PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
J Neurosci. Author manuscript; available in PMC 2013 February 8.
Published in final edited form as:
PMCID: PMC3428958
NIHMSID: NIHMS400324

Rabconnectin3α promotes stable activity of the H+-pump on synaptic vesicles in hair cells

Abstract

Acidification of synaptic vesicles relies on the Vacuolar-type ATPase (V-ATPase), which provides the electrochemical driving force for neurotransmitter exchange. The regulatory mechanisms that ensure assembly of the V-ATPase holoenzyme on synaptic vesicles are unknown. Rabconnectin3α (Rbc3α) is a potential candidate for regulation of V-ATPase activity because of its association with synaptic vesicles and its requirement for acidification of intracellular compartments. Here, we provide the first evidence for a role of Rbc3α in synaptic vesicle acidification and neurotransmission. In this study, we characterized mutant alleles of rbc3α isolated from a large-scale screen for zebrafish with auditory/vestibular defects. We show that Rbc3α is localized to basal regions of hair cells where synaptic vesicles are present. To determine whether Rbc3α regulates V-ATPase activity, we examined the acidification of synaptic vesicles and localization of the V-ATPase in hair cells. In contrast to wild-type hair cells, we observed that synaptic vesicles had elevated pH and a cytosolic subunit of the V-ATPase was no longer enriched in synaptic regions of mutant hair cells. As a consequence of defective acidification of synaptic vesicles, afferent neurons in rbc3α mutants had reduced firing rates and reduced accuracy of phase-locked action potentials in response to mechanical stimulation of hair cells. Collectively, our data suggest that Rbc3α modulates synaptic transmission in hair cells by promoting V-ATPase activity in synaptic vesicles.

Keywords: hair cells, Rabconnectin, V-ATPase, acidification, synaptic vesicles

Introduction

The hair cell is the sensory mechanoreceptor of the auditory and vestibular organs, as well as the lateral-line organ in fish and amphibians. Hair cells transduce stimuli such as sound, head movements, and changes in water currents into electrical signals. Depolarization of the hair-cell receptor potential then results in the release of synaptic vesicles containing the neurotransmitter glutamate at the basal end of the cells. Forward genetic screens for hearing and balance mutants in zebrafish and mouse knock-outs have identified several of the molecules important for synaptic transmission in hair cells (Nicolson et al., 1998; Leibovici et al., 2008; Obholzer et al., 2008; Trapani et al., 2009). One such protein is vesicular glutamate transporter 3 (Vglut3), which loads neurotransmitter into synaptic vesicles by exchanging protons for glutamate (Fremeau et al., 2002; Obholzer et al., 2008; Ruel et al., 2008; Seal et al., 2008). Protons are concentrated into the lumen of the synaptic vesicle by the V-ATPase, and as a result, robust V-ATPase activity is critical for proper synaptic transmission (Schenk et al., 2009; Goh et al., 2011). However, relatively little is known about how synaptic vesicles acquire the V-ATPase in its fully assembled and active state.

The V-ATPase holoenzyme is a complex that contains a cytosolic (V1) sector and a membrane (V0) sector that are each composed of multiple subunits. The cytosolic and membrane sectors are largely pre-assembled and can reversibly disassociate (Smardon et al., 2002, Trombetta et al., 2003; Smardon and Kane, 2007). Regulated assembly of the V-ATPase holoenzyme is an efficient mechanism for modulating V-ATPase activity (Toei et al., 2010). Whether regulated holoenzyme assembly also shapes V-ATPase activity on synaptic vesicles is unknown.

Rbc3α is a potential candidate for regulating the assembly of the V-ATPase holoenzyme on synaptic vesicles for several reasons. Recent work has shown that the Rbc3 complex (composed of Rbc3α and β) is essential for acidification of intracellular compartments in Drosophila ovarian tissue and mammalian cell-lines (Yan et al., 2009; Sethi et al., 2010). Moreover, Rbc3β biochemically interacts with insect V1 subunits E and H, as evidenced by co-immunoprecipitation experiments (Yan et al., 2009). Prior evidence also supports a role in synaptic vesicle function for the Rbc3 complex: Rbc3α and β subunits were originally identified from purified synaptic vesicle fractions and antibodies against Rbc3α labeled synaptic regions of the rat hippocampus (Nagano et al., 2002; Kawabe et al., 2003). Taken together, these data raise the possibility that the Rbc3 complex modulates V-ATPase activity on synaptic vesicles by promoting holoenzyme assembly.

In this study, we examined the morphology and activity of hair-cell synapses of rbc3α mutant zebrafish to determine the function of Rbc3α in hair cells. Our observations indicate that rbc3α mutant hair cells have overall normal synaptic structure, but synaptic vesicles fail to fully acidify presumably due to fewer assembled V-ATPase holoenzymes. We propose that Rbc3α plays a role in modulating vesicular V-ATPase activity in hair cells that ultimately affects proper synaptic transmission that is essential for both auditory and vestibular function.

Materials and Methods

Fish Strains

Wild-type, mutant, and transgenic larvae were maintained in both Tübingen and Top Long Fin strains. Larvae were kept at 28.5 °C in the dark in E3 buffer during development. Mutants were identified in a large-scale ethyl-N-nitrosourea screen (Tübingen 2000 Screen Consortium). Both sexes were examined.

Molecular Biology

For determination of alleles, mRNA was extracted from day 5 zebrafish larvae by standard methods. First-strand cDNA was generated from transcripts with the SuperScript III First-Strand Synthesis System (Invitrogen). Partial rbc3α ds-cDNAs were generated by PCR using primers targeting first (ATG-4551bp) and second (4222-9105bp) halves of the predicted full-length transcript (forward primer 5|- atgcatctgcaccaggtgctgacggg-3|; reverse primer 5-cacctgtgcatgttcggg -3; forward primer 5|- gttgccggtcgagatggtggacg -3; reverse primer 5- ttagaggatctggaatatactggccg-3) and were sequenced with internal primers.

Full-length rbc3α (Genbank accession number is pending) was generated by TA cloning both halves of ds-cDNAs into TOPO 2.1 PCR vectors (Invitrogen), restriction-enzyme digestion with AgeI and NotI enzymes (NEB), and re-ligation of fragments with T4 DNA Ligase (NEB).

Expression constructs were generated with Multisite Gateway Technology (Invitrogen, Kwan et al., 2007). In brief, full-length rbc3α (ATG-9105) was PCR amplified with Gateway compatible attB sites (forward primer 5|-ggggacagctttcttgtacaaagtggccatgcatctgcaccaggtgctgacggg -3; reverse primer 5-ggggacaactttgtataataaagttgcttagaggatctggaatatactggccg -3) and recombined to generate 3′entry vector p3E-rbc3α, then p3E-rbc3α was recombined with p5E-6.5myosin6b minimal promoter (Mo and Nicolson, 2011), pME-GFP, and the pDestination 395 vector to generate −6.5kb_myosin6b:gfp-rbc3α;clcm2:gfp. In a similar manner, atp6v1aa contained in the pME18S-FL3 (ATCC) was PCR amplified with primers (forward primer 5|-ggggacaagtttgtacaaaaaagcaggctccgccaccatggatttttccaagctgcctaagatccga -3|; reverse primer 5-ggggaccactttgtacaagaaagctgggtcgtcttccagggtgcggaaggaattctg-3) and recombined with pME. atp6v0a1 contained in the pME18S-FL3 (ATCC) was PCR amplified with primers (forward primer 5|-ggggacagctttcttgtacaaagtggcgatgggggagctgtttcgcagcgagg-3|; reverse primer 5-ggggacaactttgtataataaagttgcttattcttcagacttgccatccaga-3) and recombined with p3E. pME-atp6v1aa and p3E-atp6v0a1 cloned to generate −6.5myosin6b:atp6v1aa-GFP,clcm2:GFP and −6.5myosin6b:GFP-atp6v0a1,clcm2:GFP constructs, respectively. Constructs were then micro-injected (50 ng/μl) along with Tol2 transposase mRNA at the one-cell stage of embryos.

Generation of transgenic strains

Rbc3α+/Q850X animals were in-crossed and microinjected with Tol2 mRNA and −6.5myosin6b:atp6v1aa-gfp;clcm2:gfp. F0 animals were screened and crossed to rbc3αQ850X to generate F1 transgenic animals Tg(−6.5myosin6b:atp6v1aa-gfp,clcm2:gfp);rbc3αQ850X.

In situ hybridization

Digoxygenin-labeled riboprobes were generated with the DIG Labeling Kit (Roche) from a previously published rbc3α probe CB952, (Thisse et al., 2001). In situ hybridization was performed as described previously (Söllner et al., 2004) with 200 ng of probe. Larvae at 72 hours post fertilization (hpf) were imaged as whole-mounts. Larvae at 4 days post fertilization (dpf) were cryosectioned into 12 μm slices using standard methods. Larvae were viewed on a Zeiss Axio bright-field microscope (Oberkochen) using either a 10X or 20X dry lens objective. Images were captured with an AxioCam MRc5 color digital camera using Axiovision software and exported as TIFF files to Adobe Photoshop or ImageJ (US National Institutes of Health) for analysis.

