PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of mbcLink to Publisher's site
 
Mol Biol Cell. Jul 15, 2012; 23(14): 2741–2754.
PMCID: PMC3395662
TFIIIC localizes budding yeast ETC sites to the nuclear periphery
Shin-ichiro Hiraga,a* Sotirios Botsios,a* David Donze,b and Anne D. Donaldsona1
aInstitute of Medical Sciences, University of Aberdeen, Aberdeen AB25 2ZD, Scotland, United Kingdom
bDepartment of Biological Sciences, Louisiana State University, Baton Rouge, LA 70803
Orna Cohen-Fix, Monitoring Editor
National Institutes of Health
*These authors contributed equally.
1Address correspondence to: Anne D. Donaldson (a.d.donaldson/at/abdn.ac.uk).
Received April 26, 2011; Revised February 23, 2012; Accepted April 4, 2012.
Chromatin function requires specific three-dimensional architectures of chromosomes. We investigated whether Saccharomyces cerevisiae extra TFIIIC (ETC) sites, which bind the TFIIIC transcription factor but do not recruit RNA polymerase III, show specific intranuclear positioning. We show that six of the eight known S. cerevisiae ETC sites localize predominantly at the nuclear periphery, and that ETC sites retain their tethering function when moved to a new chromosomal location. Several lines of evidence indicate that TFIIIC is central to the ETC peripheral localization mechanism. Mutating or deleting the TFIIIC-binding consensus ablated ETC -site peripheral positioning, and inducing degradation of the TFIIIC subunit Tfc3 led to rapid release of an ETC site from the nuclear periphery. We find, moreover, that anchoring one TFIIIC subunit at an ectopic chromosomal site causes recruitment of others and drives peripheral tethering. Localization of ETC sites at the nuclear periphery also requires Mps3, a Sad1-UNC-84–domain protein that spans the inner nuclear membrane. Surprisingly, we find that the chromatin barrier and insulator functions of an ETC site do not depend on correct peripheral localization. In summary, TFIIIC and Mps3 together direct the intranuclear positioning of a new class of S. cerevisiae genomic loci positioned at the nuclear periphery.
The three-dimensional organization of the genetic material in nuclear space is integrally related to chromatin function (reviewed by Sexton et al., 2007 blue right-pointing triangle). In some higher eukaryotic cells, for example, chromosomes occupy specific nuclear “territories” that reflect their gene density and heterochromatin content (Croft et al., 1999 blue right-pointing triangle; Tanabe et al., 2002 blue right-pointing triangle). Typically, chromosome regions containing a high proportion of nontranscribed sequence display localization to the nuclear periphery (reviewed in Towbin et al., 2009 blue right-pointing triangle). Silenced chromatin in yeast cells is preferentially positioned to the nuclear periphery (Maillet et al., 2001 blue right-pointing triangle), and artificial tethering to the nuclear rim partially restores transcriptional repression by a compromised silencer (Andrulis et al., 1998 blue right-pointing triangle). Gene expression in metazoans can also be modified by manipulating its intranuclear positioning (Finlan et al., 2008 blue right-pointing triangle). The spatial arrangement of metazoan chromosomes appears to be tissue specific (Parada et al., 2004 blue right-pointing triangle) and becomes reorganized during differentiation (Kim et al., 2004 blue right-pointing triangle).
Studies of chromosome spatial organization have revealed specific intranuclear positioning of particular chromosome domains. Localization of telomeres at the nuclear periphery has been described in the budding yeast Saccharomyces cerevisiae (Gotta et al., 1996 blue right-pointing triangle), in fission yeast Schizosaccharomyces pombe (Funabiki et al., 1993 blue right-pointing triangle), in human cells (de Lange, 1992 blue right-pointing triangle; Croft et al., 1999 blue right-pointing triangle), and in other organisms (Chung et al., 1990 blue right-pointing triangle; Dawe et al., 1994 blue right-pointing triangle). The 64 telomeres of diploid budding yeast cells cluster at the nuclear periphery in three to eight discrete foci (Klein et al., 1992 blue right-pointing triangle; Gotta et al., 1996 blue right-pointing triangle), with the subtelomeric sequences being subject to transcription silencing (Gottschling et al., 1990 blue right-pointing triangle). Other genomic regions also exhibit specific spatial organization in the nucleus that is related to biological function. For example, the ribosomal DNA is localized to the nucleolus (Hartung et al., 1979 blue right-pointing triangle; Dujon, 1998 blue right-pointing triangle; Kalmarova et al., 2007 blue right-pointing triangle), whereas during interphase yeast centromeres cluster near the spindle pole body, opposite the nucleolus (Guacci et al., 1997 blue right-pointing triangle; Jin et al., 1998 blue right-pointing triangle). In addition, it has been reported that active S. cerevisiae tRNA genes tend to be localized to the nucleolus (Bertrand et al., 1998 blue right-pointing triangle; Thompson et al., 2003 blue right-pointing triangle), which is important for tRNA gene-mediated silencing (Kendall et al., 2000 blue right-pointing triangle). Additional examples of directed chromosome positioning include the relocalization to the nuclear periphery of specific genes upon transcriptional activation (e.g., GAL genes, INO1 locus; Brickner and Walter, 2004 blue right-pointing triangle; Casolari et al., 2005 blue right-pointing triangle; Schmid et al., 2006 blue right-pointing triangle). The fact that peripheral localization has been implicated in transcription activation as well as repression led to models proposing that the nuclear envelope comprises a mosaic of zones favoring either transcriptional induction or silencing.
