PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of jbcThe Journal of Biological Chemistry
 
J Biol Chem. 2012 August 17; 287(34): 28770–28778.
Published online 2012 June 14. doi:  10.1074/jbc.M112.376483
PMCID: PMC3436505

Expression of Proviral Integration Site for Moloney Murine Leukemia Virus 1 (Pim-1) Is Post-transcriptionally Regulated by Tristetraprolin in Cancer Cells*An external file that holds a picture, illustration, etc.
Object name is sbox.jpg

Abstract

The proviral integration site for Moloney murine leukemia virus 1 (Pim-1) is an oncogenic serine/threonine kinase that is up-regulated in several human cancers, facilitates cell cycle progression, and suppresses apoptosis. Previously, it has been reported that the Pim-1 3′-UTR plays important roles in the regulation of Pim-1 mRNA stability. However, the mechanisms explaining how Pim-1 mRNA stability is determined by its 3′-UTR are not well known. Here, we demonstrate that tristetraprolin (TTP) plays a critical role in the regulation of Pim-1 mRNA stability. Our results show that the level of Pim-1 expression is inversely correlated with TTP expression in human cancer cells. Pim-1 mRNA contains two AU-rich elements (ARE1 and ARE2) in the 3′-UTR. TTP bound to ARE2 and enhanced the decay of Pim-1 mRNA. Overexpression of TTP decreased Pim-1 expression and p21 and p27 phosphorylation and inhibited cell growth. Overexpression of Pim-1 cDNA without the 3′-UTR attenuated the inhibitory effects of TTP on p21 phosphorylation and cell growth. In addition, inhibition of p21 by siRNA attenuated the inhibitory effect of TTP on cell growth. Our results suggest that TTP post-transcriptionally down-regulates Pim-1 expression and that the overexpression of TTP may contribute to tumor suppression in part by down-regulating Pim-1 expression.

Keywords: Cancer, Oncogene, RNA-binding Protein, RNA Turnover, Serine/Threonine Protein Kinase, ARE-binding Protein, Pim-1, TTP, Cancer Cell, mRNA Stability

Introduction

The proto-oncogene Pim-1 is a serine/threonine Pim-1 kinase with multiple cellular functions, including roles in cell survival, proliferation, differentiation, apoptosis, and tumorigenesis (1, 2). Pim-1 kinase accomplishes its physiological activity through the phosphorylation of a wide range of cellular substrates (3), including Myc (4), p21Cip1/WAF1 (5, 6), and p27KIP1 (7). Pim-1 also synergizes with c-Myc in cell growth and transformation (8, 9). The expression of Pim-1 is induced by multiple cytokines, including SCF, G-CSF, IFN-γ, GM-CSF, IL-2, IL-3, IL-6, IL-7, and prolactin, through the activation of JAK/STAT signaling pathways (2), indicating that mutations in the signal transduction pathway through these receptors are responsible for the induction of Pim-1. It has been reported that Pim-1 is up-regulated in cells expressing constitutively active mutant STAT5 (10) or FLT3 (11). Overexpression of Pim-1 is linked to the development and progression of several types of cancer, including lymphoid and hematopoietic malignancies (12), prostate cancer (13), squamous cell carcinomas (14), gastric and colorectal carcinomas (15), pancreatic ductal adenocarcinoma (16), and bladder cancer (17). Recent studies demonstrated that knockdown of Pim (18), decreasing Pim-1 levels by use of a monoclonal antibody (19), and Pim-1 kinase inhibitors (20, 21) induced antiproliferative activity in tumor cells, supporting the idea that Pim-1 is a potential tumor target in the development of therapeutic agents (22). Pim-1 was originally identified as a preferential proviral integration site for Moloney murine leukemia virus 1 (23). Proviral insertion in the 3′-UTR of Pim-1 causes a significant increase in the Pim-1 mRNA level (24). It has been reported that the Pim-1 transcript contains the AUUUA destabilizing motif and has a short half-life due to this motif (25). The destabilizing function of the AU-rich element (AREs)4 is believed to be regulated by ARE-binding proteins (26). Tristetraprolin (TTP) is an ARE-binding protein that can recognize AREs and promote the decay of the transcripts (27, 28). TTP expression is diminished in many cancers (2931), which may contribute to an increase in the level of the transcripts containing AUUUA motifs in their 3′-UTRs.

In this study, we investigated the role of TTP in the post-transcriptional regulation of Pim-1 gene expression in human prostate cancer cells. Here, we report that the overexpression of TTP decreased the Pim-1 expression levels in LNCaP cells. TTP bound to the AUUUA motif in the 3′-UTR of Pim-1 mRNA and promoted the AUUUA motif-mediated degradation of the Pim-1 mRNA. Mutation in the ARE motif prevented the binding of TTP to this motif and the degradation of the luciferase gene containing the Pim-1 3′-UTR. Overexpression of TTP in LNCaP cells decreased the phosphorylation of Pim-1 substrates p21 and p27 and significantly inhibited the growth of cells, and transfection of Pim-1 cDNA without the 3′-UTR restored the phosphorylation of p21 and p27 and cell growth. Together, our findings suggest that TTP inhibits the expression of Pim-1 through interaction with the ARE motif in the Pim-1 3′-UTR and that limiting cellular TTP levels or mutation in the Pim-1 ARE motif can enhance the Pim-1 level, which may contribute to the development and progression of several types of cancers.

EXPERIMENTAL PROCEDURES

Cell Lines

The human cancer cell lines DU145, LNCaP (prostate carcinoma), and HeLa were purchased from the Korean Cell Line Bank (Seoul, Korea). A549, DU145, and LNCaP cells were cultured in RPMI 1640 medium, and HeLa cells were cultured in DMEM. All cell lines were supplemented with 10% FBS (WelGENE, Inc., Daegu, Korea) were maintained at 37 °C in a humidified atmosphere of 5% CO2.

