Anandamide, arachidonoyl p-nitroaniline, decanoyl p-nitroaniline and methyl arachidonoyl fluorophosphonate (MAFP) were purchased from Cayman Chemicals (Ann Arbor, MI, USA). Phenylmethylsulfonyl fluoride (PMSF) Dimethyl sulfoxide (DMSO), isopropyl-1-thio-β-D-galactopyranoside (IPTG), p-nitroaniline, and Freund’s complete and incomplete adjuvant were purchased from Sigma-Aldrich Canada (Oakville, ON, Canada). All media were obtained from Difco Laboratories (Detroit, MI). All restriction endonucleases were obtained from New England Biolabs (Mississauga, ON, Canada). T4 DNA ligase, Taq polymerase and G418 were purchased from Invitrogen (Burlington, Ontario, Canada). PCR amplification reactions were performed with a GeneAmp PCR system 9700 thermocycler (Applied Biosystems Canada, Streetsville, ON, Canada). PWO polymerase was purchased from Roche Applied Science (Laval, Quebec, Canada).
Dictyostelium strain growth and development
Dictyostelium discoideum AX3 cells were grown either with
Klebsiella aerogenes on SM agar plates or in Sorensen’s phosphate buffer (2
mM Na
2HPO
4, 14.6
mM KH
2PO
4, pH 6.0). Cells were grown axenically in liquid nutrient medium [
33] with shaking of the suspension at 150
rpm at 22-24°C. AX3FAAH cells were cultured in axenic liquid nutrient medium containing 10
μg
ml
-1G418 for selection of the recombinant protein producing cells. To analyze development, cells were grown axenically to a density of 2–3
×
10
6 cells ml
-1 washed twice in Sorensen’s phosphate buffer and 5
×
10
7 cells were plated on phosphate agar plates
. At different time points during development cells were harvested and total proteins extracted. Cell density was determined by taking an aliquot of the culture and counting it in a standard hemocytometer.
Dictyostelium subcellular fractionation
For separation of membrane and cytosolic fractions, cells were washed in Sorensen’s phosphate buffer and resuspended at a density of 1
×
10
8 cells ml
-1 in MES buffer (20
mM MES, pH6.5, 1
mM EDTA, 250
mM sucrose) supplemented with complete protease inhibitor mixture, EDTA-free (Roche Applied Science, Laval, Quebec, Canada). Cells were lysed by sonication, membrane and cytosolic fractions were separated by two separate centrifugation forces at 15,000
xg and 100,000
xg for 30
min at 4°C. Complete lysis of the cells after sonication was confirmed by checking for no intact cells under the microscope.
Bioinformatics and cDNA isolation
Nucleotide BLAST searches (
http://dictybase.org/tools/blast) were performed using full length human FAAH nucleotide sequences. Dictyostelium DNA sequences coding for characteristic amidase signature (AS) motifs were identified in the annotated genome data base (
http://dictybase.org) and ortholog
DDB_G0275967 (
http://dictybase.org/gene) [GenBank: XM_638290] was selected for further functional characterization. Domain architecture analyses and amino acid sequence homology comparisons among FAAH from different species were done using sequence analysis tools available at
http://www.ncbi.nlm.nih.gov/guide/sequence-analysis/ and
http://www.ebi.ac.uk/Tools/clustalw2/index.html. Based on gene exon sequence information of [GenBank: XM_638290], oligonucleotides were designed and used in reverse transcription-polymerase chain reaction (RT-PCR) for complete cDNA synthesis. Total RNA was extracted using RNeasy Midi kit (Qiagen, Mississauga, Ontario, Canada) from vegetatively grown Dictyostelium cells according to manufacturer’s instruction. 2μg of RNA was used in the RT reaction using Omniscript RT Kit (Qiagen, Mississauga, Ontario, Canada), 100 pmol of the gene specific primer NRC 190 with sequence 5’GTCGACTTAGTTATTTGGGTTTGTGCAATTTG 3’ and 100 pmol of Oligo-dT primer (Qiagen) was used in the RT reaction according to manufacturer’s instructions. The cDNA obtained was used as the template in the subsequent polymerase chain reaction (PCR) to amplify the FAAH gene using gene specific primers NRC189 with sequence 5’CATATGCACCACCATCATCACCACACATCTTCTTCATTAAGTAAAAGTAGTAG3’ and NRC 190. Primer NRC189 contained a restriction enzyme
NdeI site and nucleotides coding for 6 histidine (HIS) residues and primer NRC190 contained a restriction enzyme
SalI site. PCR cycle conditions were 94°C melting (1
min), 55°C annealing (1
min), and 68°C extension (2.0
min), and after 20 cycles of amplification, the PCR product obtained was ligated into pCR2.1 plasmid using TA cloning kit (Invitrogen, Burlington, Ontario, Canada) according to manufacturer’s instruction. The ligated FAAH cDNA in pCR2.1 was transferred by electroporation into
E.coli TOP10F’ (Invitrogen). The clones obtained were examined by sequencing using M13 forward and reverse primers for having the correct cDNA insert and the right clone was called as pCR2.1-FAAH.