The S. pombe RNA polymerase III transcriptional apparatus is implicated in chromosome spatial organization. Eukaryotic RNA polymerase III (Pol III) is responsible for the transcription of small structural RNAs, including tRNAs, 5S rRNA, and other small nuclear and cytoplasmic RNAs (reviewed by Dieci et al., 2007 blue right-pointing triangle). The Pol III transcription machinery is highly conserved and consists of the multisubunit Pol III polymerase and two transcription factor complexes (TFIIIB and TFIIIC; Kassavetis et al., 1990 blue right-pointing triangle). An additional factor (TFIIIA) is required only for 5S rDNA transcription. Pol III–transcribed genes share specific sequence and structural properties, including conserved A and B box sequences typically found within the coding region (Galli et al., 1981 blue right-pointing triangle). These internal control regions are recognized by the six-subunit complex TFIIIC (Baker et al., 1986 blue right-pointing triangle; Bartholomew et al., 1990 blue right-pointing triangle). The B box sequence is conserved in all eukaryotes (GGTTCGANTCC), and mutation of the internal cytosine inactivates both TFIIIC binding and Pol III transcription of a tRNA gene (Newman et al., 1983 blue right-pointing triangle; Baker et al., 1986 blue right-pointing triangle; Marzouki et al., 1986 blue right-pointing triangle). Once assembled, TFIIIC recruits TFIIIB to an ~50–base pair, AT-rich region upstream of the transcription start site. After recruitment by TFIIIC, TFIIIB in turn recruits Pol III for transcription initiation (Kassavetis et al., 1990 blue right-pointing triangle, 1997 blue right-pointing triangle).
Chromatin boundary elements function to separate chromatin domains, either by insulating promoters from transcriptional activation or by acting as barriers to the propagation of repressive heterochromatin (West et al., 2002 blue right-pointing triangle). A study in the fission yeast S. pombe revealed a role for the RNA polymerase III apparatus, and TFIIIC in particular, in boundary function and genome organization. Chromatin boundary elements called “inverted repeats” (IRs) contain multiple B box sequences but are not transcribed. IR elements were shown to bind TFIIIC but not other Pol III factors or Pol III itself, suggesting that TFIIIC binding may mediate chromatin boundary function (Noma et al., 2006 blue right-pointing triangle). These TFIIIC-bound IR insulators were found to be predominantly associated with the nuclear periphery. It was suggested that such loci act as so-called chromosome-organizing-clamp (COC) sites that tether chromosomal regions to the nuclear periphery, possibly mediating three-dimensional organization of the fission yeast genome (Noma et al., 2006 blue right-pointing triangle). However, the mechanism of peripheral localization is unclear.
In a genome-wide survey of Pol III apparatus occupancy in S. cerevisiae, eight intergenic loci were identified that display TFIIIC occupancy but no significant recruitment of other Pol III factors (Moqtaderi and Struhl, 2004 blue right-pointing triangle). These loci were called extra TFIIIC (ETC) sites. Of interest, these loci tend to lie in divergent intergenes. All eight loci share a sequence that resembles a B box consensus, but with an additionally conserved 10-base extension to the 3′ side (Moqtaderi and Struhl, 2004 blue right-pointing triangle). The ETC extended B box consensus sequences are highly conserved among sensu stricto yeast species, suggesting an important biological function. Two additional S. cerevisiae genome-wide studies of Pol III–binding sites (Harismendy et al., 2003 blue right-pointing triangle; Roberts et al., 2003 blue right-pointing triangle) identified several of the same ETC loci, as well as other sites that recruit partial Pol III complexes. Recently ETC loci were shown to be able to function as chromatin insulators, blocking gene activation if artificially inserted between an upstream activation sequence (UAS) and its transcriptional start site (Simms et al., 2008 blue right-pointing triangle; Valenzuela et al., 2009 blue right-pointing triangle). In addition, ETC6 was shown to have an insulator-like function in its natural context. Two ETC sites (ETC2 and ETC4) can also function in reporter constructs as barriers to the spread of heterochromatin, suggesting a role for TFIIIC in regulating Pol II–transcribed genes (Simms et al., 2008 blue right-pointing triangle; Valenzuela et al., 2009 blue right-pointing triangle; Kleinschmidt et al., 2011 blue right-pointing triangle). Although several studies suggested that TFIIIC binding in the absence of TFIIIB is sufficient for such insulator and barrier activities, a recent investigation found TFIIIC-mediated insulation was increased in the presence of bound TFIIIB and was compromised in various histone modifier and remodeler mutants (Valenzuela et al., 2009 blue right-pointing triangle).
In a recent interesting development, Moqtaderi et al. (2010 blue right-pointing triangle) identified >1865 ETC loci in the human genome that recruit TFIIIC but not other Pol III apparatus components. Human ETC (hETC) loci are preferentially located between closely spaced, divergently transcribed Pol II genes, reminiscent of S. cerevisiae ETCs. hETC loci are characterized by one of two sequence motifs: either a B box sequence or a novel motif loosely related to the binding motif for the ET transcription factor family (Moqtaderi et al., 2010 blue right-pointing triangle). Thousands of ETC sites have also been identified in the mouse genome (Carriere et al., 2012 blue right-pointing triangle).
We investigated whether S. cerevisiae ETC sites mediate positioning to the nuclear periphery. By fluorescently tagging all eight known ETC sites, we showed that the majority of ETC loci localize predominantly to the nuclear periphery. The ETC B box consensus is necessary for peripheral positioning, and an ETC locus is sufficient to cause peripheral localization if transferred to another chromosomal region. We find that the TFIIIC complex itself directs peripheral tethering through a pathway that involves the inner nuclear membrane protein Mps3. Surprisingly, however, it appears that peripheral localization of an ETC site is not required for its insulator or barrier activity.
ETC loci act as COCs in S. cerevisiae
We investigated whether ETC loci in S. cerevisiae are tethered to the nuclear periphery. ETC sites can be microscopically visualized in live cells using the chromosome dot system. An ETC site is tagged by inserting an array of lac operator repeats (Figure 1A) in cells expressing the Lac repressor protein fused to green fluorescent protein (GFP; LacI-GFP; Robinett et al., 1996 blue right-pointing triangle). Recruitment of LacI-GFP to the tagged ETC locus allows its visualization as a bright dot (Figure 1B). To facilitate measurement of the position and movement of the ETC dot, the nuclear envelope is also marked using a GFP-fused allele of the nuclear pore component NUP49 (Belgareh and Doye, 1997 blue right-pointing triangle). Quantification of the chromosomal ETC dot position is performed using the “three-zoning” method (Taddei and Gasser, 2004 blue right-pointing triangle), in which the dot is scored to one of three concentric zones of equal surface area (Figure 1C). A randomly positioned locus shows equal distribution among the three zones (~33% in zones 1–3), whereas a locus positioned at the nuclear periphery is preferentially observed in zone 1 (Figure 1, C and D). Cell cycle position is assessed according to bud size (see Materials and Methods).