Plasmids, siRNA, Transfections, and Dual-Luciferase Assay

The pcDNA6/V5-TTP construct has been described previously (32). Full-length human Pim-1 was amplified from the cDNA of LNCaP cells using PCR primers 5′-GGATCCACGATGCTCTTGTCCAA-3′ and 5′-CTCGAGAAAGGCTGCTATTTGCT-3′ (with restriction enzyme sites underlined). The PCR product was ligated into the BamHI/XhoI sites of pCMVT2B/FLAG (Stratagene) to generate pCMVT2B/FLAG-Pim-1. The cells were transfected with pcDNA6/V5-TTP or pCMVT2B/FLAG-Pim-1 using TurboFectTM in vitro transfection reagent (Fermentas, Hanover, MD).

siRNAs against human Pim-1 (sc-36225) and p21 (sc-29427) and control siRNA (scrambled siRNA; sc-37007) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). A549 cells were transfected with siRNA using LipofectamineTM RNAiMAX (Invitrogen). 48 h after transfection, cells were collected, and the level of Pim-1 mRNA and protein expression were analyzed by RT-PCR and Western blotting, respectively.

Two of the deletion mutants of the Pim-1 3′-UTR were PCR-amplified from the cDNA of LNCaP cells using Taq polymerase (Solgent, Daejeon, Korea) and the following primer sets: Frag-ARE1, 5′-CGCTCGAGCAGCCTTTCTGGCA-3′ and 5′-GCGGCCGCTCGGAAGAGGTGAC-3′; and Frag-ARE2, 5′-CGCTCGAGTGGAAGAGGCTACA-3′ and 5′-GCGGCCGCAACTGCTTTTCATA-3′ (with restriction enzyme sites underlined). The PCR products were inserted into the XhoI/NotI sites of the psiCHECK2 Renilla/firefly Dual-Luciferase expression vector (Promega, Madison, WI). Oligonucleotide containing AUUUA (Oligo-ARE2 WT, 5′-TCGAGCCTGGAGGTCAATGTTATGTATTTATTTATTTATTTATTTGGTTCCCTTCCTATTCCGC-3′ and 5′-GGCCGCGGAATAGGAAGGGAACCAAATAAATAAATAAATAAATACATAACATTGACCTCCAGGC-3′) and mutant oligonucleotides in which the AUUUA pentamers were substituted with AGCA (Oligo-ARE2 MUT, 5′-TCGAGCCTGGAGGTCAATGTTATGTAGCAGCAGCAGCATTTGGTTCCCTTCCTATTCCGC-3′ and 5′-GGCCGCGGAATAGGAAGGGAACCAAATGCTGCTGCTGCTACATAACATTGACCTCCAGGC-3′, with restriction enzyme sites underlined) in the Pim-1 mRNA 3′-UTR were synthesized at Integrated DNA Technologies (Coralville, IA). The oligonucleotides were ligated into the XhoI/NotI sites of the psiCHECK2 vector.

For luciferase assays, LNCaP and HeLa cells were cotransfected with various types of psiCHECK2-Pim-1 3′-UTR constructs and pcDNA6/V5-TTP using TurboFectTM in vitro transfection reagent. Transfected cells were lysed with lysis buffer (Promega) and mixed with luciferase assay reagent (Promega), and the chemiluminescence signal was measured in a SpectraMax L microplate (Molecular Devices). Firefly luciferase was normalized to Renilla luciferase in each sample.

Cell Cycle Analyses

Cells were harvested, washed twice in PBS at room temperature, and resuspended at 2 × 106 cells/ml in PBS. For propidium iodide staining, the washed cells were fixed overnight in pure ethanol at −20 °C and then treated according to the manufacturer's procedure (Molecular Probes). Cells were washed twice in PBS, resuspended in FACS buffer (PBS, 0.2% BSA, and 1% sodium azide), and analyzed using a FACSFlow cytometer (BD Biosciences).

Semiquantitative RT-PCR

DNase I-treated total RNA (3 μg) was reverse-transcribed using oligo(dT) and SuperScript II reverse transcriptase (Promega) according to the manufacturer's instructions. Semiquantitative RT-PCR was performed using the following primer sets: TTP, CGCTACAAGACTGAGCTAT and GAGGTAGAACTTGTGACAGA; Pim-1, TCTCATTAGATGGTGCTTGGCCCT and TGTGGAGGTGGATCTCAGCAGTTT; Pim-2, TGTCAGACTCAGTCACATGCCCA and ATCAATGAGTTTGGCACAGCCACG; Pim-3, TGCACCGCGACATTAAGGACGAAA and ACACCATATCGTAGAGAAGCACGC; and GAPDH, ATCTTCAAGCCATCCTGTGTGC and TGCGCTTGTCACATTTTTCTTG.

SDS-PAGE Analysis and Western Blotting

Proteins were resolved by SDS-PAGE, transferred onto nitrocellulose membranes (Whatman), and probed with the appropriate dilutions of the following antibodies: anti-human TTP (ab36558, Abcam); anti-V5 (20-783-70389, GenWay Biotech, Inc.); and anti-human Pim-1 (2409-1), anti-p21 (2990-1), anti-phospho-p21 (T3753), anti-p27 (2814-1), and anti-phospho-p27 (T3757) (Epitomics, Inc.). Immunoreactivity was detected using the SuperSignal West Pico chemiluminescent substrate (Pierce). Films were exposed at multiple time points to ensure that the images were not saturated.

