PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Toxicon. Author manuscript; available in PMC Oct 1, 2013.
Published in final edited form as:
PMCID: PMC3411878
NIHMSID: NIHMS382254
Expression and isotopic labelling of the potassium channel blocker ShK toxin as a thioredoxin fusion protein in bacteria
Shih Chieh Chang,a Charles A. Galea,a Eleanor W W. Leung,a Rajeev B. Tajhya,b Christine Beeton,b Michael W. Pennington,c and Raymond S. Nortona*
aMedicinal Chemistry, Monash Institute of Pharmaceutical Sciences, Monash University, Parkville, Victoria 3052, Australia
bDepartment of Molecular Physiology and Biophysics, Baylor College of Medicine, Houston, TX 77030, USA
cPeptides International, 11621 Electron Drive, Louisville, KY 40299, USA
*Corresponding author. Phone +61 3 9903 9167. Fax: +61 3 9903 9582. ray.norton/at/monash.edu
The polypeptide toxin ShK is a potent blocker of Kv1.3 potassium channels, which play a crucial role in the activation of human effector memory T-cells (TEM). Selective blockers constitute valuable therapeutic leads for the treatment of autoimmune diseases mediated by TEM cells, such as multiple sclerosis, rheumatoid arthritis, and type-1 diabetes. We have established a recombinant peptide expression system in order to generate isotopically-labelled ShK and various ShK analogues for in-depth biophysical and pharmacological studies. ShK was expressed as a thioredoxin fusion protein in Escherichia coli BL21 (DE3) cells and purified initially by Ni2+ iminodiacetic acid affinity chromatography. The fusion protein was cleaved with enterokinase and purified to homogeneity by reverse-phase HPLC. NMR spectra of 15N-labelled ShK were similar to those reported previously for the unlabelled synthetic peptide, confirming that recombinant ShK was correctly folded. Recombinant ShK blocked Kv1.3 channels with a Kd of 25 pM and inhibited the proliferation of human and rat T lymphocytes with a preference for TEM cells, with similar potency to synthetic ShK in all assays. This expression system also enables the efficient production of 15N-labelled ShK for NMR studies of peptide dynamics and of the interaction of ShK with Kv1.3 channels.
Keywords: ShK, potassium channels, protein expression, isotopic labelling, NMR
Sea anemones produce many polypeptide toxins and proteins that are potent ion channel blockers and cytolysins. The first potassium channel blocker to be isolated and characterized from a sea anemone was ShK toxin, from Stichodactyla helianthus (Castaneda et al., 1995; Pennington et al., 1995), which is a 35-residue peptide containing six half-cystines that form three disulfide bonds (Pohl et al., 1995) (Fig 1A). Its solution structure, determined by NMR spectroscopy (Tudor et al., 1996; Tudor et al., 1998), consists of two short α-helices encompassing residues 14–19 and 21–24, and an N-terminus with an extended conformation up to residue 8, followed by a pair of interlocking turns that resembles a 310-helix (Fig 1B).
Fig. 1
Fig. 1
Structure of ShK. (A) ShK sequence showing its three disulfide bonds: Cys3 to Cys35, Cys12 to Cys28 and Cys17 to Cys32. (B) Ribbon view of the solution structure of ShK (PDB ID: 1ROO) where the disulfide bonds are coloured grey. (C) Surface representation (more ...)
The surface of ShK involved in binding to voltage-activated (Kv) potassium channels has been mapped using alanine scanning and selected synthetic analogues (Pennington et al., 1996a; Pennington et al., 1996b). Alanine scanning mutagenesis identified the conserved dyad Lys 22 and Tyr23 as key functional residues (Fig 1C). Other residues contributing to Kv1.3 binding include Arg11, His19, Ser20 and Arg24 (Pennington et al., 1996a; Rauer et al., 1999). These essential residues were found to be clustered on a surface of the peptide that binds to a shallow vestibule at the outer entrance to the ion conduction pathway and occludes the entrance to the pore (Pennington et al., 1996a; Rauer et al., 1999). To examine this interaction in more detail, the solution structure of ShK (Kalman et al., 1998; Tudor et al., 1996) was docked to a homology model of the Kv1.3 channel based on the crystal structure of the bacterial potassium channel KcsA (Doyle et al., 1998; Rauer et al., 2000), using restrained molecular dynamics simulations guided by data from complementary mutational analyses (Lanigan et al., 2002; Rauer et al., 2000). The model reveals that Lys22 of ShK projects into the ion conduction pathway while Arg11 is in close proximity to His404 in one of the Kv1.3 subunits.