FIGURE 1:
FIGURE 1:
Chromosome dot assay reveals peripheral localization of ETC sites. (A) Illustration of strain construct used to test intranuclear positioning of ETC2, located within PPM2-ARG8 intergene on chromosome XV. The neighboring intergene (ARG8-CDC33) was GFP (more ...)
ETC2 lies on the left arm of chromosome XV (genome coordinate: XV, 58539–58758), more than 59 kb from telomere XV-L (Figure 1A; Moqtaderi and Struhl, 2004 blue right-pointing triangle). The intergene neighboring ETC2 was GFP tagged as described. We found that in the majority of interphase cells, the ETC2 locus resides in zone 1 (localization to zone 1 in 71.5% of G1 cells, 78.9% of S cells, and 75.7% of G2 cells; Figure 1D). In most cases in which ETC2 was observed within zone 1, the fluorescent signal from the chromosome dot and the nuclear envelope appeared juxtaposed. Of importance, ETC2 remains predominantly localized to the nuclear periphery in G2 phase. The cell cycle regulation of ETC2 positioning therefore differs from that of telomeres, which become randomly localized in G2 phase. A χ2 analysis confirmed that ETC2 positioning during all three cell cycle phases differs significantly from random (Figure 1D).
We constructed strains in which the other seven ETC loci were individually fluorescently tagged and examined their subnuclear localization. Figure 1E shows the percentage of GFP dots observed at the nuclear periphery (i.e., in zone 1) for each ETC-tagged strain, shown as a cumulative total throughout interphase (cell cycle–staged results in Supplemental Figure S1). ETC4, ETC5, ETC6, ETC7, and ETC8 reside in zone 1 in the majority of interphase cells (Figure 1E). All of these loci retained peripheral localization throughout interphase (Supplemental Figure S1), similar to the pattern observed for ETC2. A control locus (ChrVIint) displayed random positioning.
ETC1, in contrast, exhibited virtually random positioning throughout the cell cycle (33.5%; Figure 1E). ETC3 was also positioned largely randomly, displaying only a slight tendency toward peripheral localization (47.5%; Figure 1E).
To summarize, we found that six of the eight ETC loci (ETC2, ETC4, ETC5, ETC6, ETC7,and ETC8) exhibited clear peripheral subnuclear localization. The S. cerevisiae genome therefore contains at least six peripherally positioned ETC chromosome loci, which we propose are equivalent to S. pombe COC sites.
ETC sites do not associate with the nucleolus or telomeric foci
ETC loci share certain sequence and structural properties with tRNA genes—in particular, a B box consensus and TFIIIC binding. Because some tRNA genes are proposed to localize to the nucleolus (Bertrand et al., 1998 blue right-pointing triangle; Thompson et al., 2003 blue right-pointing triangle), we tested whether ETC loci also associate with the nucleolus. The S. cerevisiae nucleolus occupies a crescent adjacent to the nuclear envelope, so ETC positioning to the nuclear periphery does not preclude nucleolar localization. ETC7 positioning was examined in a strain bearing an mCherry-tagged version of the nucleolar marker protein Nop1 (Schimmang et al., 1989 blue right-pointing triangle). Colocalization of ETC7 with the nucleolus was scored if the chromosome dot and Nop1 fluorescent signals coincided or were juxtaposed when observed at the equatorial region in a Z-stack of images (Figure 2A). We found no tendency for ETC7 to be located close to or within the nucleolus. The nucleolus occupies on average 30% of the nuclear volume, but ETC7 coincided with the nucleolus in only 32.4% of interphase cells (Figure 2Aii). A χ2 analysis confirmed this value as consistent with only random coincidence of ETC7 with the nucleolus (p = 0.086). Similar results were obtained from analysis of ETC5, which showed 30.1% colocalization with the nucleolus (unpublished data).
FIGURE 2:
FIGURE 2:
ETC7 does not colocalize with the nucleolus and telomeres. (A) Typical images of strains carrying GFP-tagged ETC7 and NOP1-mCherry, visualized as a green dot and a red crescent, respectively. Nup49-GFP reveals the nuclear rim. Sixty-eight percent of cells (more ...)
S. cerevisiae telomeres form clusters at the nuclear periphery (Klein et al., 1992 blue right-pointing triangle; Gotta et al., 1996 blue right-pointing triangle). To test whether ETC sites colocalize with telomeres, we used a mCherry-Rap1 fusion protein to visualize the telomere foci, which appear as bright fluorescent foci at the nuclear periphery (Hayashi et al., 1998 blue right-pointing triangle; Hiraga et al., 2006 blue right-pointing triangle). In G1- and S-phase cells, these foci were predominantly localized at the nuclear envelope, as expected. Colocalization of an ETC7 dot with a telomere focus was scored if the fluorescent signals coincided or were juxtaposed when observed in the equatorial region in a Z-stack of images (Figure 2B). We found no tendency for ETC7 to colocalize with telomere clusters at greater-than-random incidence (11.1%; Figure 2Bii). Similar results were obtained with ETC2 (12.9% colocalization; unpublished data).
To summarize, S. cerevisiae ETC sites do not appear to be localized to nucleoli or telomeric foci.
Peripheral positioning of ETC sites requires the extended B box consensus sequence
We next tested whether the extended B box consensus (and by extension TFIIIC binding) is required for ETC-site perinuclear localization. Starting with the chromosome dot–tagged ETC6 strain, we deleted the 23–base pair ETC consensus along with 10 base pairs of intergenic sequence on either side, resulting in a total deletion of 43 base pairs (illustrated in Figure 3A). No other B box–like sequence is present in the intergenes where ETC6 lies, and this etc6Δ mutant no longer binds TFIIIC (Figure 3B).
FIGURE 3:
FIGURE 3:
The extended B box consensus is crucial for peripheral localization of ETC6. (A) Sequence comparisons show the TFIIIC-binding B box consensus present at tRNA genes, the extended B box–related consensus sequence of ETC sites, a 55–base (more ...)
Deleting the ETC6 consensus caused the locus to become randomly positioned in all three cell cycle phases (Figure 3, C and D). The B box extended ETC consensus therefore appears essential for tethering ETC6 to the nuclear periphery. Analogous data were obtained on deleting the ETC7 consensus (Supplemental Figure S2, A and B). To summarize, the conserved B box extended consensus sequence is critical for perinuclear localization of ETC loci.