RNA Kinetics

For the RNA kinetic analysis, we used actinomycin D and assessed expression of Pim-1 and luciferase mRNAs by quantitative real-time PCR (qRT-PCR). qRT-PCR was performed using the ABI StepOnePlusTM system by monitoring in real time the increase in fluorescence of Power SYBR Green Master Mix (Applied Biosystems). The specificity of each primer pair was confirmed by melting curve analysis and agarose gel electrophoresis. The same Pim-1 and GAPDH primer pairs as described above were used, with the following luciferase primer pair: qLuc, ACGTGCTGGACTCCTTCATC and GACACTCTCAGCATGGACGA.

EMSA

The biotinylated RNA probes for wild-type (5′-CCUGGAGGUCAAUGUUAUGUAUUUAUUUAUUUAUUUAUUUGGUUCCCUUCCUAUUCC-3′) and mutant (5′-CCUGGAGGUCAAUGUUAUGUAGCAGCAGCAGCAUUUGGUUCCCUUCCUAUUCC-3′) Pim-1 ARE2 were synthesized by ST Pharm Co., Ltd. (Seoul, Korea). A mutant RNA probe in which four AUUUA petamers were each substituted with AGCA was used as a negative control. Cytoplasmic extracts were prepared from LNCaP and HeLa cells non-transfected or transfected with pcDNA6/V5-TTP using NE-PER nuclear and cytoplasmic extraction reagent (Pierce). RNA EMSA was performed using the LightShift chemiluminescent EMSA kit (Pierce) according to the manufacturer's instructions. In brief, 50 fmol of biotinylated RNA was combined with 3 μg of cytoplasmic protein extract in binding buffer. For competition EMSA, a 50-fold excess of unlabeled wild-type or mutant RNA probe was added to the binding reaction. For the supershift EMSA, anti-V5 antibody, anti-human TTP antibody, or control antibody (I-5381, Sigma) was added to the reaction mixture. After the addition of antibodies, reaction mixtures were incubated overnight at 4 °C. The reaction mixtures were resolved on 5% nondenaturing polyacrylamide gels in 0.5× Tris borate/EDTA buffer. Gels were transferred to a nylon membrane (HybondTM-N+) in 0.5× Tris borate/EDTA at 70 V for 1 h at 4 °C. The RNAs were UV light-cross-linked to the membrane and detected using streptavidin-horseradish peroxidase binding and chemiluminescence.

For ribonucleoprotein precipitation assay, the biotinylated RNA probe-protein complexes in the reaction mixture were precipitated using streptavidin magnetic beads (656-01, Invitrogen). TTP proteins in the precipitated samples were detected by Western blot analysis using anti-V5 antibody.

Cell Proliferation

For the MTS cell proliferation assay, LNCaP cells were plated in triplicate at 5.0 × 104 cells/well in 96-well culture plates in RPMI 1640 medium. At the indicated times, CellTiter 96® AQueous One solution reagent (Promega) was added to each well according to the manufacturer's instructions. Absorbance at 490 nm was determined for each well using a Wallac 1420 VICTOR multilabel counter.

Statistics

For statistical comparisons, p values were determined using Student's t test

RESULTS

Pim-1 Expression Is Inversely Correlated with TTP Expression in Human Cancer Cell Lines

It has previously been reported that Pim-1 mRNA has a short half-life due to the presence of ARE motifs in the 3′-UTR (24, 33). TTP is an ARE-binding protein and enhances the degradation of ARE-containing transcripts (27, 28). Therefore, it is possible to speculate that the expression of Pim-1 is post-transcriptionally regulated by TTP. To confirm this hypothesis, we first examined TTP and Pim-1 expression levels by Western blotting in four human cancer cell lines: DU145, LNCaP, A549, and HeLa. The expression level of TTP was high in DU145 and A549 cells but extremely low in LNCaP and HeLa cells. In contrast, the level of Pim-1 expression in A549 and DU145 cells was low compared with that in LNCaP and HeLa cells (Fig. 1A). We next determined whether the overexpression of TTP could reduce the Pim-1 expression in LNCaP and HeLa cells. Cells were transfected with the TTP expression vector (pcDNA6/V5-TTP) or the pcDNA6/V5 empty vector as a negative control. Overexpression of TTP in LNCaP and HeLa cells was confirmed by RT-PCR and Western blot analysis (Fig. 1B and supplemental Fig. 1A). Overexpression of TTP significantly inhibited the level of Pim-1 mRNA expression (Fig. 1C and supplemental Fig. 1B). It has been reported that the Pim-1 gene encodes two isoforms of 34 and 44 kDa through the use of alternative translation initiation codons of the Pim-1 mRNA (34). Overexpression of TTP inhibited the levels of both Pim-1 isoforms (supplemental Fig. 1C). The Pim kinase family consists of three members: Pim-1, Pim-2, and Pim-3. To determine whether the expression of Pim-2 and Pim-3 is affected by TTP, we analyzed their expression levels by RT-PCR in LNCaP and HeLa cells transfected with pcDNA6/V5-TTP or pcDNA6/V5. overexpression of TTP did not affect the expression levels of both Pim-2 and Pim-3 (supplemental Fig. 1, D and E).

FIGURE 1.
Pim-1 expression is inversely correlated with TTP expression in human cancer cell lines. A, inverse correlation between TTP and Pim-1 levels in four human cancer cell lines. The levels of TTP and Pim-1 expression in four human cancer cell lines were determined ...