RT-PCR of neuromasts and yolk epithelium

Neuromasts along the head and trunk of Tübingen wild-type larvae were extracted by a suction pipette and aspirated into cold lysis buffer from Cells-to-cDNA kit II (Ambion). Overlying yolk skin cells were dissected by fine tweezers. First strand cDNA synthesis was performed using Sprint-RT Complete-Oligo(dT) 18 kit (Clontech Laboratories). cDNAs were amplified by PCR using ChoiceTaq Blue Master Mix (Denville Scientific) with primers pairs targeting cadherin23 (forward 5′ cagtagttgcaggctccaca 3′ and reverse 5′ tgggctgctaactccagatt 3′), rbc3α bp 8726-9105 (forward 5′ gcagcagttgatcatcacgggcggcaggaaggg 3′ and reverse 5′ gaggatctggaatatactggccggaatgttgtagcggtcggg 3′), rbc3α bp 8913-3′UTR (forward 5′ catggcctcatgcactcattcagcacc 3′ and reverse 5′ cgtggggcgaggtgcgagata 3′), or atp6v1aa bp 748-1299 (forward 5′ ggagccttcggctgtggcaag 3′ and reverse 5′ ccagaacacctgcacaatac 3′). Water was used as a negative template control.

Video monitoring of the auditory escape behavioral response

Larvae at 5 dpf were placed in 200 μl of E3 buffer in standard translucent 96-well microplate (Corning Life Sciences). The plate was vibrated by a Type 4810 shaker (Bruel & Kjaer) in the dark inside a Zebrabox monitoring system (ViewPoint Life Sciences). Pure-tone stimuli delivered by the shaker were generated with VideoTrack v.3 software (ViewPoint Life Sciences) and amplified by STR-DG510 sound system (Sony). Sound pressures (SPL) were determined by placing a hydrophone (WP-23502-P16, Knowles Electronics) at the bottom of each well and recording voltage amplitudes with a TDS 1002B oscilloscope (Tektronix). Voltages were then compared to an acoustic calibrator at 94 dB and1 kHz in air, which converted to 120 dB under water using 1 μPa as reference pressure (Model 521, AcoPacific). Stimuli were presented for 100 ms at 1 kHz with pressure levels of either 132, 138 or 146 dB. Behavioral responses were recorded using a Dragonfly2 Camera CCD (Point Grey Research Inc.), and binned into one-second time frames with the VideoTrack software. Camera and VideoTrack settings were as follows: shutter speed of 100ms, gain of 10 dB, frame rate 10 fps, detection sensitivity 12 pixels, burst activity threshold 50 pixels, and freeze behavior 10 pixels. An infrared light source continuously illuminated the larvae. For quantification of the auditory escape behavioral response (AEBR), 6 trials were performed per larvae (n ≥ 24 animals per genotype) with 3 minutes of rest between trials at each sound pressure level. Response percentages were calculated as the average for 6 trials. A response was scored as positive if an animal generated burst activity above a 50 pixel change. Spontaneous movement was recorded 2 second prior to the stimulus. The percentages of spontaneous movement were as follows: wild-type = 6.9%, rbc3αQ850X, rbc3αY2056X, and rbc3αY2449X = 1.4%.

High-speed video capture of auditory escape response

Larvae rbc3α+/Q850X and rbc3αQ850X/− at 5 dpf were placed in a standard petri dish filled with E3 buffer. AEBRs induced by a light tap generated by the researcher to the side of a dish were imaged using a FASTCAM PCI512 high speed CCD camera (Photron). Images were captured at 1000 fps (512×512 pixels). Several larvae (n = 5 each genotype) were imaged simultaneously on a Zeiss Axiovert 100 microscope and analyzed by ImageJ software.

Primary Antibodies for Immunohistochemistry and fluorescence labeling

Rabbit polyclonal panMAGUK (1:500 dilution) and mouse monoclonal Ribeyeb (1:1000 dilution) antibodies were described in (Sheets et al., 2011). Rabbit polyclonal Vglut3 antibody (1:1000 dilution) was described in (Obholzer et al., 2008). Atp6V1A (a and b) proteins were targeted by rabbit polyclonal antibody, dilution 1 μg/ml (17115-1-AP, Proteintech Group). PanRab3 mouse antibody (1:1000 dilution, #107011, Synaptic Systems). Actin was labeled by incubation with Alexa488-Phalloidin (1:1000 dilution, Invitrogen).

Whole-mount immunohistochemistry and fluorescent imaging

Zebrafish larvae at 5 dpf were fixed in 4% paraformaldehyde and phosphate buffered saline with 0.02% Tween (PBS-T) overnight at 4°C, permeabilized with ice-cold acetone for 5 minutes, and blocked with PBS-T containing 1% bovine serum albumin (BSA) and 1% dimethyl sulfoxide (DMSO) for 2 hours room temperature. They were then incubated with primary antibodies in blocking buffer overnight at 4°C, washed several times in PBST, and incubated in blocking buffer with secondary antibodies conjugated to Alexa488 (Molecular Probes, Invitrogen) and DyLight 549 (Jackson ImmunoResearch). Images through the Z-plane were collected with Zeiss Axiovert ImagerM.1 microscope with an LSM700 confocal scanhead, Axiocam MrM camera, oil-immersion lens Zeiss Plan Apochromat 63X/1.4NA objective (Zeiss). 488 nm and 555 nm laserlines were used for excitation and laser intensities were adjusted to minimize photobleaching.

For quantification of the Atp6V1A (a and b), neuromasts IO1-3 and SO1-3 were used due to their exceptional preservation of morphology of the hair bundles after paraformaldehyde fixation. Top-down confocal images were collected through the Z plane of the entire neuromast (10-15 μm). Statistical subtraction was then performed with Metamorph software (Molecular devices) with a threshold set to 300 pixels. Single optical sections of 1 μm that were beneath the apical hair bundle were selected for analysis of apical compartments. Maximum z-plane projections of the basal end (3 μm optical section) were selected for basal measurements. Total neuromast V1A signal was measured for maximal projections through the z-plane of the entire neuromast.

For quantification of the Rab3 and Vglut3 signal, L2 neuromasts were used for confocal microscopy. Maximal z-projections of the entire neuromast were performed (10-15 μm). Statistical subtraction was performed and neuromasts thresholded to 150 pixels and measured. For determination of Ribeyeb and panMAGUK overlap, Manders correlation coefficients were determined for maximal z-projections of L2 neuromasts using the plugin JACob of ImageJ (Bolte and Cordelières, 2006).

Live cell imaging

For live imaging, larvae at 5dpf were anesthetized in 0.01% tricaine and embedded in 1.5% low-melt agarose containing tricaine. Live-cell staining was performed with confocal microscopy using a water-immersion lens 60X/0.95NA objective. 488 nm and 555 nm laserlines were used for excitation. The entire neuromast was imaged for analysis with ImageJ. Hair cells that displayed very high expression of transgene constructs, including aberrant nuclear signal, were excluded from further analysis.

LysoTracker staining of acidic compartments

LysoTracker DND-99 dye (Invitrogen) at 100 nM concentration was used for labeling acidic compartments. Larvae were continuously incubated with dye, and then imaged (555/590 excitation/emission). Z-stacks of L2 neuromasts were used for comparison. Images were thresholded to 100 and measured with ImageJ. LysoSensor GREEN-DND-189 (Invitrogen) was added at 100 nM and emission was imaged at 505 nm.

V-ATPase pharmacological inhibition

Bafilomycin A1 inhibitor (Sigma) was added to the whole-larvae bath at a final concentration of 1 μM. Larvae were incubated for 5 minutes and washed repeatedly before imaging.

Electrophysiology and Lateral-line Afferent Recordings

Our recording setup for both microphonics and action currents has been previously described (Obholzer et al., 2008; Trapani and Nicolson, 2010). To suppress muscle activity, larvae were anesthetized and then microinjected in the heart with 125 μM α-bungarotoxin. For extracellular current recordings, borosilicate glass pipettes were pulled (P-97, Sutter Instruments) with a long taper and had resistances between 5 and 15 MΩ in extracellular solution. Microphonic electrodes resembled standard patch pipettes with resistances from 1 to 5 MΩ in extracellular solution. Signals were obtained using an EPC 10 amplifier and Patchmaster software (Heka Electronic). Extracellular action currents were recorded from the soma of an individual lateral-line afferent neuron with seal resistances ranging from 20 to 80 MΩ. The recordings were done in voltage-clamp mode, sampled at 50 μs/pt and filtered at 1 kHz. Microphonic potentials were performed in current-clamp mode and sampled at 100 μs/pt. An additional amplifier (Model 440, Brownlee Precision) was used for a total of 10,000X gain and 50 Hz filter of the voltage signal. For microphonics, the recording electrode was positioned (MPC-385, Sutter Instruments) adjacent to the neuromast at the height of the hair-cell stereociliary bundles. For action current recordings, the electrode was positioned within the posterior lateral-line ganglion. The neuromast innervated by the selected afferent neuron was then identified by incrementally moving the waterjet from neuromast to neuromast until phase-locked spiking was seen in response to stimulation of the innervated neuromast.