Cloning of FAAH into HIS tag fusion protein expression system in Dictyostelium
FAAH was expressed as a tagged protein, fused with 6 Histidine (HIS) residues at the N-terminal end of FAAH using the pDEXRH expression vector [
34]. Two oligonucleotides were synthesized for use in the PCR amplification of FAAH cDNA from the vector pCR2.1-FAAH containing full length FAAH cDNA. Oligonucleotides NRC214 with sequence 5’AAGCTTAAAAAATGCACCACCATCATCACCACACATCTTCTTCATTAAGTAAAAGTAGTAG3’and NRC215 with sequence 5’AAGCTTTTAGTTATTTGGGTTTGTGCAATTTG3’ were used as 5’ and 3’ primers respectively. Primer NRC214 contained a
HindIII restriction enzyme site and nucleotides coding for 6 histidine (HIS) residues and primer NRC215 contained a
HindIII restriction enzyme site that allowed insertion of the PCR fragment into pDEXRH vector. PCR cycle conditions were 94°C melting (1
min), 54°C annealing (1
min), and 68°C extension (2.0
min), and after 20 cycles yielded sufficient DNA to proceed with the cloning steps. The PCR product obtained was digested with restriction enzyme
HindIII and ligated into
HindIII digested pDEXRH vector. The ligated FAAH cDNA was transferred into
E.coli DH10B by electroporation. The clones obtained were examined for having the full length FAAH cDNA insert by restriction digestion mapping and DNA sequencing using gene specific primers. The right clones obtained in
E.coli DH10B were designated pDEXRH-FAAH. The protein expression plasmid pDEXRH-FAAH was transformed into Dictyostelium strain AX3 by electroporation [
35] with the Gene pulser XCell (Bio-Rad). The Dictyostelium target strain was screened by selecting on G418 antibiotic for cells that produced a 70
kDa fusion protein. The Dictyostelium cell line which expressed HIS-FAAH fusion protein was designated AX3FAAH.