An ETC site can direct peripheral tethering of a random chromosome locus
We examined whether an ETC locus inserted at a randomly positioned chromosomal region can direct its localization to the nuclear periphery. We constructed a strain in which an internal chromosomal intergene (YNL179C-RPS3; ChrXIV-302) was fluorescently tagged and confirmed that this ChrXIV-302 locus is randomly distributed in the nucleus throughout interphase (Figure 4, A and B). We next inserted at ChrXIV-302 a 91–base pair fragment of RAD2-TNA1 intergenic sequence from ChrVII, encompassing ETC4. Subnuclear localization revealed that the resulting “ectopic” ETC site was positioned in zone 1 in the majority of interphase cells (Figure 4C). In contrast, insertion of an ETC4 fragment containing a mutated consensus sequence incapable of binding TFIIIC (etc4mut; Simms et al., 2008 blue right-pointing triangle) was unable to direct peripheral localization (Figure 4D). An ETC site can therefore direct peripheral tethering even if moved to a new chromosomal context, with positioning dependent on an intact TFIIIC-binding consensus. Larger genomic fragments containing ETC2 or ETC6 were also able to direct peripheral positioning when inserted at the ChrXIV-302 site (Supplemental Figure S2, C and D).
FIGURE 4:
FIGURE 4:
An ETC site inserted at a randomly positioned locus directs peripheral localization. (A) Illustration of strain construct. Intergene YNL179C-RPS3, at 302 kb on the chromosome XIV left arm, was GFP tagged using a lacOp array. A 91–base pair fragment (more ...)
Degradation of Tfc3 causes release of an ETC site from the periphery
The eight ETC sites were discovered on the basis of their TFIIIC occupancy (Moqtaderi and Struhl, 2004 blue right-pointing triangle). To test directly whether TFIIIC mediates ETC site peripheral tethering, we fused an auxin-inducible degron (Nishimura et al., 2009 blue right-pointing triangle) to Tfc3 in the strain containing the fluorescently tagged ETC4 locus and tested the effects of inducing Tfc3 degradation on ETC4 localization. Microscopic examination of cells 1–2 h after addition of the auxin 3-indoleacetic acid (IAA) revealed that ETC4 peripheral localization was ablated (Figure 5A). In contrast, ETC4 localization remained largely intact in a control strain with untagged Tfc3 (Figure 5B). The rapid loss of ETC4 peripheral positioning on induction of Tfc3 degradation suggests that TFIIIC is directly responsible for tethering ETC sites at the nuclear periphery.
FIGURE 5:
FIGURE 5:
TFIIIC plays a critical role in peripheral anchoring of ETC sites. (A) Subnuclear positioning of ETC4 was examined in a strain SHY476 expressing Tfc3 C-terminally tagged with an auxin-inducible degron. Degradation of Tfc3 protein was induced by adding (more ...)
TFIIIC subunits drive anchoring of a chromosome locus at the nuclear periphery
The foregoing results implicate TFIIIC in the ETC tethering mechanism. We therefore tested whether TFIIIC alone can drive tethering of a chromosomal domain to the nuclear periphery. We used a system developed as a cytological assay for proteins that cause peripheral tethering (Taddei et al., 2004 blue right-pointing triangle; Ebrahimi et al., 2010 blue right-pointing triangle). Briefly, LexA-binding sites (lexAOp) are inserted at a randomly positioned chromosome locus (ChrVIint, adjacent to ARS607 on chromosome VI). Candidate anchoring proteins are expressed fused to the LexA DNA-binding domain and their effect on ChrVIint subnuclear position assessed. An array of lacOp repeats at the same site allows subnuclear positioning of ChrVIint to be monitored microscopically (Figure 6A; Taddei et al., 2004 blue right-pointing triangle).
FIGURE 6:
FIGURE 6:
TFIIIC subunits can mediate peripheral anchoring. (A) Illustration of ChrVIint locus in tethering assay strain. In addition to lacOp repeats, an array of four lexAOp-binding sites is inserted at 199.2 kb on the chromosome VI right arm, adjacent to replication (more ...)
We tested the ability of LexA-fused TFIIIC components to cause peripheral localization of ChrVIint. Expression of LexA alone does not affect ChrVIint localization (Figure 6D), but expression of either LexA-Tfc1 or LexA-Tfc6 induces anchoring of ChrVIint to the nuclear periphery (Figure 6, B and C). In both cases, peripheral anchoring levels were highest in G1 and dropped slightly in S and G2 phases. Similar results were obtained on expression of LexA fused to other TFIIIC subunits (LexA-Tfc3, LexA-Tfc4, LexA-Tfc7, and LexA-Tfc8; Supplemental Figure S3).
The fact that all the TFIIIC subunits were able to induce some level of peripheral tethering suggested that binding of one Lex-Tfc protein to DNA might cause recruitment of other TFIIIC subunits. We tested this possibility, and found, using chromatin immunoprecipitation (ChIP) analysis, that binding of LexA-Tfc3 or LexA-Tfc6 causes corecruitment of Tfc1 (Figure 6E). Together with the positioning data, this result suggests that tethering any TFIIIC subunit can cause nucleation of the other complex subunits to direct peripheral localization.
Mps3 is required for ETC-locus peripheral anchoring
We aimed to identify the nuclear envelope component responsible for anchoring ETC sites at the nuclear periphery. One candidate was Mps3, a Sad1-UNC-84 (SUN)–domain inner nuclear envelope protein. Mps3 functions as an integral membrane anchor for telomeres (Bupp et al., 2007 blue right-pointing triangle) and is also involved in sequestering double-strand break sites at the nuclear periphery (Oza et al., 2009 blue right-pointing triangle). Mps3 is an essential protein, so we examined the impact of a mutant version that lacks the N-terminal nucleoplasmic domain required for localizing telomeres (the previously described mps3Δ75–150 allele; Bupp et al., 2007 blue right-pointing triangle).
Deleting this Mps3 N-terminal domain resulted in random positioning of the ETC6 locus in all three cell cycle phases (Figure 7A), demonstrating that Mps3 is important for anchoring ETC6 to the nuclear periphery. Similar data were obtained on subnuclear localization analysis of ETC2 in the mps3Δ75–150 mutant (Figure 7B). This loss of peripheral anchoring suggests that the SUN-domain protein Mps3, and specifically its N-terminal nucleoplasmic domain, plays an important role in the perinuclear tethering of ETC loci.