All human T lymphocytes express two types of K+ channels, the voltage-gated Kv1.3 and the Ca2+-activated KCa3.1 channels, which play crucial roles in human T-cell activation (Leonard et al., 1992; Price et al., 1989). The expression levels of these two K+ channels are dependent upon the state of T-cell activation and differentiation (Wulff et al., 2003a). Naïve CD4+ or CD8+ T cells initially differentiate into long-lived central memory (TCM) T cells, which then differentiate into terminally-differentiated effector memory (TEM) cells upon repeated stimulation. Kv1.3 channels are significantly up-regulated in activated TEM cells, leading to a heightened sensitivity to Kv1.3 channel blockers (Beeton et al., 2006; Wulff et al., 2003b). Activation of naïve and central-memory (TCM) cells, by contrast, results in up-regulation of KCa3.1 channel expression and decreased sensitivity to Kv1.3 channel blockade (Wulff et al., 2003a). The differential expression of Kv1.3 and KCa3.1 K+ channels in activated TEM and TCM cells implies that it may be possible to selectively suppress TEM cells using a Kv1.3-specific inhibitor without causing generalized immunosuppression. Kv1.3 blockers therefore constitute valuable new therapeutic leads for the treatment of autoimmune diseases mediated by TEM cells, such as multiple sclerosis (MS) and rheumatoid arthritis (Beeton et al., 2011; Beeton et al., 2006; Chi et al., 2012; Wulff et al., 2003b)
Patch-clamp experiments on cloned potassium channels expressed in mammalian cells revealed that ShK blocked not only Kv1.3 (Kd 11 pM) but also Kv1.1 (Kd 16 pM), Kv1.7 (Kalman et al., 1998) and Kv3.2 channels (Beeton et al., 2005; Yan et al., 2005) in the nanomolar range. This lack of specificity constitutes a potential drawback for the use of ShK as a therapeutic agent. For example, lack of selectivity for Kv1.3 over the neuronal Kv1.1 channels could prove detrimental if ShK were to enter the brain through a compromised blood-brain barrier and induce neurotoxicity. It was therefore essential to develop ShK analogues that are selective for Kv1.3 over Kv1.1 and other K+ channels. Towards this goal, more selective analogues have been made by the incorporation of non-natural amino acids or adducts; these include ShK-Dap22, in which the critical Lys22 was replaced by the shorter, positively charged, non-natural residue 1,3-diaminopropionic acid (Dap) (Kalman et al., 1998); ShK-F6CA, a fluorescein-labelled analogue of ShK (Beeton et al., 2003); and analogues with either phospho-Tyr (ShK-186) or phosphono-Phe (ShK-192) attached via a hydrophilic linker (i.e aminoethyloxyethyloxyacetyl) to Arg1 (Beeton et al., 2005; Pennington et al., 2009). However, these analogues have several potential limitations, for example, ShK-186 and ShK-192 contain non-protein adducts while the phosphorylated residue of ShK-186 is susceptible to hydrolysis. As a result, there is still scope for the development of new analogues with enhanced stability and increased specificity for Kv1.3.
In this study we report the cloning, expression and purification of ShK in Escherichia coli. The majority of the expressed protein formed insoluble inclusion bodies but the protein was successfully refolded and the final ShK yields obtained from rich and minimal media were 3 mg/L and 2.5 mg/L, respectively. NMR spectroscopic analyses of 15N-labelled ShK indicated that the protein was correctly folded while electrophysiological studies showed that recombinant ShK blocked Kv1.3 channels with a similar efficiency to that of the synthetic peptide.
2.1 Construction of pET32a/ShK expression plasmid
DNA encoding the amino acid sequence of ShK and an N-terminal enterokinase cleavage site was synthesized by PCR using two overlapping primers and was cloned into a pET-32a expression vector (Novagen, USA). For efficient protein expression in bacterial cells, the DNA template was designed based on optimized codons for expression in E. coli. The forward primer (5’-CCAAGAGAATTCGATGATGATGATAAACGCAGCTGCATTGATACCATTCCGAAAAGCCGCTGCACCGCGTTTCAGTGCAAACAT) contained an EcoRI restriction endonuclease cleavage site (underlined) and enterokinase recognition site (double underlined). The reverse primer (5’AAGATCAAGCTTCTAGCAGGTGCCGCAGGTTTTGCGGCAAAAGCTCAGGCGATATTTCATGCTATGTTTGCACTGAAACGCGGT) contained a HindIII restriction endonuclease cleavage site (underlined). The PCR reaction mixture contained 50 pmol of each primer and 2.5 U of Taq DNA polymerase in a final volume of 50 µL. PCR amplification was performed by heating at 94 °C for 5 min followed by 30 cycles at 94 °C for 1 min, 55 °C for 1 min, 72 °C for 3 min and a final extension at 72 °C for 5 min. The amplified PCR product was digested with the restriction endonucleases EcoRI and HindIII and ligated into the thioredoxin-fusion tag-containing pET-32a vector. The sequence of the Trx-ShK fusion protein was confirmed by bi-directional nucleotide sequencing using the T7 promoter and terminator primers.
2.2 Expression of Trx-ShK fusion protein
E. coli BL21(DE3) cells transformed with the pET-32a-ShK expression vector were grown overnight at 37 °C in Luria-Bertani (LB) medium containing 100 µg/mL ampicillin. 1 L LB broth was inoculated with 1% of overnight culture and incubated at 37 °C with agitation at 200 rpm until the optical density at 600 nm (OD600) reached 0.5. The culture was incubated at 18 °C for 1 h before the culture was induced with isopropyl-β-D-thiogalactoside (IPTG, Astral Scientific) at a final concentration of 1 mM. The culture was further grown overnight at 18 °C and the cells were pelleted by centrifugation at 6000 g for 10 min at 4 °C and then stored at – 80 °C until further processing. Expression was analyzed by SDS polyacrylamide gel electrophoresis (12 % Bis-Tris SDS-PAGE gel, Bio-Rad) and the identity of the Trx-ShK fusion protein was confirmed by in-gel digestion with trypsin followed by LC/MS/MS analysis (Joint ProteomicS Laboratory, Parkville, Australia).
2.3 Refolding of Trx-ShK fusion protein
The cell pellet was thawed and lysed at room temperature for 30 min in a solution of 5 mL bugbuster master mix (Novagen) per gram of wet cell pellet containing 1 × protease inhibitor cocktail (lacking EDTA) (Roche, Germany). The lysed cells were centrifuged at 20,000 g for 20 min at 4 °C to pellet the inclusion bodies and the pellet was first washed with ice-cold buffer containing 2 M urea, 20 mM Tris, pH 8.0, 0.5 M NaCl, 2 % Triton X-100 and then briefly sonicated before spinning at 20,000 g for 10 min at 4 °C. The cell pellet was washed repeatedly with the urea-containing buffer solution and then with buffer alone. Subsequently, the inclusion bodies were resuspended in solublization buffer (20 mM Tris, pH 8.0, 0.5 M NaCl, 20 mM imidazole, 6 M guanidine hydrochloride, 1 mM DTT) and stirred for 60 min at room temperature. The sample was centrifuged for 20 min at 20,000 g at 4 °C and the supernatant was filtered through a 0.22 µm filter before being loaded onto a metal-chelating affinity column (5 mL Ni Sepharose, GE healthcare, USA) with a flow-rate of 1 mL/min. The column was washed with 2 column volumes of solublization buffer followed by 10 column volumes of wash buffer (20 mM Tris, pH 8.0, 0.5 M NaCl, 20 mM imidazole) containing 1 mM DTT, and 6 M urea. Immobilized protein was refolded on-column with a linear gradient of 6 to 0 M urea and 1 to 0 mM DTT at a flow-rate of 1 mL/min over 50 min at room temperature. The immobilized refolded protein was eluted with 20 column volumes of elution buffer (20 mM Tris, pH 8.0, 0.5 M NaCl, 0.5 M imidazole).