We also tested whether the down-regulation of TTP affects Pim-1 expression. For this purpose, we used A549 cells expressing high levels of TTP. A549 cells were transfected with siRNA against TTP to reduce the expression level of TTP. Although treatment with nonspecific siRNA (scrambled siRNA) did not induce a change in Pim-1 expression, down-regulation of TTP by siRNA significantly increased the level of Pim-1 expression (Fig. 1D). However, the inhibition of TTP by siRNA did not affect the levels of Pim-2 and Pim-3 (supplemental Fig. 1F). These results indicate that TTP down-regulates Pim-1 expression in human cancer cells.

TTP Destabilizes Pim-1 mRNA

To determine whether TTP-induced inhibition of Pim-1 expression resulted from changes in the stability of Pim-1 mRNA, the half-life of this mRNA was measured by qRT-PCR LNCaP and HeLa cells transfected with pcDNA6/V5-TTP (LNCaP/TTP and HeLa/TTP, respectively) or the pcDNA6/V5 control vector (LNCaP/pcDNA and HeLa/pcDNA, respectively). In the control LNCaP/pcDNA and HeLa/pcDNA cells, the half-life of Pim-1 mRNA was >1 h after actinomycin D treatment. However, in the TTP-overexpressing cells, the half-life was reduced to <30 min in LNCaP/TTP cells (Fig. 2A) and to <1 h in HeLa cells (supplemental Fig. 2A). These results indicate that the overexpression of TTP contributes to a decrease in Pim-1 levels through the destabilization of Pim-1 mRNA.

FIGURE 2.
TTP enhances the decay of Pim-1 by binding to the second ARE of the Pim-1 3′-UTR. A, TTP destabilizes Pim-1 mRNA. LNCaP cells were transfected with pcDNA6/V5-TTP or the pcDNA6/V5 control vector. Upper panel, the expression of TTP was determined ...

ARE2 in the Pim-1 3′-UTR Is Essential for the TTP Inhibitory Effect

The TTP protein regulates mRNA stability through binding to the AREs in the mRNA 3′-UTR (27, 31, 35). Consistent with a previous study (25), analysis of the 1335-bp-long human Pim-1 3′-UTR revealed the presence of two ARE motifs: ARE1 (AUUUA) and ARE2 (AUUUAUUUAUUUAUUUA) (Fig. 2B). To determine whether they are necessary for the TTP inhibitory effect, we used a luciferase reporter gene linked to the Pim-1 3′-UTR fragments containing the AREs (Frag-ARE1 or Frag-ARE2) in plasmid psiCHECK. When LNCaP cells were transfected to overexpress TTP (Fig. 2A), the half-life of the reporter gene linked to Frag-ARE2 was significantly decreased (<1 h) compared with the original reporter gene (>1 h) (Fig. 2E), and the luciferase activity of Frag-ARE2 was dramatically inhibited by 84% (Fig. 2C). However, Frag-ARE1 abrogated the effects of TTP on the half-life (>1 h) and activity (6% inhibition) of the reporter gene in LNCaP cells (Fig. 2, C and E). To determine whether the ARE2 motif in Frag-ARE2 is essential for the TTP inhibitory effect, we prepared the oligonucleotide Oligo-ARE2 WT (containing ARE2) and its deletion mutant, Oligo-ARE2 MUT (Fig. 2B). The ARE2 mutant prevented the TTP effects on the half-life and activity of the reporter gene (Fig. 2, D and E), strongly suggesting that Pim-1 ARE2 is involved in the TTP inhibitory activity. ARE2 of Pim-1 was also responsible for the TTP inhibitory effect in HeLa cells (supplemental Fig. 2, B and C).

TTP Interacts with ARE2 in the 3′-UTR of Pim-1

To determine whether TTP interacts with the ARE2 in the Pim-1 3′-UTR, cytoplasmic extracts were prepared from LNCaP or HeLa cells transfected with pcDNA6/V5-TTP to overexpress TTP and incubated with a biotinylated RNA probe containing wild-type or mutant ARE2 of Pim-1. The biotinylated RNA probe-protein complexes were precipitated with streptavidin-agarose, and the presence of TTP in the precipitates was determined by Western blotting using anti-V5 antibody. Although a TTP band was observed in the precipitated samples obtained using wild-type Pim-1 ARE2, it was not detected in the samples using mutant Pim-1 ARE2 (supplemental Fig. 3, A and B). These results demonstrate that TTP interacts specifically with Pim-1 ARE2. To confirm the interaction between TTP with Pim-1 ARE2, RNA EMSA was conducted. When RNA EMSA was conducted using the wild-type Pim-1 ARE2 probe, a dominant probe-protein complex was observed. However, mutation of Pim-1 ARE2 prevented the formation of this complex. The complex was reduced, and a high molecular weight antibody complex was formed by preincubation of the reaction mixture with anti-V5 antibody but not with control antibody (Fig. 2F and supplemental Fig. 4A). To demonstrate the association between endogenous TTP and Pim-1 ARE2, cytoplasmic extracts were prepared from non-transfected LNCaP or HeLa cells. When wild-type Pim-1 ARE2 was mixed with cytoplasmic extracts from LNCaP or HeLa cells, a dominant probe-protein complex was observed (Fig. 2G and supplemental Fig. 4B). However, the mutant Pim-1 ARE2 probe failed to form the complex. In addition, the complex did not compete with an excess of the unlabeled mutant Pim-1 ARE2 probe but did compete with an excess of the unlabeled wild-type Pim-1 ARE probe, demonstrating that the complex is Pim-1 ARE2-specific (supplemental Fig. 4, C and D). Formation of the Pim-1 ARE2 probe-protein complex was reduced by preincubation of the reaction mixture with anti-TTP antibody but not with control antibody (Fig. 2G and supplemental Fig. 4, B–D). These data suggest that the inhibition of Pim-1 expression requires the formation of a Pim-1 ARE2-dependent complex containing TTP.