Mechanical Stimulation

Stimulation of neuromast hair-cells was performed with a pressure clamp (HSPC-1, ALA Scientific) attached to a glass micropipette (tip diameter ~ 30 μm) filled with extracellular solution. The waterjet pipette was positioned (MP-265, Sutter Instruments) approximately 100 μm from a given neuromast and displacement of the kinocilia was verified by eye.

Signal Analysis

Data were analyzed using custom software written in Igor Pro (Wavemetrics) and were plotted with Prism 5 (Graphpad). Average spike rate (spikes/second) was computed from the total number of spikes in 60 consecutive one-second traces. Average spike latency from the start of each 60 cycle and the degree of synchrony between the stimulus wave and the action current response (calculated as vector strength) was performed as described previously (Trapani et al., 2009). Representative microphonic traces were the average of 200 consecutive 500-ms traces. Mean power spectral density (PSD) was then determined from the sum of individual PSDs for each of the 200 traces during the 200-ms stimulus portion of each trace.

Statistical Analysis

Average data are presented as the mean ± standard error (SEM). Statistical significance was determined using either a Student’s two-tailed t test (paired or unpaired as appropriate), Mann-Whitney test, or analysis of variance (one-way ANOVA with Bonferonni’s multiple comparisons test). Differences between groups were considered significant if p values were less than 0.05. Statistical analyses were performed and graphs were constructed using Prism 5.0 software.

Results

Hearing, balance, and vision are impaired in stardust/rbc3α mutants

As part of the Tübingen 2000 Screening consortium, we screened over 1,000 F2 families for mutants with balance and hearing defects to identify genes required for auditory/vestibular function in zebrafish. Five recessive alleles of a gene we named stardust were identified by complementation analysis. One line did not survive after several generations and was not further characterized. Mutant stardust larvae are morphologically normal and do not display any obvious degeneration or necrosis. Mutant larvae perform an escape response to either touch stimuli, or acoustic stimuli produced by tapping on the tank or petri dish. However, during the escape response, mutants have an aberrant body-axis orientation while swimming and fail to maintain an upright position. In addition, they do not inflate their swim bladder, lack spontaneous eye movements, and their melanocytes do not contract when exposed to bright light (data not shown). Collectively, these responses suggest that both the visual and vestibular systems are impaired in stardust mutants.

To understand the contribution of stardust to detection of sensory stimuli, we measured the auditory escape behavioral response (AEBR), which is a simple and well-defined behavior (Nicolson et al., 1998; Zeddies and Fay, 2005). Using a high-speed video camera, we first inspected the swimming and turning behaviors during the escape response to an acoustic tap stimulus. We compared multiple still frames of the escape reflex of 5 dpf wild-type siblings and homozygous stardust mutants carrying the putative strong allele, rbc3αQ850X (see positional cloning below). At rest, wild-type larvae were oriented dorsal side up with respect to gravity, while rbc3αQ850X mutants were supine on the bottom of the dish with their ventral side exposed (Fig. 1A; n = 5 each). This lack of an upright position is similar to the postural defects seen in other balance-defective mutants (Nicolson et al., 1998). In response to a tap stimulus, wild-type and mutant larvae performed C-bends or counter turns and then swam several body lengths away (>3.5 mm). After short bouts of swimming, the wild-type larvae resumed a dorsal upright position, whereas the mutants were lying on their sides. These coordinated motor behaviors indicate that wild-type and mutant larvae are capable of performing an escape response, despite the obvious vestibular deficits in the mutants.

Figure 1
Homozygous stardust/rbc3α mutants have auditory and vestibular deficits (5 dpf)

The presence of an escape response to loud, multispectral stimuli (tapping) does not exclude the possibility of a more subtle defect in hearing. We therefore assessed the auditory system in stardust mutants by testing the AEBR to either tap stimuli or pure tones delivered at a given sound pressure. Wild-type siblings and rbc3αQ850X, rbc3αY2056X, or rbc3αY2449X larvae were placed in individual wells of a 96-well plate in the dark. The percentage of larvae that performed an AEBR to a tap stimulus was not significantly different between wild-type and either rbc3αQ850X, rbc3αY2056X, or rbc3αY2449X animals (Fig. 1B; n ≥ 24 animals each; p > 0.05 unpaired Student’s t test). As stated earlier, the response to a tap stimulus confirmed that mutant larvae were capable of generating a startle response. Next, we tested pure tones and chose sound pressures ranging between 132 and 146 dB at a frequency of 1 kHz. These parameters were chosen as they yielded measureable escape responses in wild-type larvae and similar parameters were used in a previous study of the AEBR in zebrafish larvae (Zeddies and Fay, 2005). Due to variability in behavioral responses between strains, we limited our comparisons of wild-type and mutant larvae within a given strain. In contrast to the tap stimulus, at 132 dB both rbc3αQ850X and rbc3αY2056X mutants had fewer responses than wild-type animals (p < 0.05). However, mutants containing the rbc3αY2449X allele were not statistically different than wild-type animals in response. At a higher sound pressure level of 138 dB, only rbc3αQ850X animals had fewer responses than wild-type (WT 43 ± 6 %, rbc3αQ850X 18 ± 3 %, p < 0.001). At the highest sound pressure level tested, 146 dB, all three mutants performed worse than wild-type animals (WT 71 ± 5 %, rbc3αQ850X 54 ± 6 %, p < 0.05; WT 64 ± 4 %, rbc3αY2056X 45 ± 4 %, p = 0.0013; WT 67 ± 5 %, rbc3αY2449X 50 ± 6 %, p < 0.05). The reduced AEBRs of mutant larvae indicate that hearing is impaired, but not abolished. The results from this auditory test are also consistent with observation that mutant larvae are still capable of producing a startle response.

Positional cloning, expression and distribution of Rbc3α in hair cells

To identify the genetic lesions in stardust alleles, we generated a meiotic recombination map by scoring recombination events in 385 homozygous mutant larvae with microsatellite markers. A large critical interval of 3.7 Mb was defined based on the Zv8 assembly of the zebrafish genome. The critical interval contained 60 candidate genes, including rbc3α (also known as dmxl2; Fig. 2A). To identify lesions within candidate genes, total mRNA was reverse transcribed from extracts of homozygous larvae. We then performed PCR from amplified cDNA and sequenced amplicons from several candidates. Three alleles of stardust contained nonsense mutations in the gene rbc3α (Fig. 2B). A fourth allele failed to generate cDNA from rbc3α transcripts, but control vglut1 transcript was detected (data not shown). Zebrafish Rbc3α is predicted to be a large protein (3065 aa), and we designated the three alleles containing stop codons according to their amino acid locations as follows: Q850X, Y2056X, and Y2449X. In contrast to many zebrafish genes, we were unable to find any duplicates of rbc3α in the current assembly of the zebrafish genome. Similar to its mammalian orthologues, zebrafish Rbc3α also has multiple WD-40 domains that may function as protein-protein interaction sites (Fig. 2B, SMARTdatabase).

Figure 2
Positional mapping, cloning and expression of rbc3α

To determine which tissues might contribute to the behavioral deficits of rbc3α mutants, we examined the expression pattern of rbc3α transcripts. A previous large-scale expression screen detected rbc3α transcripts as early as gastrulation and demonstrated wide-spread expression throughout the larval nervous system (Thisse et al., 2001). We chose to characterize developmental stages relevant to auditory startle responses. Using an RNA in situ probe against an internal portion of the rbc3α transcript, we detected transcripts in the eye, throughout the brain, and in the sensory epithelia of the ear and cranial ganglia at 3 and 4 dpf (Fig. 2C, D). The labeling seen in the inner nuclear layer and ganglion cell layer of the retina raises the possibility that mutant visual deficits may also be present at early steps in sensory detection. Although we did not detect labeling of the lateral-line organ by in situ hybridization, we predicted that rbc3α was also expressed in lateral-line hair cells. Therefore, we used RT-PCR as an alternative detection method for detection of hair-cell transcripts in the lateral line (Trapani et al., 2009; Trapani and Nicolson, 2011). We isolated superficial neuromasts of larvae and prepared cDNA, and then used primers against two different fragments of rbc3α. We amplified another known hair-cell gene, cadherin23 as a positive control (Fig. 2E). We were able to amplify rbc3α from neuromast cDNA (Fig. 2E), a result that is consistent with rbc3α expression in hair cells of the lateral line.

To gain a better understanding of the function of Rbc3α in hair cells, we determined whether Rbc3α is present throughout the cytoplasm or localized to subcellular regions of the hair-cell soma. We first attempted to generate specific Rbc3α antibodies, but were unsuccessful. Instead, we cloned full-length rbc3α [Genbank accession number pending], and exogenously expressed N-terminally tagged GFP-Rbc3α in hair cells using a minimal myosin6b promoter. We observed that GFP-Rbc3α was localized to the basal end of hair cells in a crescent-like distribution pattern (Fig. 2F, G). The localization of GFP-Rbc3α in live cells was similar to that of Vglut3, an integral membrane protein residing within basally localized synaptic vesicles (Fig. 2H; Obholzer et al., 2008). The expression pattern of rbc3α suggests that defects in hair-cell function potentially underlie the aberrant auditory and vestibular behaviors of rbc3α mutants, and the localization of Rbc3α near hair-cell synapses may impart a synaptic function for the protein (Nagano et al., 2002; Sakisaka and Takai, 2005).

