretion in human thyroid cells upon stimulation of CD40. CD40 was stimulated on human primary thyroid cells directly by exposing them to a stimulating CD40 antibody (G28.5) for 1–3 days. The production of cytokines was analyzed using a multiplex cytokine array assay (methods). Consistent with the RNAseq data, primary human thyroid cells stimulated with G28.5 showed a statistically significant increase in the levels of IL-6, IL-8, and TNF-α (Figure 3B), in cell culture supernatants.
Taken together, these data suggest that CD40 stimulation on thyrocytes leads to pro-inflammatory cytokine production by the thyroid cells themselves that could result in local inflammation and antibody production targeting thyroid specific antigens.
6. CD40 augments EAGD via increased IL-6 secretion
We have shown in multiple ways that IL-6 is an important downstream molecule of CD40 signaling in EAGD. Therefore, we hypothesized that increased IL-6 production in CD40 transgenic mice played a role in the increased antibody production seen in these mice. To test this hypothesis, we treated immunized TG and WT mice with anti-IL-6 antibody (Figure 4A), and analyzed TRAb and T4 levels at various time points in these mice.
Treatment of mice with anti-IL-6
We induced EAGD as before and treated mice with either 1 mg of anti-IL-6 blocking antibody or isotype control. The mice were sacrificed on day 35 (Figure 4A). There was no difference in the production of TRAb over time in WT mice treated with anti-IL-6 antibody compared to isotype control (Figure 4B, left panel). In addition anti-IL-6 treatment did not affect T4 levels in WT mice immunized with TSHR (Figure 4B, right panel) In contrast, there was a significant delay in TRAb production in TG mice treated with anti-IL-6 antibody compared to mice treated with isotype controls (p=0.04 on day 26) (Figure 4C left panel). Moreover, T4 levels in anti-IL-6 treated TG mice were significantly lower than in the isotype control treated mice at day 31 and 35 (p=0.033 and 0.041, respectively). In fact, the average T4 level in TG mice treated with anti-IL-6 did not rise above the upper limit of normal (Figure 4C right panel). This suggests that anti-IL-6 mAb specifically blocked the effects of thyroidal CD40 in promoting EAGD development. Overall, TG mice treated with anti-IL-6 mAb had a significant decrease in the frequency of EAGD compared to WT isotype control, WT anti-IL-6, and TG isotype control treated mice (Table IV).
Table IV
Table IV
Frequency of EAGD (both high TRAb and T4 values) in isotype and anti-IL-6 treated mice at different time points
cAMP bioassay of serum from anti-IL-6 treated mice
To confirm that anti-IL-6 treatment inhibited the formation of TSHR stimulating IgG (TSI) in TG mice, we tested TSHR stimulating IgG activity in their serum using a cAMP bioassay. HEK-TSHR cells transfected with a PGl4.29 [luc2P/CRE/Hygro] vector, containing a cAMP response element (CRE) that drives transcription of a luciferase reporter gene, were treated with purified mouse IgG from TG mice treated with anti-IL-6 or isotype control antibodies. cAMP is produced upon TSHR stimulation, therefore, luciferase output is an indicator of levels of TSHR stimulating IgG present. The activity of TSI was significantly decreased in anti-IL-6 treated TG mice (p=0.02, Figure 4D), concordant with the decrease seen in T4 levels in the previous experiment (Figure 4C).
In this manuscript we used a mouse model of Graves’ disease (EAGD) to test the hypothesis that thyroidal over-expression of CD40, driven by a CD40 Kozak SNP, plays a role in the etiology of Graves’ disease. However, in contrast to humans, where it is well documented that CD40 is expressed and functional on thyroid follicular cells, both in normal and Graves’ glands (16, 23), we found that wild type mice express very low levels of CD40 in the thyroid. Therefore, to test this hypothesis, we created a transgenic mouse over-expressing CD40 in the thyroid (Supplemental Figure 1). Our data demonstrated that thyroid specific over-expression of CD40 plays a role in the pathogenesis of Graves’ disease. TG mice had significantly higher levels of TSHR stimulating antibodies resulting in more severe thyrotoxicosis. This was a specific effect and not the result of global increase in immunoglobulins, since the levels of total immunoglobulins and their isotypes were not different between TG and WT mice (Supplemental Figure 4).