Expression of HIS-FAAH protein and purification using nickel–nitrilotriacetic acid resin (Ni-NTA) from Dictyostelium
A 20
ml culture of Dictyostelium expression strain AX3FAAH at a density of 3x10
6 cells ml
-1 was inoculated into 1
L of liquid nutrient medium in a 4
L Erlenmeyer flask and shaken at 150
rpm at 22-24°C. Cell density was determined by taking an aliquot of the culture and counting it in a standard hemocytometer. For all the AX3FAAH expression cultures, G418 antibiotic at a concentration 10 μg ml
-1 was added to maintain the selection pressure on the integrated recombinant plasmid. When the culture reached a cell density of 3x10
6cells ml
-1, the cells were harvested and pelleted at 1000
xg for 10
min at 4°C. The cells were lysed by freeze thaw using lysis buffer (20
mM Tris-Cl, 200
mM KCl, 10
mM Imidazole,10
mM
β-mercaptoethanol and 0.1% Triton X-100, pH 9.0) containing complete protease inhibitor mixture, EDTA-free (Roche Applied Science, Laval, Quebec, Canada) and homogenized using a Wheaton Potter-Elvehjem homogenizer with a PTFE pestle (Fisher Scientific). Homogenized lysates were centrifuged at 100,000
xg for 50
min at 4°C, and the supernatant fraction was batch bound to 3
ml of Ni-NTA resin (Qiagen) at 4°C for 1
h. Protein bound Ni-NTA resin was then packed in a column using gravity flow. The column was washed with 10 column volumes of lysis buffer containing10mM imidazole and 300
mM KCl. To elute the protein of interest a linear gradient was applied from 10 to 100
mM imidazole in lysis buffer over 30 column volumes before a final pulse of 10 column volumes of lysis buffer containing 200
mM imidazole. Fractions containing the purified protein of interest as determined by SDS–PAGE (10%) and Coomassie staining were pooled and dialyzed overnight against dialysis buffer (20
mM Tris-Cl, pH 9.0, 50
mM NaCl) at 4°C. Protein concentrations were estimated by Bradford assay and the yields were typically 2–4
mg
L
–1 of cell culture.
Cloning of FAAH into maltose binding protein (MBP) fusion expression system in E.coli
FAAH was expressed as a tagged protein, fused with maltose binding protein using pCWMalET expression vector [
36]. Full length FAAH cDNA containing a HIS tag at the N-terminus was obtained by digesting pCR2.1-FAAH plasmid with restriction enzymes
NdeI and
SalI and ligated into
NdeI and
SalI digested pCWMalET vector and the clone obtained was designated pCWMalET-FAAH. The clone obtained was examined for protein expression in
E.coli BL21 [DE3] (Novagen, Madison, WI).
Expression of MBP-FAAH fusion protein and purification using amylose resin
A fresh overnight culture of BL21 containing pCWMalET-FAAH vector was diluted 100 fold in LB medium containing 100μg/ml of ampicillin. 1 to 4 liters of culture was grown at 25°C in the presence of 0.2% glucose, induced at an OD600 of 0.6 with 0.1
mM isopropyl-1-thio-β-D-galactopyranoside and harvested 5
h later. Cell pellets were resuspended in lysis buffer (20
mM Tris-Cl, pH 9.0, 200
mM NaCl, 1
mM EDTA, 10
mM-
β-mercaptoethanol) containing complete protease inhibitor mixture, EDTA-free (Roche Applied Science). The cells were disrupted by two passes through an emulsiflex C5 (20,000
psi) (Avestin, Ottawa, Canada). Lysates were centrifuged at 100,000
xg for 50
min at 4°C, and the supernatant fraction was batch bound to 3
ml of amylose resin (NEB, Pickering, Ontario) at 4°C for 1
h. Protein bound amylose resin was then packed in a column using gravity flow. The column was washed with 10 column volumes of lysis buffer containing 300
mM NaCl and the Protein of interest was eluted using 15
mM maltose in lysis buffer over 5 column volumes. Fractions containing purified protein of interest were determined by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) (10%) and Coomassie staining and pure protein fractions of interest were pooled and dialyzed overnight against dialysis buffer (20
mM Tris-Cl, pH 9.0, 50
mM NaCl) at 4°C. Yields of purified protein were typically 8–10
mg
L
–1 of cell culture.