FIGURE 7:
FIGURE 7:
An Mps3 N-terminal domain plays a role in peripheral anchoring of ETC sites. (A) Subnuclear positioning of ETC6 in mps3Δ75-150 strain was tested as in Figure 1D. Strain is SBY191. ETC6 positioning in wild type is shown in Figure 3. (B) Subnuclear (more ...)
To exclude the possibility that loss of tethering is an indirect consequence of the mps3Δ75–150 mutation, we examined the effect of ectopically overexpressing a dominant-negative version of MPS3 containing only its nucleoplasmic N-terminal domain fused to tetR-mCherry to permit visualization. A similar fusion construct was previously shown to interfere with telomere anchoring at the nuclear periphery (Schober et al., 2009 blue right-pointing triangle). Microscopic observation revealed that this Mps3-N-tetR-mCherry (Mps3-N′) protein localizes throughout the nucleoplasm (Supplemental Figure S4A), in contrast to full-length Mps3 (Bupp et al., 2007 blue right-pointing triangle) and as expected, since this Mps3-N′ construct lacks the Mps3 membrane-spanning domain. We found that the overexpression of Mps3-N′ (from a multicopy vector in a wild-type MPS3 background) ablates peripheral positioning of the ETC4 locus (Figure 7C). Expression of Mps3-N′ also prevented peripheral positioning of ETC6 (Supplemental Figure S4B). These results support the conclusion that Mps3, and specifically its N-terminal domain, is involved in ETC locus anchoring to the nuclear periphery. We propose that the soluble Mps3 N′ domain competes with full-length, membrane-attached Mps3, preventing proper recruitment of the ETC4 site to the nuclear periphery and resulting in its random localization within the nuclear space. The finding that overexpressing the Mps3-N′ domain interferes with ETC-site peripheral positioning supports the idea that ETC nuclear membrane anchoring involves an interaction with the N-terminal domain of Mps3.
Ectopic expression of the Mps3 N-terminus antagonizes TFIIIC-mediated peripheral tethering
Because anchored TFIIIC subunits are central to ETC site positioning, we tested whether Mps3-N′ also antagonizes ectopic peripheral tethering driven by TFIIIC components. Using the LexA-based tethering system described previously (Figure 6A), we found that Mps3-N′ overexpression severely compromised the ability of LexA-fused TFIIIC subunits to drive localization to the nuclear rim. Specifically, neither LexA-Tfc7 nor LexA-Tfc1 is effective in anchoring ChrVIint when Mps3-N′ is overexpressed (Figure 8 and Supplemental Figure S4, C and D). In contrast, Mps3-N′ did not affect anchoring-mediated Yif1, a nuclear transmembrane protein previously found to cause peripheral tethering (Andrulis et al., 1998 blue right-pointing triangle). Our observations favor a model in which TFIIIC mediates peripheral tethering of ETC sites based on either direct or indirect interactions between TFIIIC and the Mps3 N-terminal domain.
FIGURE 8:
FIGURE 8:
Mps3-N′ expression antagonizes peripheral anchoring by TFIIIC subunits. Tethering of ChrVIint in strains expressing LexA-Tfc7, LexA-Tfc1, and LexA-Yif1 (white, gray, and black bars respectively) compared with the same strains expressing Mps3-N′ (more ...)
Peripheral tethering is not required for ETC4 transcriptional insulator and heterochromatin barrier activities
Several ETC sites have been shown to function as “insulators” (blocking transcriptional activation by an enhancer) or as “barriers” (interrupting the spread of heterochromatin; Sun and Elgin, 1999 blue right-pointing triangle; Simms et al., 2008 blue right-pointing triangle; Valenzuela et al., 2009 blue right-pointing triangle). To examine whether positioning at the nuclear periphery is required for these ETC functions, we tested the effect on ETC4 insulator and barrier activity of overexpressing the Mps3-N′ domain, which, as shown previously, is a dominant inhibitor of peripheral localization. We used an established assay for enhancer blocking transcriptional insulator activity (Figure 9A; Simms et al., 2008 blue right-pointing triangle), in which ETC4 inserted between the GAL10 ORF and its UASG activator sequences prevents GAL10 transcription and, as a consequence, growth on galactose medium (Figure 9B, lower left quadrant). Growth on galactose was not improved by overexpressing Mps3-N′ (Figure 9B, lower right quadrant), showing that GAL10 still fails to be transcribed. This finding suggests that ETC4 retains insulator activity even when it is not localized at the nuclear periphery. Consistent with this interpretation, ETC4 also retained insulator function in a strain background in which the Mps3 N-terminal perinuclear domain was deleted (Supplemental Figure S5).
FIGURE 9:
FIGURE 9:
ETC4 transcriptional insulator and barrier activities are not affected by expressing the dominant-negative Mps3-N′ construct that inhibits Mps3-mediated localization. (A) Cartoon of test construct. ETC4 inserted between the GAL10 gene and its (more ...)
The function of ETC4 as a barrier to heterochromatin was assessed using the assay construct illustrated in Figure 9C, which tests whether silenced chromatin spreading from the silenced HMRa mating locus represses transcription of ADE2 (Jambunathan et al., 2005 blue right-pointing triangle; Simms et al., 2008 blue right-pointing triangle). Reduced ADE2 transcription results in pink colony pigmentation. The tRNA gene (tDNA) lying next to HMRa provides barrier activity that prevents spread of silent chromatin, allowing efficient ADE2 transcription and white colony color (Figure 9D, tDNA and tdnaΔ; left; Donze et al., 1999 blue right-pointing triangle). Barrier function can be provided by a copy of ETC4 replacing the tDNA but not by a mutated version etc4mut (Figure 9D, ETC4 and etc4mut; left). We found that ETC4 (and the tDNA) can still block the spread of heterochromatin when Mps3-N′ is overexpressed, as indicated by the formation of white colonies, implying successful transcription of ADE2 (Figure 9D, ETC4 and tDNA; right). We conclude that ETC4 can continue to function as a heterochromatin barrier element even when its peripheral localization is disrupted. We also found that ETC1, which is not peripherally localized (Figure 1), is not effective as a transcription-blocking insulator or as a heterochromatin barrier element (Supplemental Figure S6, A and B).