Rbc3α mutant hair cells fail to properly acidify synaptic vesicles

The Vglut3-like distribution pattern of GFP-Rbc3α in hair cells suggests a functional link between the protein and synaptic vesicles. Previous genetic evidence also argues for the importance of Rbc3α in the acidification of other intracellular compartments (Yan et al., 2009; Sethi et al., 2010). Therefore, we predicted that the loss of Rbc3α would also affect synaptic vesicle acidification. To examine this possibility, we applied the pH-dependent and cell-permeant dye LysoTracker to whole larvae in order to label acidic compartments. Lysotracker has been used to examine synaptic vesicles in retinal bipolar termini (Abreu et al. 2008). In live hair cells of wild-type larvae, the dye readily accumulated at the basal end of hair cells where synaptic vesicles reside (Fig. 3 A, B). Interestingly, at lower-gain settings, ring-like topologies or tori at the base of the hair cell became apparent (Fig. 3A). To determine whether LysoTracker dye labeled acidic synaptic vesicles surrounding each ribbon body, we applied the dye to transgenic larvae stably expressing Ribeye b-GFP. The Ribeye b-GFP aggregates were surrounded by the LysoTracker-labeled tori, confirming that ribbon-associated vesicles were labeled. In addition, immunolabel of Vglut3 also surrounds Ribeye b positive puncta (data not shown, Obholzer et al. 2008). We next examined live hair cells of mutant larvae to determine whether hair cells require Rbc3α for synaptic vesicle acidification. For comparison between genotypes, we restricted our analysis to neuromasts at the same position (L2) along the trunk. Basal LysoTracker signal of either rbc3αQ850X, or rbc3αY2449X mutants was greatly reduced compared to wild-type hair cells, but not between alleles (Fig. 3B, C, E; WT 1332 ± 126 A.U. n = 12; rbc3αQ850X 169 ± 20 A.U. n = 11; rbc3αY2449X 168 ± 15 A.U. n = 11, one-way ANOVA; F(2,31) = 74.8; p < 0.0001). A similar observation of reduced Lysotracker signal was made for the mutant rbc3αY2056X (data not shown). In addition, the fluorophore LysoSensor GREEN-DND-189 (LysoSensor) has been used to label phagosomes in microglia of zebrafish (Peri and Nusslein-Volhard 2009). We find that it also labels synaptic vesicles in wild-type hair cells more readily than mutant hair cells (data not shown). The maximal emission of LysoSensor is greatest at pH 4-5 and suggests that mutant synaptic vesicles have elevated pH. Together, these results indicate that proper synaptic vesicle acidification requires functional Rbc3α.

Figure 3
Rbc3α is required for proper acidification of basal vesicles

The residual labeling of mutant synaptic vesicles suggested that low levels of V-ATPase activity were still present. Therefore, to determine whether Rbc3α acts as a modulator of V-ATPase activity, we then applied the V-ATPase-specific inhibitor bafilomycin to both wild-type and rbc3αQ850X mutant animals. In hair cells of each genotype, basally localized LysoTracker signal was reduced to levels below that of untreated rbc3αQ850X mutants (Fig. 3 D, E; WT bafilomycin-treated 76 ± 16 A.U. n = 6; untreated rbc3αQ850X 169 ± 20 A.U. n = 11; rbc3αQ850X bafilomycin-treated 64 ± 13 A.U. n = 5; one-way ANOVA; F(2,19) = 8.7; p = 0.002). This result supports a modulatory role rather than an absolute requirement for Rbc3α in vesicle acidification. We also noted that near the epithelial surface of hair cells, apical puncta were labeled with LysoTracker and were present in both wild-type and mutant hair cells. These puncta had levels that were similarly matched, suggesting that the decrease in mutant labeling was specific to basal compartments (Fig. 3F; WT 183 ± 18 A.U. n = 6 larvae; rbc3αQ850X 232 ± 19 A.U. n = 9; rbc3αY2449X 213 ± 15 A.U. n = 11; one-way ANOVA; F(2,23) = 1.5; p = 0.234). Collectively, our results with LysoTracker suggest that the function of Rbc3α is primarily to modulate the pH of synaptic vesicles in hair cells.

Proper synaptic localization of V-ATPase subunits requires Rbc3α

Our results are consistent with a role for Rbc3α in modulating acidification of synaptic vesicles. We next set out to determine the molecular basis of this modulation. Given the interaction between various subunits of the Rbc3 complex and the V-ATPase in Drosophila, altered V-ATPase activity was a plausible explanation for defective acidification (Yan et al., 2009). We hypothesized that Rbc3α promotes acidification of vesicles via regulation of the proton pump. Rbc3α may influence proton pump activity in several ways including trafficking, protein expression or degradation, or assembly of the V-ATPase holoenzyme (Toei et al., 2010).

To determine which mode of V-ATPase regulation might be affected by the loss of Rbc3α function, we examined the distributions and levels of subunits of the cytosolic (V1) and membrane (V0) sectors of the V-ATPase. To visualize the cytosolic sector, we labeled whole larvae with an anti-panV1A antibody, and counterstained for actin using Alexa488-Phalloidin. The specificity of the V1A antibody was confirmed as ionocytes, which express high levels of V-ATPase, were robustly labeled (Fig. 4 A, A’; Shiao et al., 2005; Horng et al., 2009). The V1A immunolabeling observed in hair cells was markedly enriched at basal regions in wild-type hair cells (Figure 4B, shown in purple), but in contrast, was evenly dispersed between apical and basal regions of rbc3αQ850X hair cells (Fig. 4B’). To quantify the differences in V1A distribution between wild-type and mutant hair cells, we measured the ratio of apical-to-basal signal. We found that the ratio of apical-to-basal V1A signal was significantly increased in rbc3αQ850X hair cells (Fig 4C; WT 0.54 ± 0.03 n = 15 neuromasts, 9 animals; rbc3αQ850X 0.92 ± 0.03 n = 13, 8 animals; p < 0.0001; unpaired Student’s t test). To determine whether the increase in apical-to-basal ratio was due to a change in V1A expression, we measured the total fluorescence of V1A and found that the overall intensity of V1A labeling did not significantly differ between wild-type and mutant hair cells (Fig. 4D; WT 937 ± 61 A.U. n = 15 neuromasts, 9 animals; rbc3αQ850X 889 ± 57 A.U. n = 13, 8 animals; p = 0.57; unpaired Student’s t test). Thus, protein levels of the cytosolic V-ATPase subunit appear unaffected in mutant hair cells, while the distribution pattern indicates either a defect in trafficking, assembly, or both.

Figure 4
Cytosolic V1 sectors are redistributed in rbc3α mutants

Across species, defective assembly of the V-ATPase holoenzyme results in dispersed V1, but not V0, sectors away from normally acidified compartments (Seol et al., 2001; Smardon et al., 2002; Sautin et al., 2005). Therefore, we also examined the distribution of the membrane sector of the V-ATPase by transient expression of a GFP-tagged membrane subunit, V0A1a. Expression of GFP-V0A1a was not robust, however, a few inner-ear hair cells expressed GFP-V0A1a at sufficient levels for detection in vivo. Unlike the altered pattern of the V1A cytosolic subunit of the V-ATPase, the distribution of the GFP-tagged membrane V0A1a was similar in both wild-type and rbc3αQ850X hair cells (Fig. 4E, E’; n = 10 cells each). We observed higher levels of GFP signal near synaptic regions of the hair cells in both genotypes, suggesting that vesicular trafficking of the membrane V0A1a subunit is not perturbed in mutant hair cells. Normal localization of the membrane sector argues against a general trafficking defect of the proton pump.

To extend our in vivo analysis and confirm our findings with the pan-V1A antibodies, we also tagged a V1A subunit with GFP and examined stable transgenic expression of this cytosolic protein in live cells. In contrast to the V0A1a membrane subunit, the pattern of the cytosolic V1Aa-GFP subunit was altered in mutant hair cells. As seen with the immunolabeling experiments, wild-type hair cells showed an enriched GFP signal at the basal end, whereas GFP signal was dispersed in mutants (Fig. 4F, F’; WT 0.71 ± 0.04 apical-to-basal ratio n = 9 neuromasts, 9 animals; rbc3αQ850X 1.09 ± 0.06 n = 5 neuromasts, 5 animals; p = 0.0004, unpaired Student’s t test). These findings point to a mechanism involving V-ATPase holoenzyme assembly, as opposed to aberrant trafficking or protein levels in hair cells that are Rbc3α-deficient.