FAAH Enzyme activity assays
Hydrolysis of anandamide by HIS-FAAH and MBP-FAAH was determined by Capillary electrophoresis electron spray mass spectroscopy (CE-ES-MS). To 100μl of reaction buffer (20
mM Tris–HCl, pH 9.0, 50
mM NaCl, 10% DMSO) was added 100μg of anandamide substrate from 10
mg
ml
-1 stock prepared in methyl acetate. Enzyme reaction was initiated by adding 10μg of HIS-FAAH or MBP-FAAH enzyme (from 0.2
mg
ml
-1 stock, in 20
mM Tris-Cl, pH 9.0, 50
mM NaCl) and incubated at 37°C for 30
min and the reaction was analyzed by CE-ES-MS. For kinetic analysis, the rates of FAAH catalyzed hydrolysis of
p-nitroanilide substrates, arachidonoyl
p-nitroaniline (A
pNA) and decanoyl
p-nitroaniline (D
pNA) were determined by monitoring the release of
p-nitroaniline (
ϵ =13500
M
-1cm
-1) at 380
nm using a microplate reader (PowerWave X, Biotech Instruments Inc., Winooski, VT.). Substrate conversion was extrapolated from
A380 versus
p-nitroaniline standard curves using microplate reader. Specifically, enzyme reactions were initiated by adding 50μl HIS-FAAH enzyme (from 0.2
mg
ml
-1 stock, in 20
mM Tris-Cl, pH 9.0, 50
mM NaCl) to 100μl of reaction buffer (20
mM Tris-Cl, pH 9.0, 50
mM NaCl and 0.5% Triton X-100,) containing different concentration (20-300μM) of A
pNA and D
pNA substrates made in DMSO and the final concentration of DMSO in the reaction was adjusted to 10%. Enzyme reactions were performed in 96-well microplate at 37°C, presence of 0.5% Triton X-100 and 10% DMSO. Enzyme specific activity points were determined in triplicate and fitted into Michaelis-Menten curve.
Capillary electrophoresis electrospray mass spectroscopy (CE-ES-MS) analysis of anandamide hydrolysis by FAAH
CE-ES-MS analyses of enzymatic reactions were performed on an Applied Biosystems/MDS Sciex 4000QTRAP (Concord, ON, Canada) coupled to a Prince Technologies CE system (Emmen, The Netherlands), using chloroform-methanol (50%v/v) as the separation buffer. Spectra were acquired using precursor ion scanning for anandamide (
m/z 346.3) and its hydrolyzed product arachidonic acid (
m/z 303.5) using negative-ion mode, with orifice voltage and electron spray needle voltage set at 30
V and −5.4
kV respectively.
Production of anti FAAH polyclonal antibody
Polyclonal antibodies specific for FAAH were obtained by immunizing New Zealand white rabbits with recombinant FAAH protein purified from
E.coli. Recombinant MBP-FAAH protein expressed in
E.coli was purified using amylose resin and pure MBP-FAAH was cleaved by thrombin, to separate FAAH from MBP. Pure FAAH was obtained by Ni-NTA affinity purification and was used to immunize two rabbits using 100μg of protein antigen per animal. At day 1 prime immunization of 100μg ml
-1 of antigen was done using complete Freund’s adjuvant (according to manufacturer’s instruction) by sub-cutaneous injection of 0.5
ml at two sites. At day 28 animals were boosted with 100μg ml
-1 protein per animal using incomplete Freund’s adjuvant. At day 56 a second booster injection identical to the first booster injection was performed and at day 69 the animals were bled to check for the antibody titre.
Gel electrophoresis and Western blotting
Protein samples diluted with 1:1 sample buffer (60
mM Tris–HCl, pH 6.8, 2% SDS, 10% glycerol, 0.025% bromophenol blue) were separated on 10% polyacrylamide – SDS gels. For Western blotting analysis, separated proteins were electrophoretically transferred onto a polyvinylidene fluoride membrane (PVDF, 0.2μm, BioRad). Protein bound PVDF membranes were blocked with 5% milk and incubated with polyclonal anti-FAAH antibody raised in rabbits at a dilution of 1:2000 and secondary antibody anti-rabbit IgG conjugated to horseradish peroxidase (Sigma-1:3000) to detect FAAH from wild type cells. To detect HIS tagged recombinant proteins PVDF membrane were incubated with horseradish peroxidase (HRP) conjugated anti-HIS antibody (Sigma- 1:3000) and analyzed using Western Pico chemiluminescence (Pierce) and X-ray film exposure.
1