Pim-1 Mediates the Inhibitory Effect of TTP on the Growth and Cell Cycle of LNCaP Cells

We next determined the effect of TTP overexpression on the proliferation of LNCaP cells. We transfected LNCaP cells with pcDNA6/V5-TTP (LNCaP/TTP) or pcDNA6/V5 (LNCaP/pcDNA), and the cell cycle and the growth rates were compared. Overexpression of TTP and down-regulation of Pim-1 were confirmed by Western blotting (Fig. 3A, upper panel). The cell cycle of LNCaP cells was arrested at G1 phase (supplemental Fig. 5), and the growth of LNCaP cells was significantly suppressed by the overexpression of TTP (Fig. 3A, lower panel). The inhibition of Pim-1 by siRNA treatment (Fig. 3B, upper panel) resulted in suppression of cell growth to a level similar to that achieved by TTP overexpression (Fig. 3B, lower panel). To determine whether the TTP-induced inhibition of cell growth was mediated by a reduction in Pim-1 levels, we transfected LNCaP cells with the Pim-1 cDNA, in which expression is not affected by TTP because the transcript does not contain the Pim-1 3′-UTR. Overexpression of Pim-1 (Fig. 3A, upper panel) increased the growth of LNCaP/TTP cells, which exceeded that of LNCaP/pcDNA control cells (Fig. 3A, lower panel). It has previously been reported that the ectopic expression of Pim-1 increases cell mitogenesis, independent of growth factors (36). We also found that the overexpression of Pim-1 increased the growth of LNCaP cells (Fig. 3C). These results show that the level of Pim-1 expression correlates with the growth of LNCaP cells and that TTP suppresses cell growth through the down-regulation of Pim-1.

FIGURE 3.
Pim-1 mediates the inhibitory effect of TTP on cell growth. LNCaP cells were transfected with pcDNA6/V5-TTP and pCMVT2B/FLAG-Pim-1 (A), siRNA against Pim-1 (B), or pCMVT2B/FLAG-Pim-1 (C). The expression levels of TTP and Pim-1 were determined by Western ...

Inhibition of Pim-1 Target Protein p21 by siRNA Attenuates the Inhibitory Effect of TTP on Cell Growth

It has been reported that Pim-1 suppresses cell growth through the phosphorylation of p21 (5, 6). To determine the effects of TTP overexpression on the phosphorylation of p21, we analyzed the expression level and phosphorylation of p21 in LNCaP/TTP and LNCaP/pcDNA cells. Although the overexpression of TTP increased the total protein level of p21, it decreased phosphorylation (Fig. 4A). Overexpression of Pim-1 cDNA in LNCaP/TTP cells decreased the total protein level of p21 and increased its phosphorylation (Fig. 4B), indicating that changes in the levels of total protein and phosphorylation of p21 in LNCaP cells are caused by the reduced expression of Pim-1. p27 is another Pim-1 target (7), and we found that TTP overexpression decreased its phosphorylation (Fig. 4A), but the overexpression of Pim-1 cDNA increased its phosphorylation (Fig. 4B). In the case of p27, the overexpression of TTP or Pim-1 cDNA did not affect the total protein level of p27 (Fig. 4, A and B). To determine whether the TTP-induced inhibition of cell growth is mediated by the increase in p21 levels, we analyzed the growth of LNCaP/TTP cells after the knockdown of p21 by siRNA treatment. The inhibition of p21 by siRNA treatment (Fig. 4C) restored the growth of LNCaP/TTP cells to a level similar to that of LNCaP/pcDNA control cells (Fig. 4D). These results suggest that the inhibitory effect of TTP on LNCaP cell growth is mediated by the Pim-1/p21 pathway.

FIGURE 4.
Inhibition of p21, a Pim-1 target gene, attenuates the inhibitory effects of TTP on cell growth. A, overexpression of TTP decreases the phosphorylation of p21 and p27. LNCaP cells were transfected with pcDNA6/V5-TTP or the pcDNA6/V5 control vector. The ...

DISCUSSION

The expression of Pim-1 is up-regulated in many human tumors and is correlated with the enhanced metastatic potential of the tumor (37). Hence, the mechanisms for the down-regulation of Pim-1 gene expression have been the subject of substantial interest. It has previously been reported that the AUUUA motif in the Pim-1 3′-UTR plays an important role in the destabilization of Pim-1 mRNA (25) and that proviral insertion in the Pim-1 3′-UTR results in high levels of Pim-1 mRNA (24). In this study, we demonstrated that an ARE-binding protein (TTP) binds to the ARE motif and enhances the decay of the Pim-1 transcript. Mutation of the AUUUA motif in the Pim-1 3′-UTR abrogates the binding of TTP to the Pim-1 3′-UTR and the TTP-induced decay of the Pim-1 3′-UTR-containing luciferase gene. Based on our results, it is possible to speculate that proviral insertion in the Pim-1 3′-UTR may disrupt the AUUUA motif, resulting in the inhibition of TTP binding to the Pim-1 3′-UTR and an increase in the level of Pim-1.

TTP is an ARE-binding protein that promotes the degradation of ARE-containing mRNA (27, 31, 35). Given previous reports that TTP expression is significantly decreased in many cancers (29), it is possible to speculate that the reason for the enhanced level of Pim-1 in tumor cells, which gives cells a competitive growth advantage, may result from the low level expression of TTP. In support of this hypothesis, we found that the inhibition of TTP by siRNA significantly increased the Pim-1 expression levels in cancer cells in the absence of added growth factors. In addition, restoring TTP expression suppressed the expression of Pim-1 and cell proliferation. The expression of Pim-1 cDNA without the 3′-UTR restored the growth of cells overexpressing TTP, indicating that the inhibitory effect of TTP on cell growth is mediated by the down-regulation of Pim-1.