Rbc3α may also play a role in shaping V-ATPase localization in other cell types, such as the previously mentioned ionocytes. We therefore isolated yolk epithelium, which includes numerous ionocytes, and then prepared extracts for RT-PCR of v1aa and rbc3α transcripts. We detected products for both cDNAs (data not shown), indicating that yolk epithelial cells also express the Rbc3α protein. While variability in cell-to-cell labeling within individuals of both genotypes made quantification of signal intensities difficult, the loss of Rbc3α did not appear to have an obvious impact on apical V1A localization in ionocytes (Fig. 4 A, A’). Consequently, pathways in ionocytes that assemble the V-ATPase holoenzyme at apical regions may have redundant mechanisms, or limited need for Rbc3α. Taken together, these results suggest that assembly defects of the V-ATPase in rbc3α mutants are primarily restricted to synaptic vesicles in hair cells.

Synaptic composition is normal in rbc3α mutants

The distribution of the Rbc3 complex and its interaction with regulators of the small GTPase Rab3 may indicate additional synaptic roles for the complex, such as Rab3-dependent trafficking (Nagano et al., 2002; Kawabe et al., 2003). Therefore, we assessed the distributions and levels of synaptic vesicle proteins by immunolabeling hair cells with antibodies that target Vglut3 and Rab3 (a-d isoforms, Obholzer et al., 2008). We found that both Vglut3 and Rab3 were basally enriched in wild-type and mutant rbc3αQ850X hair cells, and the intensity of labeling was not significantly different for either proteins (Fig.5 A, B; Vglut3 WT 496 ± 29 A.U.; mutant 609 ± 51 A.U., n = 13 neuromasts, 7 animals each; p = 0.09 Mann-Whitney Test; panRab3 WT 883 ± 31 A.U. and mutant 856 ± 62 A.U.; p = 0.21 Mann-Whitney Test). In addition, wild-type and mutant efferent termini readily labeled with Rab3 (arrowheads Fig. 5 A, B). These observations further argue against a trafficking defect, or a decrease of the vesicle population.

Figure 5
Loss of Rbc3α function does not affect hair-cell synaptic components

The Rbc3 complex may also play a role in the synaptic development of the lateral line, as it is necessary for processing the intracellular domain of Notch in other organisms (Yan et al., 2009; Sethi et al., 2010), and Rab3 has been implicated in the nucleation of the neuromuscular junction in Drosophila (Graf et al., 2009). We therefore labeled presynaptic ribbon bodies with an anti-Ribeye b antibody and labeled postsynaptic contacts with an antibody against MAGUK proteins (Fig. 5D, E; Sheets et al., 2011). We observed that rbc3αQ850X mutants and wild-type hair cells contained Ribeye b and MAGUK-positive puncta with similar co-localization of both proteins (Fig. 5F; Manders correlation coefficient WT 0.58 ± 0.05 n = 9, rbc3αQ850X 0.57 ± 0.04 n = 8; p = 0.87; unpaired Student’s t test). We also did not observe obvious morphological defects nor cell death within the inner ear or neuromasts. Altogether, our observations suggest that the contribution of Rbc3α to the mutant auditory and vestibular behavioral phenotypes is not due to an obvious disruption in the development or morphology of hair-cell synapses.

Synaptic activity is reduced in rbc3α mutants

Hair cells transduce high frequency stimuli with temporal precision that is maintained during sustained periods of stimulation (reviewed in Nouvian et al., 2006). In order to support high rates of neurotransmitter release, a hair cell must ensure that synaptic vesicles are sufficiently acidified for optimal filling of neurotransmitter. Considering the defective acidification of synaptic vesicles in rbc3α mutants, we hypothesized that reduced V-ATPase activity would result in reduced synaptic transmission at mutant hair-cell synapses. In addition to reduced release of neurotransmitter, it was not clear whether mechanotransduction would also be sensitive to changes in apical V-ATPase activity (Shiao et al., 2005; Wangemann, 2006). To determine if reduced V-ATPase activity had any effect on mechanotransduction, we first recorded microphonic potentials in the presence of bafilomycin. Drug treatment did not have an obvious effect on microphonic potentials (data not shown). Consistent with this observation, the amplitude of microphonic potentials and power spectra of the microphonic potentials were similar in response to 20 Hz stimulation of wild-type and rbc3αQ850X neuromasts (Fig. 6A; WT n = 3; Mutant n = 6, 20 Hz p = 0.24; 40 Hz p = 0.93). The absence of effect on mechanotransduction is in agreement with our previous experiments, and it suggests that the defects in rbc3α mutant hair cells are largely synaptic.

Figure 6
The rate and fidelity of stimulus-dependent spiking of lateral-line afferent neurons is reduced in rbc3α mutants

In zebrafish larvae, an afferent neuron forms multiple synapses with groups of lateral-line hair cells that are all aligned with the same planar polarity in one or more neuromasts (Nagiel et al., 2008; Obholzer et al., 2008; Faucherre et al., 2009). It is not known whether single vesicles are released at each synapse during depolarization of lateral-line hair cells, as is the case for cochlear outer hair cells (Weisz et al. 2009), or whether multi-vesicular release occurs, as has been described for inner hair cells and bullfrog saccular hair cells (Glowatzki and Fuchs 2002; Li et al., 2009). Furthermore, in afferent neurons of mammalian inner hair cells, an excitatory postsynaptic potential (EPSP) at a single synapse generates a postsynaptic action potential (Rutherford et. al, 2012). However, at the developmental stage used for our recordings, the action potentials of a single afferent neuron are generated following activation of potentially many more synapses. Thus, it is not known whether a single EPSP is sufficient or whether EPSPs from multiple synapses must summate in order to bring the afferent neuron to threshold in the lateral line.

In order to examine synaptic transmission of wild-type hair cells in the presence of bafilomycin and in rbc3α mutant hair cells, we recorded evoked action potentials from afferent neurons of the lateral line organ. First, we confirmed our previous findings with bafilomycin by examining afferent activity during stimulation of lateral-line hair cells at 60 Hz before and during application of bafilomycin. Bafilomycin drastically reduced the firing rate of wild-type neurons (Fig. 6B; WT: 27 ± 4 spikes/sec; bafilomycin: 5 ± 1 spikes/sec; n = 3 larvae; p < 0.05, paired Student’s t test). These results strongly suggest that V-ATPase activity is necessary for proper synaptic transmission, presumably by establishing the proton gradient, which provides the driving force for neurotransmitter exchange.

We next examined synaptic transmission in rbc3αQ850X mutants by recording evoked activity of lateral-line afferent neurons from stimulating hair cells at two different frequencies: 20 and 60 Hz. At 60 Hz, the evoked firing rates of lateral-line afferent neurons were significantly reduced in rbc3αQ850X mutants (Fig. 6B,C; WT: 22 ± 2 spikes /sec, n = 9; rbc3αQ850X 12 ± 3 spikes/sec, n = 9; p < 0.05; unpaired Student’s t test). The reduced rate of spiking observed in the mutants during 60 Hz stimulation is consistent with the notion that mutant synaptic vesicles are underfilled and do not contain sufficient quantities of neurotransmitter to reliably bring the afferent neuron to threshold. In contrast to 60 Hz, stimulation at 20 Hz did not result in a significant difference between wild-type and mutant afferent firing rates (WT: 14 ± 4 spikes /sec, n = 5; rbc3αQ850X 10 ± 3 spikes/sec, n = 7; p = 0.4; unpaired Student’s t test). Ostensibly, this difference in spiking rate at 20 versus 60 Hz in rbc3αQ850X larvae reflects the difference in the length of the stimulus wave cycle; at 20 Hz the 50 millisecond period results in a 25 millisecond depolarization of the hair cell, which is a longer period of time for fusion of synaptic vesicles and subsequent release of sufficient quantities of neurotransmitter. Despite normal spiking rates at 20 Hz, slower neurotransmitter release would likely result in a temporal delay to reach threshold in the afferent neuron. Indeed, there was a significant increase in the latency of firing in rbc3αQ850X larvae at both 20 and 60 Hz when compared to wild-type animals (Fig. 6D; 20 Hz, WT: 0.16 ± 0.01, n = 5; rbc3αQ850X 0.30 ± 0.02, n = 7; p < 0.001; two-tailed unpaired Student’s t test; 60 Hz, WT: 0.27 ± 0.02, n = 9; rbc3αQ850X 0.41 ± 0.04, n = 9; p < 0.01; two-tailed unpaired Student’s t test). The shift in latency is consistent with defective acidification and consequent reduced concentration of neurotransmitter within the synaptic vesicles of rbc3α mutants.

Interestingly, the effects of bafilomycin treatment had a greater effect on firing rates than the loss of Rbc3α function (Fig. 6B), similar to the results obtained from experiments with LysoTracker pH indicator dye (Fig. 3D,E). Furthermore, following a prolonged incubation in bafilomycin, action potentials disappeared (data not shown). These results support the notion of a modulatory role for Rbc3α leading to partial filling of vesicles in the mutants in contrast to the severe depletion of neurotransmitter in vesicles after bafilomycin treatment.