ETC loci as COC sites
Here we described S. cerevisiae ETC sites as a new class of sequence loci positioned at the nuclear periphery. We found that six of eight identified S. cerevisiae ETC loci exhibit peripheral localization. ETC loci therefore represent distinct chromosome sites conserved in eukaryote genomes, involved in directing correct spatial positioning within the eukaryotic nucleus (Noma et al., 2006 blue right-pointing triangle). ETC sites are not colocalized with telomere foci, nor are they positioned within the nucleolus. Our experiments suggest that TFIIIC bound at ETC sites directly mediates their peripheral localization, since mutating its binding site or degrading a TFIIIC subunit abolishes positioning. We find indeed that anchoring TFIIIC subunits at an ectopic chromosomal site can drive localization to the nuclear periphery. Disrupting function of the Mps3 N-terminal domain prevents ETC-site localization, but ETC site chromatin boundary function remains intact.
Our results clearly implicate TFIIIC as central for the ETC-site positioning mechanism, a finding that raises interesting questions about the involvement of the RNA Pol III apparatus in spatial organization of the genome. Active Pol III–transcribed tRNA genes appear preferentially localized to the nucleolus (Thompson et al., 2003 blue right-pointing triangle), but we found no significant colocalization of either ETC5 or ETC7 with the nucleolus. It has been suggested that another category of tRNA genes may tend to colocalize with centromeres (Duan et al., 2010 blue right-pointing triangle), but we saw no tendency for ETC sites to associate with centromeres or telomere clusters. Perinuclear anchoring of ETC sites therefore appears to represent a new mode of TFIIIC-mediated positioning, acting aside from and independent of nucleolar and telomere localization. The fact that ETC-site peripheral localization is retained throughout interphase also differs from previously described peripheral positioning mechanisms. In particular, ETC sites do not appear to undergo the replication-triggered release from the nuclear periphery that leads to delocalization of telomeres during G2 (Ebrahimi and Donaldson, 2008 blue right-pointing triangle).
ETC sites all contain an extended B box sequence that is conserved among sensu stricto Saccharomyces species (Moqtaderi and Struhl, 2004 blue right-pointing triangle). Deletion of the B box extended consensus and immediately surrounding sequence ablated tethering of the ETC7 and ETC6 sites to the nuclear envelope, showing that the TFIIIC binding sequence is required for tethering, in agreement with studies in S. pombe (Noma et al., 2006 blue right-pointing triangle). Moreover, a version of ETC4 mutated in its TFIIIC-binding consensus was unable to cause localization of an ectopic site. One possibility is that the variant, extended B box consensus present at ETC sites may allow TFIIIC to direct peripheral localization rather than TFIIIB recruitment, perhaps by altering its mode of binding.
We addressed the importance of the B box–based consensus by moving ETC loci to a new chromosomal context. All three loci tested (ETC4, ETC2, and ETC6) can direct peripheral tethering even in a new chromosomal context, with retention of peripheral positioning throughout interphase (as at endogenous ETC loci). Our results support the suggestion that TFIIIC binding alone is enough to drive peripheral localization, overriding other limitations presented by chromatin context. It is notable that ETC1 and ETC3, the two sites that display little or no peripheral localization, displayed the lowest TFIIIC binding in the study that originally identified the S. cerevisiae ETC loci (Moqtaderi and Struhl, 2004 blue right-pointing triangle), and ETC3 has the weakest homology to the B box consensus. A role for TFIIIC as a major component in the positioning mechanism is further suggested by our finding that artificial recruitment of TFIIIC subunits mediates peripheral anchoring of a randomly positioned locus (Figure 6).
Examining other candidate molecular components that could mediate ETC-site peripheral tethering led us to identify the SUN-domain inner nuclear membrane protein Mps3 as a possible nuclear envelope anchor. Mps3 is a multifunctional protein previously found to act in spindle pole duplication, telomere peripheral tethering, and localization of DNA-break sites (Bupp et al., 2007 blue right-pointing triangle; Schober et al., 2009 blue right-pointing triangle). Deletion of the Mps3 N-terminal domain (mps3Δ75-150) severely compromised tethering to the nuclear envelope of two different ETC loci (ETC6 and ETC2). Mps3 may function as the ETC perinuclear anchor through its N-terminal acidic domain, which is located within the nucleoplasm and could interact with TFIIIC. Overexpressing a soluble N-terminal fragment of Mps3 in an MPS3 wild-type background ablated the perinuclear tethering of ETC loci and prevented LexA-Tfc–driven peripheral tethering of the ChrVIint locus (Figure 8 and Supplemental Figure S4, A and B), suggesting that Mps3-N′ competes with endogenous Mps3 for ETC-site interaction. These results support the idea that Mps3 acts as the ETC perinuclear anchor protein through its N-terminal nucleoplasmic domain. However, coimmunoprecipitation and two-hybrid tests did not reveal a direct interaction between Mps3 and any TFIIIC subunit (unpublished data), so we cannot exclude the possibility that the effect of Mps3 on ETC-site positioning is indirect and involves additional, unidentified components. We tested the effect of the variant histone Htz1, since Mps3 has been shown to interact with Htz1 (Gardner et al., 2011 blue right-pointing triangle) and Htz1 is incorporated close to some ETC sites (Albert et al., 2007 blue right-pointing triangle). Deleting Htz1, however, had only a marginal effect on ETC site positioning (unpublished data).
We previously found that ETC-site peripheral tethering required the activity of chromatin-remodeling proteins and in particular H3-K56 acetylation (Hiraga et al., 2008 blue right-pointing triangle). Proteins like Yku70/Yku80 and Sir4, which are involved in telomere peripheral anchoring pathways, in contrast have only a marginal effect on ETC6 peripheral positioning (Hiraga et al., 2008 blue right-pointing triangle). Further work will be required for a complete understanding of the ETC-anchoring pathway and identification of any additional protein components involved.
What is the function of ETC sites?