Mechanistically, in thyroids from EAGD mice IL-6 expression was found to be augmented in the setting of over-expression of CD40 in the thyroid, suggesting a role for IL-6 secretion, triggered by thyroidal CD40 stimulation, in the production of tissue specific antibodies. Indeed, IL-6 has been shown to play an important role in adaptive immunity, specifically in inducing B-cell differentiation into antibody producing plasma cells (3133). To confirm the role of IL-6 in antibody production in EAGD, we blocked IL-6 in TG and WT EAGD mice, and analyzed the production of thyroid specific antibodies. While there was no difference in TRAb and T4 levels in WT mice treated with anti-IL-6 antibody, this treatment delayed production of TRAb in TG mice. Moreover, it appears that blocking IL-6 restricted the production of pathogenic (stimulating) TRAb, since T4 levels in anti-IL-6 treated CD40-TG mice remained within the normal range, even though the titers of antibodies eventually returned to the levels of isotype control treated mice. Since this effect was seen only in the TG mice, it suggests that IL-6 plays a role in augmenting pathogenic TRAb production in EAGD in the setting of high levels of CD40 in the thyroid. Supporting this notion are the data showing that stimulation of CD40 on primary human thyroid cells resulted in the secretion of pro-inflammatory cytokines including IL-6.
The data presented here help to provide a novel mechanism for the association of CD40 with GD as well as other autoimmune diseases. Previously, we and others (9,3436) have shown an association of a single nucleotide polymorphism (SNP) in the Kozak sequence of the CD40 gene with Graves’ disease. The association was significantly stronger in a subset of Graves’ patients having high titers of thyroid specific antibodies, suggesting that CD40 played a role in the production of antibodies that mediate Graves’ disease (911). Functionally, the CC genotype (associated with disease) has been shown to cause increased CD40 protein expression (10). However it was not clear whether increased CD40 expression on B-cells, thyroid cells, or both, conferred susceptibility to GD. Here we show that thyroidal expression of CD40 plays an important role in disease etiology as over-expression of CD40 in the thyroid augmented disease and deletion of CD40 in non BM derived cells including thyroid cells attenuated disease. Since our chimeric-KO mice had CD40 deletion in all non-BM derived cells and not only in thyroid cells, it is possible that CD40 expression in other non BM cells in addition to thyroid cells may also contribute to disease etiology. Moreover, EAGD itself caused increased thyroidal expression of CD40 in WT mice which can additionally help perpetuate the disease (Supplemental Figure 3F).
Our findings showing a role of target tissue expression of CD40 in the etiology of GD may be relevant to other autoimmune diseases. Indeed, in addition to being expressed in the human thyroid (16,23), CD40 has been shown to be expressed in many tissues that are targets for other organ specific autoimmune conditions such as β-cells (18), the target in T1D, spinal cord (37), tissue affected by MS, keratinocytes (20), cells affected in psoriasis, colon fibroblast and intestinal epithelial cells (21,38), cells effected by inflammatory bowel disease (IBD), and synovial cells from RA patients (22). Moreover, genetic associations with the CD40 gene locus have been reported in conditions besides Graves’ disease, including rheumatoid arthritis, multiple sclerosis, and asthma, suggesting that tissue specific CD40 expression may also play a role in these autoimmune diseases. In multiple sclerosis, CD40 expression is increased in the spinal cord during acute relapses of disease and deleting CD40 in the CNS compartment in experimental autoimmune encephalomyelitis has been shown to result in a less severe disease (39,40), similar to our observation in mice lacking CD40 in the thyroid.