The reduction in spike rate at higher frequencies would also predict that a decrease in the fidelity of stimulus encoding would be present in the mutant larvae (Wittig and Parsons, 2008). We found that the fidelity of phase-locked spiking of the afferent neuron to the 60 Hz mechanical stimulus was decreased. Calculation of vector strength, an indication of the precision of responses to a given stimulus, was significantly reduced in rbc3αQ850X larvae (Fig. 6E; WT: 0.87 ± 0.01, n = 9; rbc3αQ850X 0.78 ± 0.02, n = 9; p < 0.001; unpaired Student’s t test). We also determined the fidelity of phase locking at 20 Hz but did not observe a significant difference between wild-type and mutant larvae (WT: 0.96 ± 0.01, n = 5; rbc3αQ850X 0.85 ± 0.05, n = 7; p = 0. 13, unpaired Student’s t test). This result indicates that for longer durations of stimulation such as 20 Hz cycle length, relatively normal spike rates and phase locking are still possible in rbc3α mutants despite a significant shift in latency.

An additional postsynaptic effect that could result from reduced release of neurotransmitter is a decrease in the rate of spontaneous spiking of the afferent neuron (Rutherford et al., 2012). We previously showed that spontaneous activity of afferent neurons in the lateral line is generated by spontaneous hair-cell neurotransmission (Trapani and Nicolson, 2011). To determine whether spontaneous activity was affected in rbc3αQ850X mutants, we recorded afferent activity in the absence of mechanical stimulation. We observed a reduction in the rate of spontaneous action potentials in rbc3αQ850X mutants with a significant increase in the mean interspike interval (WT: 83 ± 9 msec, n = 11; rbc3αQ850X 394 ± 141 msec, n = 7; p < 0.05; unpaired Student’s t test).

Given that endosomes are thought to be a source for replenishing synaptic vesicles (Südhof, 2004), and that endosomal maturation is defective inRbc3α-deficient flies (Yan et al., 2009), we next considered whether synaptic vesicle replenishment is impaired in rbc3αQ850X hair cells. Furthermore, like rbc3α mutants, a similar reduction in initial spike rate and phase locking was reported for synj1 mutants, which have defects in synaptic vesicle recycling (Trapani et al., 2009). We therefore mechanically stimulated hair bundles with a sustained stimulus of 15 minutes at 60 Hz while recording the resulting evoked activity in the afferent neuron. We found that in contrast to synj1 mutants, sustained stimulation did not further degrade the synaptic firing rate of rbc3αQ850X mutants (Fig. 6C; 10 ± 5 spikes/sec; n = 4; p = 0.14; paired Student’s t test). This result suggests that despite the reduced rate of spiking at 60 Hz, replenishment of synaptic vesicles at this same frequency is not defective in rbc3αQ850X hair cells. Altogether, our electrophysiology results are consistent with the synaptic defects identified by our cellular and molecular analyses, suggesting that synaptic activity is impaired as a result of de-acidified and underfilled synaptic vesicles in the hair cells of rbc3α mutants.

Discussion

Numerous studies have demonstrated that acidification of the lumen of synaptic vesicles is a necessary step in loading neurotransmitter into vesicles (Edwards, 2007; Schenck et al., 2009; Goh et al., 2011). In this study, we demonstrate that de-acidification of synaptic vesicles, either by genetic disruption of Rbc3α function or pharmacological inhibition of the proton pump, impairs synaptic transmission in hair cells. Our experiments indicate that proton gradients are reduced in mutant rbc3α synaptic vesicles and can be further dissipated by the proton pump inhibitor bafilomycin. Furthermore, blocking the proton pump drastically attenuates synaptic transmission in wild-type hair cells to levels below those in rbc3α mutants. Consistent with involvement of Rbc3α in synaptic vesicle acidification, the V1A cytosolic subunit of the V-ATPase was not concentrated in synaptic regions of mutant hair cells. Altogether, our data provide strong evidence for a defect in vesicle acidification that causes a reduction in the quantity of neurotransmitter in mutant synaptic vesicles. Thus, we propose that Rbc3α modulates synaptic activity in hair cells by promoting the assembly of the V-ATPase holoenzyme on synaptic vesicles, thereby regulating the vesicle’s internal pH and, ultimately, its concentration of neurotransmitter.

Several observations suggest that the primary function of Rbc3α is synaptic in nature. First, GFP-Rbc3α localizes to the basal end of hair cells in a distribution pattern akin to synaptic vesicle proteins. This distribution pattern is also in agreement with the vesicular distribution pattern observed for Rbc3α in the rat CNS (Nagano et al., 2002). Next, the acidification defect affects basally located structures such as synaptic vesicles in mutant hair cells, while apical membrane compartments appear to be unaffected. Finally, various V-ATPase subunits were enriched at the basal regions of wild-type hair cells, whereas mutant hair cells had a pronounced decrease in the basal localization of the cytosolic subunit V1A. Similar dispersal of various V1 sector subunits has been reported for conditions causing disassembly of holoenzyme (Seol et al., 2001; Smardon et al., 2002; Sautin et al., 2005), a finding that is consistent with the notion that Rbc3α regulates synaptic vesicle acidification via a mechanism involving assembly of the cytosolic and membrane components of the proton pump.

We also considered alternative possibilities that might account for a decrease in synaptic vesicle acidification. Changes in both protein levels and trafficking of the proton pump could lead to acidification defects. However, the aberrant redistribution of V1A cytosolic subunits in mutants appeared to not be due to a change in V1A protein levels as evidenced by the intensity of immunolabeling. A general trafficking defect was also not apparent, as we found that subcellular localization of synaptic vesicle proteins Rab3 and Vglut3, and exogenously expressed GFP-V0A1a was unchanged in mutant hair cells. Such results are inconsistent with either degradation of proton pump subunits or a trafficking defect of the V-ATPase complex (Hurtado-Lorenzo et al., 2006; Oehlke et al., 2011).

Overall, our results point to a modulatory role for Rbc3α as opposed to an absolute requirement for synaptic vesicle acidification. Defects of vesicle acidification could be further compounded by inhibition of the proton pump with bafilomycin in the mutants. We also noted that while the V1A cytosolic subunit appeared dispersed in mutant hair cells, its distribution still partially overlapped with the synaptic vesicle region of the hair cell, potentially accounting for the remaining vesicular V-ATPase assembly. As mentioned previously, de-acidification of synaptic vesicles would be expected to reduce neurotransmitter filling in synaptic vesicles (Edwards, 2007). Supporting this prediction, rbc3α mutant afferents have reduced evoked and spontaneous synaptic firing rates. In addition, there was an increased latency in spike timing, and decreased phase locking of evoked action potentials in response to mechanical stimulation of hair cells. Still, the evoked firing rate of rbc3α mutant afferents was greater than that of wild-type afferents after the larvae were treated with bafilomycin. This result further suggests that mutant vesicles have partially-filled vesicles due to the remaining V-ATPase activity.

Aside from a role in synaptic vesicle acidification, the loss of Rbc3α could also impact synaptic transmission in other ways, including perturbing vesicle trafficking or vesicle fusion. The Rbc3 complex was originally proposed to act as a synaptic scaffold upon which Rab3 GEP and GAP regulate Rab3 activity (Nagano et al., 2002; Kawabe et al., 2003). Rab3 activity shapes exocytosis, Rab3-dependent cargo trafficking to the synapse, and potentially nucleation of the synapse (Tanaka et al., 2001; Niwa et al., 2008; Graf et al., 2009). Therefore, impaired Rab3 GEP and Rab3 activity might be disrupted in rbc3α mutants. However, the distribution of vesicular proteins Rab3 and Vglut3 and the apposition of pre- and postsynaptic components, Ribeyeb and MAGUK, respectively, were unchanged in rbc3α mutants. These findings argue against the idea that Rab3 activity is disrupted. Another possible role comes from recent evidence indicating that the V0 sector contributes to membrane fusion (Hiesinger et al., 2005; Sun-Wada et al., 2006; Peri and Nüsslein-Volhard, 2008; Di Giovanni et al., 2010). Whether synaptic vesicle fusion proceeds normally in the absence of functional Rbc3α requires further investigation, but data from C. elegans suggests that V0-mediated membrane fusion does not require V-ATPase holoenzyme assembly (Liégeois et al., 2006).

While the etiology resulting from the loss of V-ATPase activity in human patients is incomplete, mutations within subunits of the V-ATPase (V1B1 and V0A4) cause progressive sensorineural deafness accompanied by distal renal tubular acidosis (Karet et al., 1999; Stover et al., 2002). Assembly and trafficking of the V-ATPase in rat kidney cell-ines is disrupted by mutations that mimic human V1B1 lesions in the orthologous rat V1B1 subunits, suggesting a potential mechanism behind the human disease (Yang et al., 2006). Surprisingly, however, V1B1 knockout mice are not deaf (Dou et al., 2003), suggesting that mice may have multiple mechanisms for ensuring the acidification of compartments, or sub-detectable expression levels of compensatory V1B2 subunit (Finberg et al., 2005). In zebrafish larvae, various V-ATPase subunit mutations cause gross morphological defects (Nuckels et al., 2009). In contrast to the severe consequences of V-ATPase mutations, the reduced V-ATPase activity phenotype seen in rbc3α mutants results in a more restricted phenotype of hearing impairment in zebrafish. An explanation for the differences that we observed in the auditory escape response among the different rbc3α mutants is lacking. However, given the widespread expression of Rbc3α in the nervous system, we speculate that the neural circuitry of the escape response might be subject to differences between the alleles.