The conservation of ETC-site consensus sequences throughout sensu stricto Saccharomyces species suggests an important biological function for these loci. Six of the eight S. cerevisiae ETC loci lie between divergently transcribed genes, similar to the arrangement of most COC sites in S. pombe (Noma et al., 2006 blue right-pointing triangle). ETC sites can behave as chromatin boundary elements, but copy number expression data (Ghaemmaghami et al., 2003 blue right-pointing triangle) reveal no particular tendency for genes flanking ETC sites to be expressed at very different levels. There is a slight enrichment for genes within in the lowest 5% of expression levels in the vicinity of ETC sites (within the five flanking genes to the left and right). ETC sites might therefore tend to be associated with transcriptional suppression, but the significance of this observation is marginal, with the low number of identified sites limiting statistically significant conclusions. At least one S. pombe COC site behaves as a boundary element to limit the spread of silenced chromatin, and it was suggested that peripheral tethering of COC sites might facilitate boundary activity by creating a barrier to processive assembly of heterochromatin (Noma et al., 2006 blue right-pointing triangle). However, we found that ETC4 retained both heterochromatin barrier and transcription-blocking insulator functions even under conditions in which ETC-site peripheral localization is ablated (Figure 9 and Supplemental Figure S5), implying that perinuclear localization is not required for these activities. Consistent with our observations, a recent study found although nuclear pore proteins associate with a tRNA gene barrier element at a modified HMRa locus, pore protein association is not essential for barrier activity (Ruben et al., 2011 blue right-pointing triangle). The biological significance of ETC-site peripheral positioning is unclear, although one interesting possibility is of a relationship to condensin function, since the Pol III apparatus has been implicated in recruiting condensin to S. cerevisiae chromosomes (D'Ambrosio et al., 2008 blue right-pointing triangle; Haeusler et al., 2008 blue right-pointing triangle) and condensin is localized to a subset of the ETC sites. It will be interesting to explore further the relation between condensin, ETC-site function, and localization at the nuclear periphery.
The recent discovery of large numbers of ETC loci in the human and mouse genomes represents a particularly interesting addition to our knowledge of ETC/COC loci and reinforces the suggestion of additional roles for eukaryotic TFIIIC beyond its function in Pol III transcription (Simms et al., 2008 blue right-pointing triangle; Moqtaderi et al., 2010 blue right-pointing triangle; Carriere et al., 2012 blue right-pointing triangle). The large number of mammalian ETC loci raises the question of whether additional ETC sites exist in the S. cerevisiae genome. Two recent studies hinted there may be uncharacterized TFIIIC-binding sites in S. cerevisiae (D'Ambrosio et al., 2008 blue right-pointing triangle; Venters et al., 2011 blue right-pointing triangle), which have yet to be validated or further investigated. Some of the human ETC sites contained a novel motif (instead of the known TFIIIC-binding motif), so it is even possible that additional yeast ETC sites might not contain a TFIIIC-binding consensus. Like yeast ETC sites, human ETC loci also tend to lie in closely spaced, divergently transcribed Pol II intergenic regions, hinting that human ETC loci could also act as chromatin boundary elements. Human ETC loci tend to occur near binding sites for CTCF, a protein implicated in higher-order organization of metazoan chromosomes through cohesin interaction, insulator function, and chromosome looping (Wallace and Felsenfeld, 2007 blue right-pointing triangle; Parelho et al., 2008 blue right-pointing triangle). Overall, the emerging evidence points toward an important role for ETC loci in chromosome spatial organization that is conserved throughout eukaryotes.
Yeast strains and plasmids
All yeast strains were constructed in the W303-1A background (ade2-1 trp1-1 leu2-3112 ura3-1 his3-11,15 can1-100). Strains are listed in Supplemental Table S1. Plasmids are listed in Supplemental Table S2. Standard techniques were used for DNA and yeast manipulations.
To tag each ETC locus with GFP, a suitable restriction site was identified in the genomic DNA near the ETC locus to be tagged. Primers were designed to amplify a ~400–base pair fragment containing this restriction site, and the fragment was cloned into lacOp repeat plasmid pAFS52 (Robinett et al., 1996 blue right-pointing triangle). The resulting plasmid was cut at the unique restriction enzyme site and transformed into yeast strain GA-1320 (Heun et al., 2001 blue right-pointing triangle), creating strains SBY1-SBY14 and SBY17-SBY25. In the cases of ETC1, ETC4, ETC5, and ETC8 the size of the intergene allowed the insertion of lacOp tagging sequences within the intergene occupied by the ETC site (Table 1); for ETC3, ETC6, and ETC7 the tag was inserted in a neighboring intergene. Table 1 shows ETC-site coordinates, ETC-site sequences, and relative distances of the lacOp insert from the ETC locus.
TABLE 1:
TABLE 1:
ETC loci and GFP tagging.
To test for ETC colocalization with the nucleolus, we tagged the endogenous NOP1 gene with mCherry (Shu et al., 2006 blue right-pointing triangle). Briefly, SBY3 and SBY13 were transformed with a DNA fragment containing the natMX4 marker and mCherry targeted for in-frame insertion at the NOP1 3′ end, creating strains SBY31-33 and SBY49-51. To test for colocalization of ETC sites with telomeres, strains SBY84-86 and SBY87-89 were made by transforming SBY3 and SBY10, respectively, with plasmid pSB33 (YCp-mCherry-RAP1). The pSB33 plasmid resulted from exchanging GFP with mCherry (pKT355; Iwase et al., 2006 blue right-pointing triangle) in plasmid YCp-GFP-RAP1 (Hiraga et al., 2006 blue right-pointing triangle).
Strains SBY26, SBY27 (etc7Δ), and SBY37, SBY38 (etc6Δ) were derived from SBY3 and SBY1, respectively, by deleting the 23–base pair extended B box consensus sequence (23 base pairs) and 10 flanking base pairs on either side (43 base pairs total) using a fragment lacking this 43–base pair sequence but having 40–base pair homology on each side to the sequences flanking the deletion. This was performed in two steps. First the URA3 marker gene (YDp-U; Berben et al., 1991 blue right-pointing triangle) was inserted at the appropriate ETC site, followed by disruption with either the etc6Δ or etc7Δ deletion fragment and selection of correct isolates by plating cells to 5-fluoroorotic acid. To create strains for Tfc1-FLAG ChIP (Figure 3B), we crossed SBY1 and SBY37 with DDY4058 and sporulated them to produce DDY4729 and DDY4732.