One of the major effects of CD40 stimulation is induction of cytokine secretion. Cytokine secretion after CD40 stimulation has been previously studied in target tissues of other autoimmune conditions. In the β-cell, CD40 stimulation led to the secretion of IL-6, IL-8, MCP-1, and MIP-1β (41). On keratinocytes, stimulation of CD40 with sCD154 and IFN-γ resulted in the up-regulation of cellular adhesion molecules, the anti-apoptotic gene Bcl-x, IL-8, CCL20, RANTES, and MCP-1 (20). In microglia cells, stimulation of CD40 caused secretion of IL-12 and TNF-α (42). Colon fibroblasts stimulated with anti-CD40 antibody showed activation of NF-kB and production of IL-6, MCP-1, and IL-8 (21), and intestinal epithelial cells stimulated with CD40L secreted IL-8 (38). Finally, in synovial fibroblasts, CD40 stimulation led to proliferation, as well as increased levels of adhesion molecules and IL-6, GM-CSF, MIP-1α (43), and RANKL (44). Thus, our data, demonstrating increased IL-6, TNF-α, and IL-8 in thyrocytes stimulated with CD40 antibody, is consistent with data in other autoimmune conditions and suggests a generalized mechanism by which CD40 tissue expression plays a role in autoimmunity. For this reason, it seems plausible that blocking the interaction of CD40 with its ligand, CD154, might suppress organ specific autoimmunity. However, the first clinical trial using anti-CD154 mAb to block the interaction of CD40-CD154 had to be discontinued early due to thrombosis in some patients (45). Therefore, in the future, it may be more effective to target downstream effectors in this pathway. Indeed, our data suggest that blocking IL-6 may be an attractive approach to treating autoimmune diseases influenced by CD40 target tissue expression.
In conclusion, we have shown, for the first time, a novel mechanism by which CD40 expression in the thyroid may contribute to the etiology of Graves’ disease. We found that thyroidal CD40 over-expression augments the production of thyroid specific antibodies, resulting in a more severe disease, whereas deletion of thyroidal CD40 had the opposite effect. Therefore, a model is emerging whereby, during times of local inflammation (e.g. induced by infection, or other toxins such as excess iodine), thyroidal CD40 activation can result in local cytokine secretion, bystander activation of resident T- and B-cells, and increased B-cell tissue specific responses, leading to thyroid specific antibody production. When other predisposing factors are present, either environmental or genetic, this autoimmune reaction may result in the onset of clinical GD (Figure 5). Therefore, our data suggest that CD40 and its downstream cytokine response may be potential therapeutic targets in Graves’ disease. Moreover, these same targets could be important in other autoimmune conditions, where target-tissue CD40 has also been shown to play an important role.
Figure 5
Figure 5
Proposed mechanism of the function of CD40 in the pathogenesis of Graves’ disease
Supplementary Material
ACKNOWLEDGMENTS
We would like to thank Drs. Terry Davies, Adrian Ting, and Thomas Moran for expert advice. Special thanks to Dr. Alia Hasham for expert review of the manuscript.
This work was supported in part by Grants DK61659, DK067555, and DK073681 from the National Institutes of Health and by Veterans Administration funds (to Y.T.).
Footnotes
Disclosure: The authors of this paper have nothing to disclose.
The authors have no conflicting financial interests.
1. Tomer Y, Concepcion E, Greenberg DA. A C/T single nucleotide polymorphism in the region of the CD40 gene is associated with Graves' disease. Thyroid. 2002;12:1129–1135. [PubMed]