Indeed, behavioral deficits in rbc3α mutants are not limited to the auditory/vestibular system. Mutants also lack spontaneous eye movements and light adaptation responses in melanocytes, suggesting a possible visual defect. The selective importance of Rbc3α to visual and auditory/vestibular sensory systems, but not touch sensation, may reflect the commonalities between these tissues. Retinal bipolar cells and photoreceptors of the eye share an assortment of unique molecular specializations with the hair cell, and also have ribbon-type synapses (Zanazzi and Matthews, 2009). Inherited forms of human deafness and blindness such as Usher syndrome are due to genetic lesions in the common molecular repertoire of the hearing and visual systems (hereditaryhearingloss.org). Future studies may identify synaptic defects in the retina of rbc3α mutants as well.

In summary, we have identified a novel role for Rbc3a in the acidification of synaptic vesicles in vertebrate hair cells. Rbc3α appears to modulate the activity of the V-ATPase holoenzyme on synaptic vesicles, most likely through a mechanism involving its assembly. Our study is the first step towards understanding how Rbc3α may act as both a synaptic vesicle scaffold and regulator of the V-ATPase.

Acknowledgements

This study was supported in part by NIH R01 DC006880. We thank the members of the Tübingen 2000 Screen Consortium for their assistance in isolating the rbc3α alleles.