2.4 Purification of recombinant ShK
The Trx-ShK fusion protein was dialyzed extensively against enterokinase cleavage buffer (50 mM Tris, pH 8.0, 50 mM NaCl, 2 mM CaCl2) at 4 °C for 24 h and then incubated with enterokinase (0.06 % w/w) at room temperature for 48 h. The cleaved protein was loaded onto a C18 reverse-phase high-performance liquid chromatography (RP-HPLC) column (Phenomenex, 100 × 10mm) equilibrated in buffer A (99.9 % water and 0.01 % TFA). Proteins were eluted with an acetonitrile gradient in 0.01 % TFA (0–26 % over 30 min followed by 26–64 % over 5 min). Eluted fractions containing ShK were lyophilized for storage.
2.5 Expression of 15N-labelled ShK
15N-labelled Trx-ShK fusion protein was expressed in E. coli BL21(DE3) using M9 minimal medium supplemented with 100 µg/mL ampicillin. The M9 medium contained 1 g/L 15NH4Cl (Cambridge Isotope Labs) as the sole nitrogen source and 4 g/L glucose as the carbon source. Cultures were grown at 37 °C until mid-log phase (OD600 =0.5) was reached, cooled at 18 °C for 1 h and then induced by adding IPTG to a final concentration of 1 mM. The cultures were incubated overnight with agitation at 18 °C. The cells were pelleted by centrifugation at 6000 g for 10 min at 4 °C, lysed with bugbuster master mix containing protease inhibitors, and protein in the pellet (inclusion bodies) was purified as outlined in sections 2.3 and 2.4 above.
2.6 Determination of recombinant protein concentration, purity and mass
Protein and peptide concentrations were determined using the bicinchoninic acid (BCA) assay (Pierce) with bovine serum albumin as a standard. The BCA assay was calibrated against peptide content by amino acid analysis on several ShK samples (Florey Neuroscience Institutes, Australia). Protein purity was determined by SDS-PAGE on 12 % gels using Coomassie blue staining and analytical RP-HPLC.
Protein mass was determined by electrospray ionisation time-of-flight (ESI-TOF) mass spectrometry using a Waters LCT TOF LC/MS Mass Spectrometer coupled to a 2795 Alliance Separations module and Masslynx software version 4.1 (Waters, Australia). Mass spectra were created by averaging the scans across each total ion current peak and subtracting background. The mass spectrometer conditions were as follows: ionisation mode electrospray ionisation, desolvation gas flow 550 L/h, desolvation temperature 250 °C, source temperature 110 °C, capillary voltage 2400 V, sample cone voltage 60 V, scan range acquired 100–1500 m/z, scan time: 1 sec, internal reference ions positive ion mode = m/z = 556.2771.
2.7 NMR spectroscopy
NMR spectra were recorded on samples of 0.2 mM unlabelled or 0.6 mM 15N-labelled ShK in 90 % H2O/10 % 2H2O at pH 4.9. The 1D 1H NMR spectrum was acquired on a Bruker DRX 600 MHz spectrometer while the 2D 1H/15N HSQC and SOFAST-HMQC spectra were acquired on a Varian INOVA 600 MHz spectrometer. Both spectrometers were equipped with cryogenic probes. The water resonance was suppressed using the WATERGATE pulse sequence (Piotto et al., 1992). All spectra were collected at 20 °C and referenced to the water resonance. Spectra were acquired over 16384 (1D) or 4096 (2D) data points, with a 1H spectral width of 14 ppm. The 1D spectrum was acquired with 1024 scans. The HSQC was acquired with 32 scans per increment using 2048 points in the proton dimension and 192 increments in the 15N dimension. The SOFAST-HMQC spectrum (Schanda and Brutscher, 2005) was acquired with 32 scans per increment using 2048 points in the proton dimension and 40 increments in the 15N dimension. The 15N dimension of the SOFAST-HMQC spectrum was extended to 120 points with linear prediction. The 15N dimension of both spectra was apodized with a shifted sine-bell apodization function and zero filled to 1024 complex points prior to Fourier transformation. The spectral widths were 14.0 and 40 ppm in the 1H and 15N dimensions, respectively. The 3D 15N-edited NOESY-HSQC spectrum was acquired with a mixing time of 120 ms, 16 scans per increment, 2048 complex points in the acquisition dimension, and 96 and 80 increments in the indirect 1H and 15N dimensions, respectively.
2.8 Animals, cells and cell lines
L929 mouse fibroblast cells stably expressing mKv1.1 and mKv1.3 channels (Grissmer et al., 1994) were gifts from Dr. K. George Chandy (University of California, Irvine). They were maintained in DMEM medium (Invitrogen, Carlsbad, CA) supplemented with 10 IU/mL penicillin, 0.1 µg/mL streptomycin, 2 mM L-glutamine, 10 % heat-inactivated fetal bovine serum, and 0.5 mg/mL G418 (EMD Chemicals, Gibbstown, NJ).