2. Raychaudhuri S, Remmers EF, Lee AT, Hackett R, Guiducci C, Burtt NP, Gianniny L, Korman BD, Padyukov L, Kurreeman FA, Chang M, Catanese JJ, Ding B, Wong S, van der Helm-van Mil AH, Neale BM, Coblyn J, Cui J, Tak PP, Wolbink GJ, Crusius JB, van der Horst-Bruinsma IE, Criswell LA, Amos CI, Seldin MF, Kastner DL, Ardlie KG, Alfredsson L, Costenbader KH, Altshuler D, Huizinga TW, Shadick NA, Weinblatt ME, de Vries N, Worthington J, Seielstad M, Toes RE, Karlson EW, Begovich AB, Klareskog L, Gregersen PK, Daly MJ, Plenge RM. Common variants at CD40 and other loci confer risk of rheumatoid arthritis. Nat Genet. 2008;40:1216–1223. [PMC free article] [PubMed]
3. Genome-wide association study identifies new multiple sclerosis susceptibility loci on chromosomes 12 and 20. Nat Genet. 2009;41:824–828. [PubMed]
4. Park JH, Chang HS, Park CS, Jang AS, Park BL, Rhim TY, Uh ST, Kim YH, Chung IY, Shin HD. Association Analysis of CD40 Polymorphisms with Asthma and the Level of Serum Total IgE. Am J Respir Crit Care Med. 2007;175:775–782. [PubMed]
5. Blanco-Kelly F, Matesanz F, Alcina A, Teruel M, Diaz-Gallo LM, Gomez-Garcia M, Lopez-Nevot MA, Rodrigo L, Nieto A, Cardena C, Alcain G, Diaz-Rubio M, de la Concha EG, Fernandez O, Arroyo R, Martin J, Urcelay E. CD40: novel association with Crohn's disease and replication in multiple sclerosis susceptibility. PLoS One. 2010;5:e11520. [PMC free article] [PubMed]
6. Wakeland EK, Liu K, Graham RR, Behrens TW. Delineating the genetic basis of systemic lupus erythematosus. Immunity. 2001;15:397–408. [PubMed]
7. Nduwayo L, Bacq Y, Valat C, Goudeau A, Lecomte P. [Thyroid function and autoimmunity in 215 patients seropositive for the hepatitis C virus] Ann Endocrinol (Paris) 1998;59:9–13. [PubMed]
8. Jacobson EM, Concepcion E, Oashi T, Tomer Y. A Graves' disease-associated Kozak sequence single-nucleotide polymorphism enhances the efficiency of CD40 gene translation: a case for translational pathophysiology. Endocrinology. 2005;146:2684–2691. [PubMed]
9. Kim TY, Park YJ, Hwang JK, Song JY, Park KS, Cho BY, Park DJ. A C/T polymorphism in the 5'-untranslated region of the CD40 gene is associated with Graves' disease in Koreans. Thyroid. 2003;13:919–926. [PubMed]
10. Jacobson EM, Concepcion E, Oashi T, Tomer Y Y. A Graves' disease-associated Kozak sequence single-nucleotide polymorphism enhances the efficiency of CD40 gene translation: a case for translational pathophysiology. Endocrinology. 2005;146:2684–2691. [PubMed]
11. Jacobson EM, Huber AK, Akeno N, Sivak M, Li CW, Concepcion E, Ho K, Tomer Y. A CD40 Kozak sequence polymorphism and susceptibility to antibody-mediated autoimmune conditions: The role of CD40 tissue-specific expression. Genes Immun. 2007;8:205–214. [PubMed]
12. Urbich C, Dimmeler S. CD40 and vascular inflammation. Can J Cardiol. 2004;20:681–683. [PubMed]
13. Zirlik A, Bavendiek U, Libby P, MacFarlane L, Gerdes N, Jagielska J, Ernst S, Aikawa M, Nakano H, Tsitsikov E, Schonbeck U. TRAF-1,-2,-3,-5, and-6 are induced in atherosclerotic plaques and differentially mediate proinflammatory functions of CD40L in endothelial cells. Arterioscler Thromb Vasc Biol. 2007;27:1101–1107. [PubMed]
14. Alabraba EB, Lai V, Boon L, Wigmore SJ, Adams DH, Afford SC. Coculture of human liver macrophages and cholangiocytes leads to CD40-dependent apoptosis and cytokine secretion. Hepatology. 2008;47:552–562. [PubMed]
15. Ohta Y, Hamada Y. In situ Expression of CD40 and CD40 ligand in psoriasis. Dermatology. 2004;209:21–28. [PubMed]