It is believed that the oncogenic and prosurvival potential of the Pim-1 kinase contributes to tumorigenesis and promotes drug resistance in prostate cancer (1, 2). These findings are important because they provide evidence that the development of effective cancer treatments may be possible by targeting Pim-1 kinase (22). Several small compounds inhibiting Pim-1 activity have been reported to exhibit antiproliferative activity in human tumor cells (3840). In addition, the inhibition of Pim-1 expression by Pim-1 mAb treatment has been reported to suppress tumor growth (19). In this study, we found that the overexpression of TTP significantly reduced the Pim-1 expression levels and growth of cancer cells. Our results indicate that an inducer of TTP expression could be a candidate for a chemotherapeutic drug. Such molecules may potentially enable the inhibition of prostate cancer growth mediated by Pim-1 without severe physiological side effects because normal cells already express a high level of TTP.

Cell cycle regulatory proteins p21 and p27 have been reported to be substrates of Pim-1 (57). Consistent with previous reports, we found that the down-regulation of Pim-1 by TTP led to decreased p21 and p27 phosphorylation. However, although the phosphorylation of p21 by Pim-1 has been reported to stabilize the p21 protein and to increase p21 protein levels (5, 6), we were surprised to find that the TTP-mediated reduction in p21 phosphorylation increased p21 protein levels. The inhibition of p21 by siRNA restored the growth of TTP-overexpressing cells, indicating that the inhibitory effect of TTP on tumor cell growth is mediated by an increase in the level of p21. There has been an ongoing controversy about whether the phosphorylation of Thr-145 or Ser-146 influences the stability of p21 (41, 42). It was found that PKC and Akt can phosphorylate and promote p21 degradation (41). However, it was also found that Akt phosphorylation of the same site results in the stabilization of p21 (42). Besides phosphorylation, association with other cellular proteins is also an important factor that regulates p21 protein stability and, therefore, protein levels. For example, the binding of cyclin D1 (43) or the chaperone Hsp90 and WISp3 (44) to p21 dramatically stabilizes it. Further studies are needed to determine whether such interacting proteins are required for the stabilization of p21 protein phosphorylated by Pim-1.

In conclusion, we have demonstrated that TTP plays an important role in the post-transcriptional regulation of Pim-1 gene expression. We determined that Pim-1 contains an ARE in its mRNA 3′-UTR and that TTP destabilizes its mRNA by binding to the Pim-1 mRNA ARE. As a result, TTP-induced down-regulation of Pim-1 leads to a decrease in the phosphorylation of p21 and p27 but increases the protein level of p21, which contributes to the suppression of cancer cell growth. This study therefore provides a molecular mechanism for the post-transcriptional regulation of Pim-1 gene expression. Because down-regulation of TTP is among the key factors that increase Pim-1 expression in many cancer cells, it is conceivable that increasing TTP expression through a specific drug might represent a method for the treatment of cancer in humans.

Supplementary Material

Supplemental Data:

*This work was supported by Korean Research Foundation Grants NRF-2008-C00249, BRL-2009-0087350, 2009-0070260, 2010-0023905, and 2011-0030746 funded by the Korean Government (MOEHRD) and Korean Health 21 R&D Project Grant A101086 from the Ministry of Health and Welfare, Korea.

An external file that holds a picture, illustration, etc.
Object name is sbox.jpgThis article contains supplemental Figs. 1–5.

4The abbreviations used are:

ARE
AU-rich element
TTP
tristetraprolin
qRT-PCR
quantitative real-time PCR
MTS
3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium.