Female Lewis rats (8–10 weeks old) were purchased from Harlan-Sprague Dawley (Indianapolis, IN, USA) and housed under pathogen-free conditions with food and water ad libitum. Animals were euthanised under a Baylor College of Medicine Animal Use and Care Committee approved protocol for blood, spleen, and thymus collection, as described (Beeton and Chandy, 2007).
Freshly prepared buffy coats were purchased from the Gulf Coast Regional Blood Center (Houston, TX) under a protocol approved by the Baylor College of Medicine Institutional Review Board. Mononuclear cells were isolated from the buffy coats using Histopaque-1077 gradients (Sigma, St Louis, MI) and used immediately.
Ovalbumin-specific TEM cells expressing high levels of Kv1.3 channels upon activation were a gift from Dr. Alexander Flügel (University of Göttingen, Germany) and were maintained in culture as described previously (Kawakami et al., 2005; Matheu et al., 2008).
2.9 Electrophysiological analysis
Experiments were conducted at room temperature in the whole-cell configuration of the patch-clamp technique. The patch pipettes had a resistance of 2–4 MΩ when filled with a solution containing (in mM): 145 KF, 10 HEPES, 10 EGTA, and 2 MgCl2, pH 7.2, 290 mOsm. The bath solution contained (in mM): 160 NaCl, 4.5 KCl, 2 CaCl2, 1 MgCl2, 10 HEPES, pH 7.2, 300 mOsm. Kv currents were elicited every 30 s by 200-ms depolarizing pulses from a holding potential of −80 mV to 40 mV. Kd values and Hill coefficients were determined by fitting the Hill equation to the reduction of peak current measured at 40 mV.
2.10 T lymphocyte proliferation assays
Proliferation assays were conducted as described previously (Beeton et al., 2001a; Beeton et al., 2005; Matheu et al., 2008). Briefly, mononuclear cells (105 /well) or rat ovalbumin-specific TEM cells (5×104 /well) were plated into 96-well plates and pre-incubated with the peptide blockers for 45 min at 37 °C in RPMI medium (Invitrogen) supplemented with 10 IU/mL penicillin, 0.1 µg/mL streptomycin, 2 mM L-glutamine, 1 mM sodium pyruvate, 1% non-essential amino acids, 1% RPMI vitamins, 50 µM β-mercaptoethanol, and 1% heat-inactivated fetal bovine serum (human cells) or 1% Lewis rat serum (rat cells). Human T lymphocyte activation and proliferation was induced by the addition of 60 ng/mL anti-CD3 antibodies (Clone OKT3, eBioscience, San Diego, CA). Rat splenocytes were stimulated with 1 µg/mL concanavalin A (Sigma). Rat TEM cells were stimulated with 10 µg/mL ovalbumin in the presence of irradiated thymocytes as antigen-presenting cells. Cells were cultured for 72 h at 37 °C, 5% CO2, and [3H] thymidine was added during the last 16–18 h of culture. Cells were lysed by freezing at −20 °C. After thawing, DNA was harvested onto fibreglass filters using a cell harvester (Inotech Biosystems International, Rockville, MD). [3H] thymidine incorporation into the DNA of proliferating cells was measured using a β-scintillation counter (Beckman Coulter, Brea, CA).
3.1 Expression of Trx-ShK
The Trx-ShK fusion protein (Fig 2A) was highly expressed upon induction with 1 mM IPTG at 18 °C overnight. SDS-PAGE analysis showed the appearance of an intense band at about 25 kDa (Fig. 2B, lane 2). Protein was expressed as inclusion bodies (Fig 2C, lane 2), with yields of 2 g per L from both LB and M9 media, while only a small portion of the Trx-ShK fusion protein was soluble (18 mg/L of LB and 10 mg/L of M9 media). The identity of the Trx-ShK fusion protein was confirmed by in-gel trypsin digestion followed by LC/MS/MS peptide sequence analysis.
Fig. 2
Fig. 2
Expression and purification of Trx-ShK. (A) Schematic of thioredoxin-ShK fusion protein. The N-terminal thioredoxin (red) and C-terminal ShK (yellow) proteins were fused by a polypeptide linker containing a hexa-His Tag (blue) and an enterokinase recognition (more ...)
3.2 Refolding and purification of ShK
Inclusion bodies containing the His-tagged Trx-ShK fusion protein were solubilized in denaturant and loaded onto an NTA column, then the bound protein was refolded by gradual removal of denaturant The partially purified Trx-ShK fusion protein was eluted from the Ni-chelating column (Fig 2D) and then cleaved with enterokinase. The cleaved fusion protein (Fig 2D, lane 2) was purified to homogeneity by RP-HPLC (Fig 3A). Analytical RP-HPLC and SDS-PAGE showed that purified ShK was essentially homogenous (Fig 3B).
Fig. 3
Fig. 3
Characterisation of recombinant ShK. (A) RP-HPLC chromatogram where peaks 1 and 2 correspond to recombinant ShK and the cleaved thioredoxin fusion partner, respectively. The right axis represents the percentage of acetonitrile. (B) Analytical RP-HPLC (more ...)
High-resolution ESI-TOF analysis (Fig 3C) of recombinant ShK toxin produced an average mass of 4055 ± 0.01 Da. This value was identical to the theoretical mass of 4055 Da for ShK toxin with all six cysteines engaged in the three native disulfide bonds (Pohl et al., 1995). For the fully 15N-labelled ShK, ESI-TOF analysis yielded a mass of 4109 ± 0.00 Da which was also identical to the theoretical mass of 4109 Da. The yields, determined by amino acid analysis, were about 3 mg/L of unlabelled peptide from LB and 2.5 mg/L of 15N-labelled peptide from M9 media.