16. Smith TJ, Sciaky D, Phipps RP, Jennings TA. CD40 expression in human thyroid tissue: evidence for involvement of multiple cell types in autoimmune and neoplastic diseases. Thyroid. 1999;9:749–755. [PubMed]
17. Falco A, Romano M, Iapichino L, Collura M, Davi G. Increased soluble CD40 ligand levels in cystic fibrosis. J Thromb Haemost. 2004;2:557–560. [PubMed]
18. Klein D, Barbe-Tuana F, Pugliese A, Ichii H, Garza D, Gonzalez M, Molano RD, Ricordi C, Pastori RL. A functional CD40 receptor is expressed in pancreatic beta cells. Diabetologia. 2005;48:268–276. [PubMed]
19. Peters AL, Stunz LL, Bishop GA. CD40 and autoimmunity: the dark side of a great activator. Semin Immunol. 2009;21:293–300. [PMC free article] [PubMed]
20. Denfeld RW, Hollenbaugh D, Fehrenbach A, Weiss JM, von Leoprechting A, Mai B, Voith U, Schopf E, Aruffo A, Simon JC. CD40 is functionally expressed on human keratinocytes. Eur J Immunol. 1996;26:2329–2334. [PubMed]
21. Gelbmann CM, Leeb SN, Vogl D, Maendel M, Herfarth H, Scholmerich J, Falk W, Rogler G. Inducible CD40 expression mediates NFkappaB activation and cytokine secretion in human colonic fibroblasts. Gut. 2003;52:1448–1456. [PMC free article] [PubMed]
22. Rissoan MC, van Kooten C, Chomarat P, Galibert L, Durand I, Thivolet-Bejui F, Miossec P, Banchereau J. The functional CD40 antigen of fibroblasts may contribute to the proliferation of rheumatoid synovium. Clin Exp Immunol. 1996;106:481–490. [PubMed]
23. Faure GC, Bensoussan-Lejzerowicz D, Bene MC, Aubert V, Leclere J. Coexpression of CD40 and class II antigen HLA-DR in Graves' disease thyroid epithelial cells. Clin Immunol Immunopathol. 1997;84:212–215. [PubMed]
24. Knauf JA, Ma X, Smith EP, Zhang L, Mitsutake N, Liao XH, Refetoff S, Nikiforov YE, Fagin JA. Targeted expression of BRAFV600E in thyroid cells of transgenic mice results in papillary thyroid cancers that undergo dedifferentiation. Cancer Res. 2005;65:4238–4245. [PubMed]
25. Chen CR, Pichurin P, Chazenbalk GD, Aliesky H, Nagayama Y, McLachlan SM, Rapoport B. Low-dose immunization with adenovirus expressing the thyroid-stimulating hormone receptor A-subunit deviates the antibody response toward that of autoantibodies in human Graves' disease. Endocrinology. 2004;145:228–233. [PubMed]
26. Aliesky HA, Pichurin PN, Chen CR, Williams RW, Rapoport B, McLachlan SM. Probing the genetic basis for thyrotropin receptor antibodies and hyperthyroidism in immunized CXB recombinant inbred mice. Endocrinology. 2006;147:2789–2800. [PubMed]
27. Nagayama Y, Kita-Furuyama M, Ando T, Nakao K, Mizuguchi H, Hayakawa T, Eguchi K, Niwa M. A novel murine model of Graves' hyperthyroidism with intramuscular injection of adenovirus expressing the thyrotropin receptor. J Immunol. 2002;168:2789–2794. [PubMed]
28. Chen CR, Pichurin P, Nagayama Y, Latrofa F, Rapoport B, McLachlan SM. The thyrotropin receptor autoantigen in Graves disease is the culprit as well as the victim. J Clin Invest. 2003;111:1897–1904. [PMC free article] [PubMed]
29. Hewison M. Vitamin D and innate and adaptive immunity. Vitamins and Hormones. 2011;86:23–62. [PubMed]
30. Di Rosa M, Malaguarnera M, Nicoletti F, Malaguarnera L. Vitamin D3: a helpful immuno-modulator. Immunology. 2011;134:123–139. [PubMed]
31. Hirano T, Taga T, Nakano N, Yasukawa K, Kashiwamura S, Shimizu K, Nakajima K, Pyun KH, Kishimoto T. Purification to homogeneity and characterization of human B-cell differentiation factor (BCDF or BSFp-2) Proc Natl Acad Sci U S A. 1985;82:5490–5494. [PubMed]
32. Kishimoto T, Hirano T. Molecular regulation of B lymphocyte response. Annu Rev Immunol. 1988;6:485–512. [PubMed]