Reference

  • Abreu BJ, Guimaraes M, Uliana LC, Vigh J, von Gersdorff H, Prado MA, Guatimosim C. Protein kinase C modulates synaptic vesicle acidification in a ribbon type nerve terminal in the retina. Neurochemistry International. 2008;53:155–164. [PMC free article] [PubMed]
  • Bolte S, Cordelières FP. A guided tour into subcellular colocalization analysis in light microscopy. J Microsc. 2006;224:213–32. [PubMed]
  • Di Giovanni J, Boudkkazi S, Mochida S, Bialowas A, Samari N, Lévêque C, Youssouf F, Brechet A, Iborra C, Maulet Y, Moutot N, Debanne D, Seagar M, El Far O. V-ATPase membrane sector associates with synaptobrevin to modulate neurotransmitter release. Neuron. 2010;67:268–79. [PubMed]
  • Dou H, Finberg K, Cardell EL, Lifton R, Choo D. Mice lacking the B1 subunit of H+ −ATPase have normal hearing. Hear Res. 2003;180:76–84. [PubMed]
  • Edwards RH. The neurotransmitter cycle and quantal size. Neuron. 2007;55:835–58. [PubMed]
  • Faucherre A, Pujol-Marti J, Kawakami K, López-Schier H. Afferent neurons of the zebrafish lateral line are strict selectors of hair-cell orientation. Plos One. 2009;4:e4477, 1–12. [PMC free article] [PubMed]
  • Finberg KE, Wagner CA, Bailey MA, Paunescu TG, Breton S, Brown D, Giebisch G, Geibel JP, Lifton RP. The B1-subunit of the H(+) ATPase is required for maximal urinary acidification. Proc Natl Acad Sci U S A. 2005;102:13616–21. [PubMed]
  • Fremeau RT, Jr, Burman J, Qureshi T, Tran CH, Proctor J, Johnson J, Zhang H, Sulzer D, Copenhagen DR, Storm-Mathisen J, Reimer RJ, Chaudhry FA, Edwards RH. The identification of vesicular glutamate transporter 3 suggests novel modes of signaling by glutamate. Proc Natl Acad Sci U S A. 2002;99:14488–93. [PubMed]
  • Glowatzki E, Fuchs PA. Transmitter release at the hair cell ribbon synapse. Nature Neuroscience. 2002;5:147–154. [PubMed]
  • Goh GY, Huang H, Ullman J, Borre L, Hnasko TS, Trussell LO, Edwards RH. Presynaptic regulation of quantal size: K+/H+ exchange stimulates vesicular glutamate transport. Nat Neurosci. 2011;14:1285–92. [PMC free article] [PubMed]
  • Graf ER, Daniels RW, Burgess RW, Schwarz TL, DiAntonio A. Rab3 dynamically controls protein composition at active zones. Neuron. 2009;64:663–77. [PMC free article] [PubMed]
  • Hiesinger PR, Fayyazuddin A, Mehta SQ, Rosenmund T, Schulze KL, Zhai RG, Verstreken P, Cao Y, Zhou Y, Kunz J, Bellen HJ. The v-ATPase V0 subunit a1 is required for a late step in synaptic vesicle exocytosis in Drosophila. Cell. 2005;121:607–20. [PMC free article] [PubMed]
  • Horng J, Lin L, Hwang P. Functional regulation of H+-ATPase-rich cells in zebrafish embryos acclimated to an acidic environment. Am J Physiol Cell Physiol. 2009;296:C682–92. [PubMed]
  • Hurtado-Lorenzo A, Skinner M, El Annan J, Futai M, Sun-Wada G, Bourgoin S, Casanova J, Wildeman A, Bechoua S, Ausiello DA, Brown D, Marshansky V. V-ATPase interacts with ARNO and Arf6 in early endosomes and regulates the protein degradative pathway. Nat Cell Biol. 2006;8:124–36. [PubMed]
  • Kane PM. The where, when, and how of organelle acidification by the yeast vacuolar H+-ATPase. Microbiol Mol Biol Rev. 2006;70:177–91. [PMC free article] [PubMed]
  • Karet FE, Finberg KE, Nelson RD, Nayir A, Mocan H, Sanjad SA, Rodriguez-Soriano J, Santos F, Cremers CW, Di Pietro A, Hoffbrand BI, Winiarski J, Bakkaloglu A, Ozen S, Dusunsel R, Goodyer P, Hulton SA, Wu DK, Skvorak AB, Morton CC, Cunningham MJ, Jha V, Lifton RP. Mutations in the gene encoding B1 subunit of H+-ATPase cause renal tubular acidosis with sensorineural deafness. Nat Genet. 1999;21:84–90. [PubMed]
  • Kawabe H, Sakisaka T, Yasumi M, Shingai T, Izumi G, Nagano F, Deguchi-Tawarada M, Takeuchi M, Nakanishi H, Takai Y. A novel rabconnectin-3-binding protein that directly binds a GDP/GTP exchange protein for Rab3A small G protein implicated in Ca(2+)-dependent exocytosis of neurotransmitter. Genes Cells. 2003;8:537–46. [PubMed]
  • Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Parant JM, Yost HJ, Kanki JP, Chien C. The Tol2kit: a multisite gateway-based construction kit for Tol2 transposon transgenesis constructs. Dev Dyn. 2007;236:3088–99. [PubMed]
  • Lafourcade C, Sobo K, Kieffer-Jaquinod S, Garin J, van der Goot FG. Regulation of the V-ATPase along the endocytic pathway occurs through reversible subunit association and membrane localization. PLoS One. 2008;3:e2758. [PMC free article] [PubMed]
  • Leibovici M, Safieddine S, Petit C. Mouse models for human hereditary deafness. Curr Top Dev Biol. 2008;84:385–429. [PubMed]
  • Li G, Keen E, Andor-Ardo D, Hudspeth AJ, von Gersdorf H. The unitary event underlying multiquantal EPSCs at a hair cell’s ribbon synapse. J Neurosci. 2009;29:7558–7568. [PMC free article] [PubMed]
  • Liégeois S, Benedetto A, Garnier J, Schwab Y, Labouesse M. The V0-ATPase mediates apical secretion of exosomes containing Hedgehog-related proteins in Caenorhabditis elegans. J Cell Biol. 2006;173:949–61. [PMC free article] [PubMed]
  • Nagano F, Kawabe H, Nakanishi H, Shinohara M, Deguchi-Tawarada M, Takeuchi M, Sasaki T, Takai Y. Rabconnectin-3, a novel protein that binds both GDP/GTP exchange protein and GTPase-activating protein for Rab3 small G protein family. J Biol Chem. 2002;277:9629–32. [PubMed]
  • Nagano F, Kawabe H, Nakanishi H, Shinohara M, Deguchi-Tawarada M, Takeuchi M, Sasaki T, Takai Y. Rabconnectin-3, a novel protein that binds both GDP/GTP exchange protein and GTPase-activating protein for Rab3 small G protein family. J Biol Chem. 2002;277:9629–32. [PubMed]
  • Nagiel A, Andor-Ardo D, Hudspeth AJ. Specificity of afferent synapses onto plane-polarized hair cells in the posterior lateral line of the zebrafish. Jneurosci. 2008;28:8442–8453. [PMC free article] [PubMed]
  • Nicolson T, Rüsch A, Friedrich RW, Granato M, Ruppersberg JP, Nüsslein-Volhard C. Genetic analysis of vertebrate sensory hair cell mechanosensation: the zebrafish circler mutants. Neuron. 1998;20:271–83. [PubMed]
  • Nouvian R, Beutner D, Parsons TD, Moser T. Structure and function of the hair cell ribbon synapse. J Membr Biol. 2006;209:153–65. [PMC free article] [PubMed]
  • Nuckels RJ, Ng A, Darland T, Gross JM. The vacuolar-ATPase complex regulates retinoblast proliferation and survival, photoreceptor morphogenesis, and pigmentation in the zebrafish eye. Invest Ophthalmol Vis Sci. 2009;50:893–905. [PubMed]
  • Obholzer N, Wolfson S, Trapani JG, Mo W, Nechiporuk A, Busch-Nentwich E, Seiler C, Sidi S, Söllner C, Duncan RN, Boehland A, Nicolson T. Vesicular glutamate transporter 3 is required for synaptic transmission in zebrafish hair cells. J Neurosci. 2008;28:2110–8. [PubMed]
  • Oehlke O, Martin HW, Osterberg N, Roussa E. Rab11b and its effector Rip11 regulate the acidosis-induced traffic of V-ATPase in salivary ducts. J Cell Physiol. 2011;226:638–51. [PubMed]
  • Peri F, Nüsslein-Volhard C. Live imaging of neuronal degradation by microglia reveals a role for v0-ATPase a1 in phagosomal fusion in vivo. Cell. 2008;133:916–27. [PubMed]
  • Ruel J, Emery S, Nouvian R, Bersot T, Amilhon B, Van Rybroek JM, Rebillard G, Lenoir M, Eybalin M, Delprat B, Sivakumaran TA, Giros B, El Mestikawy S, Moser T, Smith RJH, Lesperance MM, Puel J. Impairment of SLC17A8 encoding vesicular glutamate transporter-3, VGLUT3, underlies nonsyndromic deafness DFNA25 and inner hair cell dysfunction in null mice. Am J Hum Genet. 2008;83:278–92. [PubMed]
  • Rutherford M, Chapochnikov N, Moser T. Spike Encoding of Neurotransmitter Release Timing by Spiral Ganglion Neurons of the Cochlea. Jneurosci. 2012;32:4773–4789. [PubMed]
  • Sakisaka T, Takai Y. Purification and properties of rabconnectin-3. Methods Enzymol. 2005;403:401–7. [PubMed]
  • Sautin YY, Lu M, Gaugler A, Zhang L, Gluck SL. Phosphatidylinositol 3-kinase-mediated effects of glucose on vacuolar H+-ATPase assembly, translocation, and acidification of intracellular compartments in renal epithelial cells. Mol Cell Biol. 2005;25:575–89. [PMC free article] [PubMed]
  • Schenck S, Wojcik SM, Brose N, Takamori S. A chloride conductance in VGLUT1 underlies maximal glutamate loading into synaptic vesicles. Nat Neurosci. 2009;12:156–62. [PubMed]
  • Seal RP, Akil O, Yi E, Weber CM, Grant L, Yoo J, Clause A, Kandler K, Noebels JL, Glowatzki E, Lustig LR, Edwards RH. Sensorineural deafness and seizures in mice lacking vesicular glutamate transporter 3. Neuron. 2008;57:263–75. [PMC free article] [PubMed]
  • Seol JH, Shevchenko A, Shevchenko A, Deshaies RJ. Skp1 forms multiple protein complexes, including RAVE, a regulator of V-ATPase assembly. Nat Cell Biol. 2001;3:384–91. [PubMed]
  • Sethi N, Yan Y, Quek D, Schupbach T, Kang Y. Rabconnectin-3 is a functional regulator of mammalian Notch signaling. J Biol Chem. 2010;285:34757–64. [PubMed]
  • Sheets L, Trapani JG, Mo W, Obholzer N, Nicolson T. Ribeye is required for presynaptic Ca(V)1.3a channel localization and afferent innervation of sensory hair cells. Development. 2011;138:1309–19. [PubMed]
  • Shiao J, Lin L, Horng J, Hwang P, Kaneko T. How can teleostean inner ear hair cells maintain the proper association with the accreting otolith? J Comp Neurol. 2005;488:331–41. [PubMed]
  • Sipos G, Brickner JH, Brace EJ, Chen L, Rambourg A, Kepes F, Fuller RS. Soi3p/Rav1p functions at the early endosome to regulate endocytic trafficking to the vacuole and localization of trans-Golgi network transmembrane proteins. Mol Biol Cell. 2004;15:3196–209. [PMC free article] [PubMed]
  • Smardon AM, Kane PM. RAVE is essential for the efficient assembly of the C subunit with the vacuolar H(+)-ATPase. J Biol Chem. 2007;282:26185–94. [PubMed]
  • Smardon AM, Tarsio M, Kane PM. The RAVE complex is essential for stable assembly of the yeast V-ATPase. J Biol Chem. 2002;277:13831–9. [PubMed]
  • Stover EH, Borthwick KJ, Bavalia C, Eady N, Fritz DM, Rungroj N, Giersch ABS, Morton CC, Axon PR, Akil I, Al-Sabban EA, Baguley DM, Bianca S, Bakkaloglu A, Bircan Z, Chauveau D, Clermont M, Guala A, Hulton SA, Kroes H, Li Volti G, Mir S, Mocan H, Nayir A, Ozen S, Rodriguez Soriano J, Sanjad SA, Tasic V, Taylor CM, Topaloglu R, Smith AN, Karet FE. Novel ATP6V1B1 and ATP6V0A4 mutations in autosomal recessive distal renal tubular acidosis with new evidence for hearing loss. J Med Genet. 2002;39:796–803. [PMC free article] [PubMed]
  • Südhof TC. The synaptic vesicle cycle. Annu Rev Neurosci. 2004;27:509–47. [PubMed]
  • Sun-Wada G, Toyomura T, Murata Y, Yamamoto A, Futai M, Wada Y. The a3 isoform of V-ATPase regulates insulin secretion from pancreatic beta-cells. J Cell Sci. 2006;119:4531–40. [PubMed]
  • Söllner C, Schwarz H, Geisler R, Nicolson T. Mutated otopetrin affects the genesis of otoliths and the localization of Starmaker in zebrafish. Development Genes and Evolution. 2004;214:582–590. [PubMed]
  • Thisse B, Pflumio S, Fürthauer M, Loppin B, Heyer V, Degrave A, Woehl R, Lux A, Steffan T, Charbonnier XQ, Thisse C. Expression of the zebrafish genome during embryogenesis. 2001 ZFIN Direct Data Submission ( http://zfin.org)
  • Toei M, Saum R, Forgac M. Regulation and isoform function of the V-ATPases. Biochemistry. 2010;49:4715–23. [PMC free article] [PubMed]
  • Trapani JG, Obholzer N, Mo W, Brockerhoff SE, Nicolson T. Synaptojanin1 is required for temporal fidelity of synaptic transmission in hair cells. PLoS Genet. 2009;5:e1000480. [PMC free article] [PubMed]
  • Trapani JG, Nicolson T. Physiological recordings from zebrafish lateral-line hair cells and afferent neurons. Methods Cell Biol. 2010;100:219–31. [PubMed]
  • Trapani J, Nicolson T. Mechanism of spontaneous activity in afferent neurons of the zebrafish lateral-line organ. J Neurosci. 2011;31:1614–23. [PMC free article] [PubMed]
  • Trombetta S, Ebersold M, Garrett W, Pypaert M, Mellman I. Activation of lysosomal function during dendritic cell maturation. Science. 2003;299:1400–3. [PubMed]
  • Wangemann P. Supporting sensory transduction: cochlear fluid homeostasis and the endocochlear potential. J Physiol. 2006;576:11–21. [PubMed]
  • Weisz C, Glowatzki W, Fuchs F. The postsynaptic function of type II cochlear afferents. Nature. 2009;461:1126–1129. [PMC free article] [PubMed]
  • Wittig JH, Jr, Parsons TD. Synaptic ribbon enables temporal precision of hair cell afferent synapse by increasing the number of readily releasable vesicles: a modeling study. J Neurophysiol. 2008;100:1724–39. [PubMed]
  • Yan Y, Denef N, Schüpbach T. The vacuolar proton pump, V-ATPase, is required for notch signaling and endosomal trafficking in Drosophila. Dev Cell. 2009;17:387–402. [PMC free article] [PubMed]
  • Yang Q, Li G, Singh SK, Alexander EA, Schwartz JH. Vacuolar H+ -ATPase B1 subunit mutations that cause inherited distal renal tubular acidosis affect proton pump assembly and trafficking in inner medullary collecting duct cells. J Am Soc Nephrol. 2006;17:1858–66. [PubMed]
  • Zanazzi G, Matthews G. The molecular architecture of ribbon presynaptic terminals. Mol Neurobiol. 2009;39:130–48. [PMC free article] [PubMed]
  • Zeddies DG, Fay RR. Development of the acoustically evoked behavioral response in zebrafish to pure tones. J Exp Biol. 2005;208:1363–72. [PubMed]