REFERENCES

1. Wang Z., Bhattacharya N., Weaver M., Petersen K., Meyer M., Gapter L., Magnuson N. S. (2001) Pim-1: a serine/threonine kinase with a role in cell survival, proliferation, differentiation, and tumorigenesis. J. Vet. Sci. 2, 167–179 [PubMed]
2. Bachmann M., Möröy T. (2005) The serine/threonine kinase Pim-1. Int. J. Biochem. Cell Biol. 37, 726–730 [PubMed]
3. Brault L., Gasser C., Bracher F., Huber K., Knapp S., Schwaller J. (2010) PIM serine/threonine kinases in the pathogenesis and therapy of hematologic malignancies and solid cancers. Haematologica 95, 1004–1015 [PubMed]
4. Zhang Y., Wang Z., Li X., Magnuson N. S. (2008) Pim kinase-dependent inhibition of c-Myc degradation. Oncogene 27, 4809–4819 [PubMed]
5. Wang Z., Bhattacharya N., Mixter P. F., Wei W., Sedivy J., Magnuson N. S. (2002) Phosphorylation of the cell cycle inhibitor p21Cip1/WAF1 by Pim-1 kinase. Biochim. Biophys. Acta 1593, 45–55 [PubMed]
6. Zhang Y., Wang Z., Magnuson N. S. (2007) Pim-1 kinase-dependent phosphorylation of p21Cip1/WAF1 regulates its stability and cellular localization in H1299 cells. Mol. Cancer Res. 5, 909–922 [PubMed]
7. Morishita D., Katayama R., Sekimizu K., Tsuruo T., Fujita N. (2008) Pim kinases promote cell cycle progression by phosphorylating and down-regulating p27Kip1 at the transcriptional and post-transcriptional levels. Cancer Res. 68, 5076–5085 [PubMed]
8. van Lohuizen M., Verbeek S., Krimpenfort P., Domen J., Saris C., Radaszkiewicz T., Berns A. (1989) Predisposition to lymphomagenesis in pim-1 transgenic mice: cooperation with c-myc and N-myc in murine leukemia virus-induced tumors. Cell 56, 673–682 [PubMed]
9. Zippo A., De Robertis A., Serafini R., Oliviero S. (2007) PIM-1-dependent phosphorylation of histone H3 at serine 10 is required for MYC-dependent transcriptional activation and oncogenic transformation. Nat. Cell Biol. 9, 932–944 [PubMed]
10. Nosaka T., Kawashima T., Misawa K., Ikuta K., Mui A. L., Kitamura T. (1999) STAT5 as a molecular regulator of proliferation, differentiation, and apoptosis in hematopoietic cells. EMBO J. 18, 4754–4765 [PubMed]
11. Kim K. T., Baird K., Ahn J. Y., Meltzer P., Lilly M., Levis M., Small D. (2005) Pim-1 is up-regulated by constitutively activated FLT3 and plays a role in FLT3-mediated cell survival. Blood 105, 1759–1767 [PubMed]
12. Meeker T. C., Nagarajan L., ar-Rushdi A., Croce C. M. (1987) Cloning and characterization of the human PIM-1 gene: a putative oncogene related to the protein kinases. J. Cell. Biochem. 35, 105–112 [PubMed]
13. Dhanasekaran S. M., Barrette T. R., Ghosh D., Shah R., Varambally S., Kurachi K., Pienta K. J., Rubin M. A., Chinnaiyan A. M. (2001) Delineation of prognostic biomarkers in prostate cancer. Nature 412, 822–826 [PubMed]
14. Chiang W. F., Yen C. Y., Lin C. N., Liaw G. A., Chiu C. T., Hsia Y. J., Liu S. Y. (2006) Up-regulation of a serine/threonine kinase proto-oncogene Pim-1 in oral squamous cell carcinoma. Int. J. Oral Maxillofac. Surg. 35, 740–745 [PubMed]
15. Warnecke-Eberz U., Bollschweiler E., Drebber U., Metzger R., Baldus S. E., Hölscher A. H., Mönig S. (2009) Prognostic impact of protein overexpression of the proto-oncogene PIM-1 in gastric cancer. Anticancer Res. 29, 4451–4455 [PubMed]
16. Xu D., Allsop S. A., Witherspoon S. M., Snider J. L., Yeh J. J., Fiordalisi J. J., White C. D., Williams D., Cox A. D., Baines A. T. (2011) The oncogenic kinase Pim-1 is modulated by K-Ras signaling and mediates transformed growth and radioresistance in human pancreatic ductal adenocarcinoma cells. Carcinogenesis 32, 488–495 [PMC free article] [PubMed]
17. Guo S., Mao X., Chen J., Huang B., Jin C., Xu Z., Qiu S. (2010) Overexpression of Pim-1 in bladder cancer. J Exp. Clin. Cancer Res. 29, 161. [PMC free article] [PubMed]
18. Adam M., Pogacic V., Bendit M., Chappuis R., Nawijn M. C., Duyster J., Fox C. J., Thompson C. B., Cools J., Schwaller J. (2006) Targeting PIM kinases impairs survival of hematopoietic cells transformed by kinase inhibitor-sensitive and kinase inhibitor-resistant forms of Fms-like tyrosine kinase 3 and BCR/ABL. Cancer Res. 66, 3828–3835 [PubMed]
19. Hu X. F., Li J., Vandervalk S., Wang Z., Magnuson N. S., Xing P. X. (2009) PIM-1-specific mAb suppresses human and mouse tumor growth by decreasing PIM-1 levels, reducing Akt phosphorylation, and activating apoptosis. J. Clin. Invest. 119, 362–375 [PMC free article] [PubMed]
20. Blanco-Aparicio C., Collazo A. M., Oyarzabal J., Leal J. F., Albarán M. I., Lima F. R., Pequeño B., Ajenjo N., Becerra M., Alfonso P., Reymundo M. I., Palacios I., Mateos G., Quiñones H., Corrionero A., Carnero A., Pevarello P., Lopez A. R., Fominaya J., Pastor J., Bischoff J. R. (2011) Pim-1 kinase inhibitor ETP-45299 suppresses cellular proliferation and synergizes with PI3K inhibition. Cancer Lett. 300, 145–153 [PubMed]
21. Lin Y. W., Beharry Z. M., Hill E. G., Song J. H., Wang W., Xia Z., Zhang Z., Aplan P. D., Aster J. C., Smith C. D., Kraft A. S. (2010) A small molecule inhibitor of Pim protein kinases blocks the growth of precursor T-cell lymphoblastic leukemia/lymphoma. Blood 115, 824–833 [PubMed]