33. Muraguchi A, Hirano T, Tang B, Matsuda T, Horii Y, Nakajima K, Kishimoto T. The essential role of B cell stimulatory factor 2 (BSF-2/IL-6) for the terminal differentiation of B cells. J Exp Med. 1988;167:332–344. [PMC free article] [PubMed]
34. Kurylowicz A, Kula D, Ploski R, Skorka A, Jurecka-Lubieniecka B, Zebracka J, Steinhof-Radwanska K, Hasse-Lazar K, Hiromatsu Y, Jarzab B, Bednarczuk T. Association of CD40 gene polymorphism (C-1T) with susceptibility and phenotype of Graves' disease. Thyroid. 2005;15:1119–1124. [PubMed]
35. Ban Y, Tozaki T, Taniyama M, Tomita M, Ban Y. Association of a C/T Single-Nucleotide Polymorphism in the 5' Untranslated Region of the CD40 Gene with Graves' Disease in Japanese. Thyroid. 2006;16:443–446. [PubMed]
36. Mukai T, Hiromatsu Y, Fukutani T, Ichimura M, Kaku H, Miyake I, Yamada K. A C/T polymorphism in the 5' untranslated region of the CD40 gene is associated with later onset of Graves' disease in Japanese. Endocr J. 2005;52:471–477. [PubMed]
37. Issazadeh S, Navikas V, Schaub M, Sayegh M, Khoury S. Kinetics of expression of costimulatory molecules and their ligands in murine relapsing experimental autoimmune encephalomyelitis in vivo. J Immunol. 1998;161:1104–1112. [PubMed]
38. Borcherding F, Nitschke M, Hundorfean G, Rupp J, von Smolinski D, Bieber K, van Kooten C, Lehnert H, Fellermann K, Buning J. The CD40-CD40L pathway contributes to the proinflammatory function of intestinal epithelial cells in inflammatory bowel disease. Am J Pathol. 2010;176:1816–1827. [PubMed]
39. Ponomarev ED, Shriver LP, Dittel BN. CD40 expression by microglial cells is required for their completion of a two-step activation process during central nervous system autoimmune inflammation. J Immunol. 2006;176:1402–1410. [PubMed]
40. Becher B, Blain M, Antel JP. CD40 engagement stimulates IL-12 p70 production by human microglial cells: basis for Th1 polarization in the CNS. J Neuroimmunol. 2000;102:44–50. [PubMed]
41. Barbe-Tuana FM, Klein D, Ichii H, Berman DM, Coffey L, Kenyon NS, Ricordi C, Pastori RL. CD40-CD40 ligand interaction activates proinflammatory pathways in pancreatic islets. Diabetes. 2006;55:2437–2445. [PubMed]
42. Tan J, Town T, Mori T, Obregon D, Wu Y, DelleDonne A, Rojiani A, Crawford F, Flavell RA, Mullan M. CD40 is expressed and functional on neuronal cells. EMBO J. 2002;21:643–652. [PubMed]
43. Min DJ, Cho ML, Lee SH, Min SY, Kim WU, Min JK, Park SH, Cho CS, Kim HY. Augmented production of chemokines by the interaction of type II collagen-reactive T cells with rheumatoid synovial fibroblasts. Arthritis Rheum. 2004;50:1146–1155. [PubMed]
44. Lee HY, Jeon HS, Song EK, Han MK, Park SI, Lee SI, Yun HJ, Kim JR, Kim JS, Lee YC, Kim SI, Kim HR, Choi JY, Kang I, Kim HY, Yoo WH. CD40 ligation of rheumatoid synovial fibroblasts regulates RANKL-mediated osteoclastogenesis: evidence of NF-kappaB-dependent, CD40-mediated bone destruction in rheumatoid arthritis. Arthritis Rheum. 2006;54:1747–1758. [PubMed]
45. Toubi E, Shoenfeld Y. The role of CD40-CD154 interactions in autoimmunity and the benefit of disrupting this pathway. Autoimmunity. 2004;37:457–464. [PubMed]
46. Tan J, Town T, Saxe M, Paris D, Wu Y, Mullan M. Ligation of microglial CD40 results in p44/42 mitogen-activated protein kinase-dependent TNF-alpha production that is opposed by TGF-beta 1 and IL-10. Journal of Immunology. 1999;163:6614–6621. [PubMed]
47. Chen CR, Aliesky H, Pichurin PN, Nagayama Y, McLachlan SM, Rapoport B. Susceptibility rather than resistance to hyperthyroidism is dominant in a thyrotropin receptor adenovirus-induced animal model of Graves' disease as revealed by BALB/c-C57BL/6 hybrid mice. Endocrinology. 2004;145:4927–4933. [PubMed]