3.3 NMR spectroscopy
NMR spectroscopy was used to determine whether recombinant ShK was correctly folded in solution. The 1D 1H (Fig. 4) and 2D 1H/15N HSQC (Fig. 5A) spectra exhibited well dispersed peaks with narrow linewidths, as expected for a small folded protein. Comparison with the published NMR spectral data for synthetic ShK (Fig.4) (Tudor et al., 1998) demonstrated that the recombinant protein adopted a similar fold to synthetic ShK in solution. Recombinant ShK displayed sharp peaks across the spectrum and a peak at 10.87 ppm corresponding to Thr31, as previously reported for the synthetic peptide (Fig. 4) (Tudor et al., 1998).
Fig. 4
Fig. 4
1D 1H NMR spectra (600 MHz) of recombinant unlabelled ShK (top, in black) and synthetic ShK (bottom, in red). The samples were prepared in 90 % H2O/10 % 2H2O at pH 4.9, 293 K. The residual water resonance between 4.75 ppm and 5.25 ppm was replaced with (more ...)
Fig. 5
Fig. 5
(A) [1H- 15N] HSQC spectrum of 15N-labelled ShK recorded in 90 % H2O/10 % 2H2O at pH 4.9 and 293 K. Lys and Arg side chain peaks, which were folded from outside the acquired 15N spectral width, are highlighted by a box. The amide side chain peaks of Gln16 (more ...)
The Met21 resonance of 15N-labelled recombinant ShK in the HSQC spectrum (Fig 5A) was significantly weaker than those from most of the residues. Other residues such as Arg1 and Pro8 were not expected to show cross peaks in this 15N-1H HSQC spectrum, while the Ser2 and Cys3 resonances were significantly broadened as a consequence of intermediate exchange with the solvent water resonance (Tudor et al., 1998). Assignments of NH cross peaks in the HSQC spectrum were confirmed by recording a 3D NOESY-HSQC spectrum, representative strips from which are shown in Fig S1.
Recently, we showed that SOFAST-HMQC spectra have the potential to recover cross peaks from amides in intermediate exchange with water (Yao et al., 2011). As shown in Fig 5B, a SOFAST-HMQC spectrum gave well-defined, intense cross peaks from Cys3 and Met 21, although the peak from Ser2 was still absent. This result further confirms the correct folding of recombinant ShK. More generally, the SOFAST-HMQC method should be useful for many peptide toxins containing solvent-exposed amides whose cross peaks may be weakened or eliminated by exchange with the water.
3.4 K+ channel blocking activity
Native and synthetic ShK block Kv1.1 and Kv1.3 channels with similar potencies in whole-cell patch-clamp assays (Beeton et al., 2003; Kalman et al., 1998). To determine whether recombinant ShK also blocked Kv1.1 and Kv1.3 channels with a similar potency to the native and synthetic proteins we measured the ability of recombinant and synthetic ShK to block mouse Kv1.3 (mKv1.3) and mouse Kv1.1 (mKv1.1) channels stably expressed in L929 cells (Fig 6). As expected, synthetic ShK blocked both channels with equivalent potencies (Kd = 10 ± 2 pM on mKv1.3 and 21 ± 3 pM on mKv1.1) and a Hill coefficient of 1. Recombinant ShK exhibited similar affinity for both channels, with Kd values of 25 ± 10 pM for mKv1.3 and 15 ± 5 pM for Kv1.1. The differences between the potencies of recombinant and synthetic ShK against Kv1.3 and Kv1.1 are not statistically significant.
Fig. 6
Fig. 6
Recombinant ShK exhibits a high affinity for Kv1.3 and Kv1.1 K+ channels. (A) Effect of recombinant ShK (rShK) on mKv1.3 currents in stably transfected L929 cells. (B) Effect of synthetic ShK (sShK) on mKv1.1 currents in stably transfected L929 cells. (more ...)
The activity of recombinant ShK on the proliferation of freshly-isolated human peripheral blood T lymphocytes was compared with that of the well-characterized Kv1.3 channel blocker ShK-186 (Beeton et al., 2006; Matheu et al., 2008; Pennington et al., 2009). Recombinant ShK inhibited the proliferation of human T lymphocytes with an IC50 of 2.2 ± 0.4 nM, a value very similar to that reported previously for ShK-186 (IC50 4.1 ± 0.4 nM) (Beeton et al., 2006; Kalman et al., 1998). We also tested its ability to inhibit rat TEM and naïve/TCM lymphocytes; recombinant ShK preferentially inhibited TEM cells proliferation (IC50 738 ± 89 pM) with little effect on the proliferation of naïve/TCM cells, as was previously found for synthetic ShK (Beeton et al., 2001b).
We have developed an efficient bacterial expression system for the sea anemone peptide ShK toxin. Following NTA chromatography, cleavage by enterokinase and RP-HPLC, we obtained pure peptide of the correct mass. Enterokinase has the advantage of leaving no extra residues at the N-terminus of the cleaved recombinant ShK peptide, thus allowing for direct comparison with the native ShK peptide. Our patch-clamp and T-lymphocyte proliferation data show that recombinant ShK has essentially identical activities to those of synthetic ShK (Beeton et al., 2001b; Kalman et al., 1998).
The use of a thioredoxin tag and oxidative refolding proved to be a successful strategy for the production of biologically active recombinant ShK. It has been well documented that various solubility tags can improve the expression of disulfide-bond enriched polypeptide toxins. For example, the sea anemone toxin anthopleurin-B (ApB) was successfully expressed in E. coli as a fusion protein with the gene 9 product of bacteriophage T7 (Gallagher and Blumenthal, 1992). Once purified, the fusion protein was refolded using a coupled glutathione redox system and then cleaved with staphylococcal protease to release ApB with additional Gly and Arg residues at the N-terminus. The total yield of ApB was about 1 mg/L of culture (Gallagher and Blumenthal, 1992). Similar methods were reported for the expression of a scorpion neurotoxin (Turkov et al., 1997) and the sea anemone toxin ATX II (Moran et al., 2006), with yields of 0.5 mg/L and 1.5 mg/L, respectively. In contrast, the short sea anemone toxin ATX III (renamed Av3), with an N-terminal extension of Gly-Ser-Ser-Met-Ala and fused with thioredoxin, was soluble when expressed in E. coli (Moran et al., 2007). The use of an S-tag has been reported to increase the yield of the sea anemone toxin BgK to about 1.8–2.8 mg/L of culture (Braud et al., 2004). Overall, solubility tags and oxidative refolding have been used successfully for the production of various peptide toxins (Quintero-Hernández et al., 2011), some of which can be difficult to synthesize because of the presence of multiple disulfide bonds and the need for efficient oxidative refolding.