22. Amaravadi R., Thompson C. B. (2005) The survival kinases Akt and Pim as potential pharmacological targets. J. Clin. Invest. 115, 2618–2624 [PMC free article] [PubMed]
23. Cuypers H. T., Selten G., Quint W., Zijlstra M., Maandag E. R., Boelens W., van Wezenbeek P., Melief C., Berns A. (1984) Murine leukemia virus-induced T-cell lymphomagenesis: integration of proviruses in a distinct chromosomal region. Cell 37, 141–150 [PubMed]
24. Selten G., Cuypers H. T., Boelens W., Robanus-Maandag E., Verbeek J., Domen J., van Beveren C., Berns A. (1986) The primary structure of the putative oncogene pim-1 shows extensive homology with protein kinases. Cell 46, 603–611 [PubMed]
25. Wingett D., Reeves R., Magnuson N. S. (1991) Stability changes in pim-1 proto-oncogene mRNA after mitogen stimulation of normal lymphocytes. J. Immunol. 147, 3653–3659 [PubMed]
26. Shyu A. B., Wilkinson M. F. (2000) The double lives of shuttling mRNA-binding proteins. Cell 102, 135–138 [PubMed]
27. Blackshear P. J. (2002) Tristetraprolin and other CCCH tandem zinc-finger proteins in the regulation of mRNA turnover. Biochem. Soc. Trans. 30, 945–952 [PubMed]
28. Chen C. Y., Gherzi R., Ong S. E., Chan E. L., Raijmakers R., Pruijn G. J., Stoecklin G., Moroni C., Mann M., Karin M. (2001) AU-binding proteins recruit the exosome to degrade ARE-containing mRNAs. Cell 107, 451–464 [PubMed]
29. Brennan S. E., Kuwano Y., Alkharouf N., Blackshear P. J., Gorospe M., Wilson G. M. (2009) The mRNA-destabilizing protein tristetraprolin is suppressed in many cancers, altering tumorigenic phenotypes and patient prognosis. Cancer Res. 69, 5168–5176 [PMC free article] [PubMed]
30. Young L. E., Sanduja S., Bemis-Standoli K., Pena E. A., Price R. L., Dixon D. A. (2009) The mRNA-binding proteins HuR and tristetraprolin regulate cyclooxygenase-2 expression during colon carcinogenesis. Gastroenterology 136, 1669–1679 [PMC free article] [PubMed]
31. Lee H. H., Son Y. J., Lee W. H., Park Y. W., Chae S. W., Cho W. J., Kim Y. M., Choi H. J., Choi D. H., Jung S. W., Min Y. J., Park S. E., Lee B. J., Cha H. J., Park J. W. (2010) Tristetraprolin regulates expression of VEGF and tumorigenesis in human colon cancer. Int. J. Cancer 126, 1817–1827 [PubMed]
32. Lee H. H., Vo M. T., Kim H. J., Lee U. H., Kim C. W., Kim H. K., Ko M. S., Lee W. H., Cha S. J., Min Y. J., Choi D. H., Suh H. S., Lee B. J., Park J. W., Cho W. J. (2010) Stability of the LATS2 tumor suppressor gene is regulated by tristetraprolin. J. Biol. Chem. 285, 17329–17337 [PMC free article] [PubMed]
33. Domen J., Von Lindern M., Hermans A., Breuer M., Grosveld G., Berns A. (1987) Comparison of the human and mouse PIM-1 cDNAs: nucleotide sequence and immunological identification of the in vitro synthesized PIM-1 protein. Oncogene Res. 1, 103–112 [PubMed]
34. Saris C. J., Domen J., Berns A. (1991) The pim-1 oncogene encodes two related serine/threonine protein kinases by alternative initiation at AUG and CUG. EMBO J. 10, 655–664 [PubMed]
35. Carballo E., Lai W. S., Blackshear P. J. (1998) Feedback inhibition of macrophage tumor necrosis factor-α production by tristetraprolin. Science 281, 1001–1005 [PubMed]
36. Lilly M., Kraft A. (1997) Enforced expression of the Mr 33,000 Pim-1 kinase enhances factor-independent survival and inhibits apoptosis in murine myeloid cells. Cancer Res. 57, 5348–5355 [PubMed]
37. Shah N., Pang B., Yeoh K. G., Thorn S., Chen C. S., Lilly M. B., Salto-Tellez M. (2008) Potential roles for the PIM-1 kinase in human cancer–a molecular and therapeutic appraisal. Eur. J. Cancer 44, 2144–2151 [PubMed]
38. Bullock A. N., Debreczeni J. E., Fedorov O. Y., Nelson A., Marsden B. D., Knapp S. (2005) Structural basis of inhibitor specificity of the human proto-oncogene proviral insertion site in Moloney murine leukemia virus (PIM-1) kinase. J. Med. Chem. 48, 7604–7614 [PubMed]
39. Cheney I. W., Yan S., Appleby T., Walker H., Vo T., Yao N., Hamatake R., Hong Z., Wu J. Z. (2007) Identification and structure-activity relationships of substituted pyridones as inhibitors of Pim-1 kinase. Bioorg. Med. Chem. Lett. 17, 1679–1683 [PubMed]
40. Holder S., Zemskova M., Zhang C., Tabrizizad M., Bremer R., Neidigh J. W., Lilly M. B. (2007) Characterization of a potent and selective small molecule inhibitor of the PIM-1 kinase. Mol. Cancer Ther. 6, 163–172 [PubMed]
41. Scott M. T., Ingram A., Ball K. L. (2002) PDK1-dependent activation of atypical PKC leads to degradation of the p21 tumor modifier protein. EMBO J. 21, 6771–6780 [PubMed]
42. Li Y., Dowbenko D., Lasky L. A. (2002) AKT/PKB phosphorylation of p21Cip/WAF1 enhances protein stability of p21Cip/WAF1 and promotes cell survival. J. Biol. Chem. 277, 11352–11361 [PubMed]
43. Coleman M. L., Marshall C. J., Olson M. F. (2003) Ras promotes p21Waf1/Cip1 protein stability via a cyclin D1-imposed block in proteasome-mediated degradation. EMBO J. 22, 2036–2046 [PubMed]
44. Jascur T., Brickner H., Salles-Passador I., Barbier V., El Khissiin A., Smith B., Fotedar R., Fotedar A. (2005) Regulation of p21WAF1/CIP1 stability by WISp39, a Hsp90-binding TPR protein. Mol. Cell 17, 237–249 [PubMed]

Articles from The Journal of Biological Chemistry are provided here courtesy of American Society for Biochemistry and Molecular Biology