The 1D 1H NMR spectrum of recombinant ShK was essentially identical to that of synthetic ShK, indicating that the recombinant protein was correctly folded (Pennington et al., 1999). Previous NMR studies of synthetic ShK showed that all hydrogen-bonded backbone amides had slow or intermediate exchange rates except for Lys18, Ser20 and Met21, which were rapidly exchanging (Tudor et al., 1998). These residues are located within a loop joining the two α helices of ShK (Fig 1) and it was suggested that this region may be more flexible than the surrounding structure. This may partly explain why Met21 exhibits a weaker than expected peak intensity. 15N relaxation experiments will be carried out in future studies to probe the backbone dynamics of ShK over timescales from ps to µs (Kuang et al., 2006; Yao et al., 2004). The backbone amides of Ser2 and Cys3 were affected by exchange with water at pH 4.9 and 293 K (Tudor et al., 1998). The Cys3 resonance was found to be truncated and the Ser2 resonance was too broad to be detected. This observation was in agreement with our findings, where these two peaks were not observed in the HSQC spectrum of recombinant 15N-labelled ShK. However, detection of these peaks in the SOFAST-HMQC spectrum (Fig 5B) suggests that this experiment will be a useful method for recovering some backbone amide cross peaks that are broadened due to intermediate exchange with water (Yao et al., 2011).
Our expression system can be easily scaled up for production of larger quantities of ShK for in vivo studies. In addition, it offers an economical approach to producing isotopically-labelled peptides for NMR studies, thereby enabling studies of the dynamics of ShK in solution and of its interaction with Kv1.3 channels. 15N- and/or 13C-labelled ShK can be used for NMR studies of ShK binding to Kv1.3-KcsA chimeras reconstituted in detergent micelles (Chill et al., 2006; Imai et al., 2010) or lipid bilayers (Lange et al., 2006). The results from such studies, in conjunction with site-directed mutagenesis, will be invaluable in refining our understanding of the interaction of ShK with Kv1.3 leading to the design of ShK analogues with increased specificity for Kv1.3 channels.
Highlights
  • ShK is a potent potassium channel blocker
  • A recombinant expression system for ShK has been established
  • Recombinant ShK is equipotent with synthetic ShK in a range of bioassays
  • Expression yield is maintained in minimal media suitable for isotopic labelling
Supplementary Material
01
Acknowledgments
This work was supported in part by grants from the Australian Research Council (DP1093909 to RSN) and the National Institutes of Health (NS073712 to CB and RSN and AI084981 to CB). RSN acknowledges the award of a fellowship by the National Health and Medical Research Council of Australia.
Abbreviations
TEMeffector memory T-cells
Kvvoltage-gated K+ channel
KCaCa2+-activated K+ channel
ShKK+ channel toxin from Stichodactyla helianthus
Trx-ShKShK fused with thioredoxin solubility tag
HSQCheteronuclear single quantum coherence

Footnotes
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Conflict of interest
Kineta Inc. has licensed a patent on ShK-186 from the University of California and is developing this peptide as a therapeutic for autoimmune disease. The authors MWP and CB are consultants to Kineta Inc.
  • Beeton C, Barbaria J, Giraud P, Devaux J, Benoliel AM, Gola M, Sabatier JM, Bernard D, Crest M, Beraud E. Selective blocking of voltage-gated K+ channels improves experimental autoimmune encephalomyelitis and inhibits T cell activation. J Immunol. 2001a;166:936–944. [PubMed]
  • Beeton C, Chandy KG. Induction and monitoring of adoptive delayed-type hypersensitivity in rats. J Vis Exp. 2007:e325. [PMC free article] [PubMed]
  • Beeton C, Pennington MW, Wulff H, Singh S, Nugent D, Crossley G, Khaytin I, Calabresi PA, Chen CY, Gutman GA, Chandy KG. Targeting effector memory T cells with a selective peptide inhibitor of Kv1.3 channels for therapy of autoimmune diseases. Mol Pharmacol. 2005;67:1369–1381. [PubMed]
  • Beeton C, W Pennington M, S Norton R. Analogs of the sea anemone potassium channel blocker ShK for the treatment of autoimmune diseases. Inflamm Allergy Drug Targets. 2011;10:313–321. [PMC free article] [PubMed]
  • Beeton C, Wulff H, Barbaria J, Clot-Faybesse O, Pennington M, Bernard D, Cahalan MD, Chandy KG, Beraud E. Selective blockade of T lymphocyte K+ channels ameliorates experimental autoimmune encephalomyelitis, a model for multiple sclerosis. Proc Natl Acad Sci U S A. 2001b;98:13942–13947. [PubMed]
  • Beeton C, Wulff H, Singh S, Botsko S, Crossley G, Gutman GA, Cahalan MD, Pennington M, Chandy KG. A novel fluorescent toxin to detect and investigate Kv1.3 channel up-regulation in chronically activated T lymphocytes. J Biol Chem. 2003;278:9928–9937. [PubMed]
  • Beeton C, Wulff H, Standifer NE, Azam P, Mullen KM, Pennington MW, Kolski-Andreaco A, Wei E, Grino A, Counts DR, Wang PH, LeeHealey CJ, S Andrews B, Sankaranarayanan A, Homerick D, Roeck WW, Tehranzadeh J, Stanhope KL, Zimin P, Havel PJ, Griffey S, Knaus H-G, Nepom GT, Gutman GA, Calabresi PA, Chandy KG. Kv1.3 channels are a therapeutic target for T cell-mediated autoimmune diseases. Proc Natl Acad Sci U S A. 2006;103:17414–17419. [PubMed]
  • Braud S, Belin P, Dassa J, Pardo L, Mourier G, Caruana A, Priest BT, Dulski P, Garcia ML, Ménez A, Boulain J-C, Gasparini S. BgK, a disulfide-containing sea anemone toxin blocking K+ channels, can be produced in Escherichia coli cytoplasm as a functional tagged protein. Protein Expr Purif. 2004;38:69–78. [PubMed]
  • Castaneda O, Sotolongo V, Amor AM, Stocklin R, Anderson AJ, Harvey AL, Engstrom A, Wernstedt C, Karlsson E. Characterization of a potassium channel toxin from the Caribbean Sea anemone Stichodactyla helianthus. Toxicon. 1995;33:603–613. [PubMed]
  • Chi V, Pennington MW, Norton RS, Tarcha EJ, Londono LM, Sims-Fahey B, Upadhyay SK, Lakey JT, Iadonato S, Wulff H, Beeton C, Chandy KG. Development of a sea anemone toxin as an immunomodulator for therapy of autoimmune diseases. Toxicon. 2012;59:529–546. [PMC free article] [PubMed]
  • Chill JH, Louis JM, Miller C, Bax A. NMR study of the tetrameric KcsA potassium channel in detergent micelles. Protein Sci. 2006;15:684–698. [PubMed]
  • Doyle DA, Morais Cabral J, Pfuetzner RA, Kuo A, Gulbis JM, Cohen SL, Chait BT, MacKinnon R. The structure of the potassium channel: molecular basis of K+ conduction and selectivity. Science. 1998;280:69–77. [PubMed]
  • Gallagher MJ, Blumenthal KM. Cloning and expression of wild-type and mutant forms of the cardiotonic polypeptide anthopleurin B. J Biol Chem. 1992;267:13958–13963. [PubMed]
  • Grissmer S, Nguyen AN, Aiyar J, Hanson DC, Mather RJ, Gutman GA, Karmilowicz MJ, Auperin DD, Chandy KG. Pharmacological characterization of five cloned voltage-gated K+ channels, types Kv1.1, 1.2, 1.3, 1.5, and 3.1, stably expressed in mammalian cell lines. Mol Pharmacol. 1994;45:1227–1234. [PubMed]
  • Imai S, Osawa M, Takeuchi K, Shimada I. Structural basis underlying the dual gate properties of KcsA. Proc Natl Acad Sci U S A. 2010;107:6216–6221. [PubMed]
  • Kalman K, Pennington MW, Lanigan MD, Nguyen A, Rauer H, Mahnir V, Paschetto K, Kem WR, Grissmer S, Gutman GA, Christian EP, Cahalan MD, Norton RS, Chandy KG. ShK-Dap22, a potent Kv1.3-specific immunosuppressive polypeptide. J Biol Chem. 1998;273:32697–32707. [PubMed]
  • Kawakami N, Nägerl UV, Odoardi F, Bonhoeffer T, Wekerle H, Flügel A. Live imaging of effector cell trafficking and autoantigen recognition within the unfolding autoimmune encephalomyelitis lesion. J Exp Med. 2005;201:1805–1814. [PMC free article] [PubMed]
  • Kuang Z, Yao S, Keizer DW, Wang CC, Bach LA, Forbes BE, Wallace JC, Norton RS. Structure, dynamics and heparin binding of the C-terminal domain of insulin-like growth factor-binding protein-2 (IGFBP-2) J Mol Biol. 2006;364:690–704. [PubMed]
  • Lange A, Giller K, Hornig S, Martin-Eauclaire MF, Pongs O, Becker S, Baldus M. Toxin-induced conformational changes in a potassium channel revealed by solid-state NMR. Nature. 2006;440:959–962. [PubMed]
  • Lanigan MD, Kalman K, Lefievre Y, Pennington MW, Chandy KG, Norton RS. Mutating a critical lysine in ShK toxin alters its binding configuration in the pore-vestibule region of the voltage-gated potassium channel, Kv1.3. Biochemistry. 2002;41:11963–11971. [PubMed]
  • Leonard RJ, Garcia ML, Slaughter RS, Reuben JP. Selective blockers of voltage-gated K+ channels depolarize human T lymphocytes: mechanism of the antiproliferative effect of charybdotoxin. Proc Natl Acad Sci U S A. 1992;89:10094–10098. [PubMed]
  • Matheu MP, Beeton C, Garcia A, Chi V, Rangaraju S, Safrina O, Monaghan K, Uemura MI, Li D, Pal S, de la Maza LM, Monuki E, Flugel A, Pennington MW, Parker I, Chandy KG, Cahalan MD. Imaging of effector memory T cells during a delayed-type hypersensitivity reaction and suppression by Kv1.3 channel block. Immunity. 2008;29:602–614. [PMC free article] [PubMed]
  • Moran Y, Cohen L, Kahn R, Karbat I, Gordon D, Gurevitz M. Expression and mutagenesis of the sea anemone toxin Av2 reveals key amino acid residues important for activity on voltage-gated sodium channels. Biochemistry. 2006;45:8864–8873. [PubMed]
  • Moran Y, Kahn R, Cohen L, Gur M, Karbat I, Gordon D, Gurevitz M. Molecular analysis of the sea anemone toxin Av3 reveals selectivity to insects and demonstrates the heterogeneity of receptor site-3 on voltage-gated Na+ channels. Biochem J. 2007;406:41–48. [PubMed]
  • Pennington MW, Beeton C, Galea CA, Smith BJ, Chi V, Monaghan KP, Garcia A, Rangaraju S, Giuffrida A, Plank D, Crossley G, Nugent D, Khaytin I, Lefievre Y, Peshenko I, Dixon C, Chauhan S, Orzel A, Inoue T, Hu X, Moore RV, Norton RS, Chandy KG. Engineering a stable and selective peptide blocker of the Kv1.3 channel in T lymphocytes. Mol Pharmacol. 2009;75:762–773. [PubMed]
  • Pennington MW, Byrnes ME, Zaydenberg I, Khaytin I, de Chastonay J, Krafte DS, Hill R, Mahnir VM, Volberg WA, Gorczyca W, et al. Chemical synthesis and characterization of ShK toxin: a potent potassium channel inhibitor from a sea anemone. Int J Pept Protein Res. 1995;46:354–358. [PubMed]
  • Pennington MW, Lanigan MD, Kalman K, Mahnir VM, Rauer H, McVaugh CT, Behm D, Donaldson D, Chandy KG, Kem WR, Norton RS. Role of disulfide bonds in the structure and potassium channel blocking activity of ShK toxin. Biochemistry. 1999;38:14549–14558. [PubMed]
  • Pennington MW, Mahnir VM, Khaytin I, Zaydenberg I, Byrnes ME, Kem WR. An essential binding surface for ShK toxin interaction with rat brain potassium channels. Biochemistry. 1996a;35:16407–16411. [PubMed]
  • Pennington MW, Mahnir VM, Krafte DS, Zaydenberg I, Byrnes ME, Khaytin I, Crowley K, Kem WR. Identification of three separate binding sites on ShK toxin, a potent inhibitor of voltage-dependent potassium channels in human T-lymphocytes and rat brain. Biochem Biophys Res Commun. 1996b;219:696–701. [PubMed]
  • Piotto M, Saudek V, Sklenar V. Gradient-tailored excitation for single-quantum NMR spectroscopy of aqueous solutions. J Biomol NMR. 1992;2:661–665. [PubMed]
  • Pohl J, Hubalek F, Byrnes ME, Nielsen KR, Woods A, Pennington MW. Assignment of the three disulfide bonds in ShK toxin: A potent potassium channel inhibitor from the sea anemone Stichodactyla helianthus. Lett. Peptide Sci. 1995;1:291–297.
  • Price M, Lee SC, Deutsch C. Charybdotoxin inhibits proliferation and interleukin-2 production in human peripheral blood lymphocytes. Proc Natl Acad Sci U S A. 1989;86:10171–10175. [PubMed]
  • Quintero-Hernández V, Ortiz E, Rendón-Anaya M, Schwartz EF, Becerril B, Corzo G, Possani LD. Scorpion and spider venom peptides: Gene cloning and peptide expression. Toxicon. 2011;58:644–663. [PubMed]
  • Rauer H, Lanigan MD, Pennington MW, Aiyar J, Ghanshani S, Cahalan MD, Norton RS, Chandy KG. Structure-guided transformation of charybdotoxin yields an analog that selectively targets Ca2+-activated over voltage-gated K+ channels. J Biol Chem. 2000;275:1201–1208. [PubMed]
  • Rauer H, Pennington M, Cahalan M, Chandy KG. Structural conservation of the pores of calcium-activated and voltage-gated potassium channels determined by a sea anemone toxin. J Biol Chem. 1999;274:21885–21892. [PubMed]
  • Schanda P, Brutscher B. Very fast two-dimensional NMR spectroscopy for real-time nvestigation of dynamic events in proteins on the time scale of seconds. J Am Chem Soc. 2005;127:8014–8015. [PubMed]
  • Tudor JE, Pallaghy PK, Pennington MW, Norton RS. Solution structure of ShK toxin, a novel potassium channel inhibitor from a sea anemone. Nat Struct Biol. 1996;3:317–320. [PubMed]
  • Tudor JE, Pennington MW, Norton RS. Ionisation behaviour and solution properties of the potassium-channel blocker ShK toxin. Eur J Biochem. 1998;251:133–141. [PubMed]
  • Turkov M, Rashi S, Noam Z, Gordon D, Ben Khalifa R, Stankiewicz M, Pelhate M, Gurevitz M. In vitro folding and functional analysis of an anti-insect selective scorpion depressant neurotoxin produced in Escherichia coli. Protein Expr Purif. 1997;10:123–131. [PubMed]
  • Wulff H, Beeton C, Chandy KG. Potassium channels as therapeutic targets for autoimmune disorders. Curr Opin Drug Discov Devel. 2003a;6:640–647. [PubMed]
  • Wulff H, Calabresi PA, Allie R, Yun S, Pennington M, Beeton C, Chandy KG. The voltage-gated Kv1.3 K+ channel in effector memory T cells as new target for MS. J Clin Invest. 2003b;111:1703–1713. [PMC free article] [PubMed]
  • Yan L, Herrington J, Goldberg E, Dulski PM, Bugianesi RM, Slaughter RS, Banerjee P, Brochu RM, Priest BT, Kaczorowski GJ, Rudy B, Garcia ML. Stichodactyla helianthus peptide, a pharmacological tool for studying Kv3.2 channels. Mol Pharmacol. 2005;67:1513–1521. [PubMed]
  • Yao S, Headey SJ, Keizer DW, Bach LA, Norton RS. C-terminal domain of insulin-like growth factor (IGF) binding protein 6: conformational exchange and its correlation with IGF-II binding. Biochemistry. 2004;43:11187–11195. [PubMed]
  • Yao S, Hinds MG, Murphy JM, Norton RS. Exchange enhanced sensitivity gain for solvent-exchangeable protons in 2D 1H-15N heteronuclear correlation spectra acquired with band-selective pulses. J Magn Reson. 2011;211:243–247. [PubMed]