To insert an ETC site on another chromosome, we selected a suitable chromosomal locus (ChrXIV: RPS3-YNL179C intergene) and GFP tagged it (as described previously), creating SBY76, SBY77, and SBY78. A DNA fragment containing a kanMX marker flanked by loxP sites and a ~450–base pair sequence containing either ETC2 or ETC6 was targeted for integration next to the GFP tag. Removal of the kanMX marker by expressing Cre recombinase from a pSH47 plasmid (Guldener et al., 1996 blue right-pointing triangle) then created SBY135, SBY136, and SBY137 and SBY139, SBY142, and SBY143. For transfer of ETC4, double-stranded synthetic oligonucleotides containing wild-type ETC4 or a mutated version of ETC4 with a single base substitution in B box consensus (etc4mut; Simms et al., 2008 blue right-pointing triangle) were cloned in between BamHI and SalI sites of plasmid pU6H3FLAG (Katou et al., 2003 blue right-pointing triangle). The resulting plasmids pSH136 and pSH138 contain wild type or etc4mut adjacent to loxP-kanMX-loxP, respectively. PCR fragments containing ETC4 and loxP-kanMX-loxP were PCR amplified with primers (with genomic sequence of chrXIV-302 at their 5′ ends) and used to transform strain SBY76. After insertion of ETC4 sequences, the kanMX marker was removed using galactose-inducible Cre recombinase of the plasmid pSH47. The resulting strains SHY465 and SHY468 have a 225–base pair sequence inserted at the chrXIV-302 locus containing ETC4 or etc4mut, respectively.
All LexA fusions were created in pAT4 (Taddei et al., 2004 blue right-pointing triangle). Fusion proteins were created by inserting the full-length sequences of TFC1, TFC3, TFC4, TFC6, TFC7 (YOR110W), or TFC8 (made by PCR amplification) into pAT4. Error-free constructs were confirmed by sequencing, and the resulting plasmids were then used to transform strain GA-1461 (Hediger et al., 2002 blue right-pointing triangle) to create SBY144-149, SBY155-166, and SBY211-212.
To construct strains suitable for ChIP analysis of Tfc1-FLAG recruitment by LexA-Tfc fusions, first we cloned double-stranded synthetic DNA containing four LexA operator sequences between the BsiWI and SalI site of plasmid pUG27 to obtain plasmid pSH142. Using pSH142 as a PCR template, we inserted the LexA operator array near the ARS607 locus of DDY4071 by one-step PCR replacement to obtain SHY451. The HIS3MX maker was then removed by Cre recombinase to obtain strain SHY457. Strain SHY457 was transformed with a plasmid pAT4, pSB48, or pSB50 to obtain strain SHY459, SHY461, or SHY463, respectively.
Strains SBY191, SBY195, and SBY196 (ETC6; mps3Δ75-150) and SBY194, SBY197, and SBY198 (ETC2; mps3Δ75-150) were derived from SBY1 and SBY10, respectively, by directing integration of BstEII-digested pSJ519 plasmid (mps3Δ75-150; Bupp et al., 2007 blue right-pointing triangle) at the chromosomal LEU2 locus, followed by deletion of the chromosomal copy of MPS3 using a natMX4 cassette amplified from strain SLJ2059 (Bupp et al., 2007 blue right-pointing triangle). Single-copy integration was verified by Southern blotting. Plasmid pSH129 was constructed by recloning the BamHI-SalI fragment of pSJ148 (bearing the MPS3 gene) into BamHI-SalI–cut pRS316.
The Mps3-N-tetR-mCherry construct, pSB79, was created in a pRS426 backbone through three steps of ligation. The promoter region and N-terminal domain of MPS3 N-terminal domain containing residues 1–151 of MPS3 were amplified from pSJ148 plasmid (Bupp et al., 2007 blue right-pointing triangle) using primers that incorporated the XhoI and AatII, EcoRI restriction sites at the 5′ and 3′ ends of the fragment, respectively. The tetR coding region, flanked by SV40 NLS at its N-terminal end, was amplified from p3524 plasmid (Michaelis et al., 1997 blue right-pointing triangle) using primers that incorporated the AatII and NheI, SpeI restriction sites, whereas the coding region and termination sequence for mCherry were amplified from pKT355 plasmid (Iwase et al., 2006 blue right-pointing triangle) using primers that incorporated the NheI and NotI restriction sites. Initial ligation of Mps3-N′ under its own promoter using the XhoI and EcoRI restriction sites was followed by in-frame ligation of tetR using the AatII and SpeI restriction sites and concluded with in-frame ligation of mCherry and ADHter to the existing Mps3-N-tetR fusion using the NheI and NotI restriction sites. Strains SBY215, SBY216 (ETC6; Mps3-N′); SBY217, SBY218 (ETC4; Mps3-N′); SBY219, SBY220 (LexA-Tfc7; Mps3-N′); SBY221, SBY222 (LexA-Tfc1; Mps3-N′); and SBY223, SBY224 (LexA-Yif1; Mps3-N′) were derived from SBY1, SBY22, SBY147, SBY155, and SBY212, respectively, by transforming the aforementioned strains with the multicopy plasmid pSB79 (pRS426-Mps3-N-tetR-mCherry).
To test for correct homologous insertion and replacement events, suitable PCR amplification reactions were designed to analyze the junction sites. ETC-site deletions, LexA fusions, and pSB79 (Mps3-N′) construct were confirmed by sequencing.
Insulator assays were as described (Simms et al., 2008 blue right-pointing triangle) and barrier assays as in Jambunathan et al. (2005 blue right-pointing triangle). Strains to test ETC1 barrier and insulator activity (Supplemental Figure S6) were constructed as described (Simms et al., 2008 blue right-pointing triangle).
Auxin-inducible degron
To make strains for the auxin-inducible degradation experiments, the OsTIR1 gene was inserted into the genomic URA3 locus of strain SBY22 as described (Nishimura et al., 2009 blue right-pointing triangle) to obtain strain SHY472. To obtain strain SHY476, an auxin-inducible degron was added to the C-terminus of the genomic copy of the TFC3 gene in SHY472 as described (Nishimura et al., 2009 blue right-pointing triangle). Strains SHY472 and SHY476 were cultivated in synthetic raffinose medium buffered at pH5.5 with appropriate auxotrophic selection. At OD600 = 0.2–0.3, galactose was added to a final concentration of 2%. One hour after addition of galactose, IAA (Sigma-Aldrich, St. Louis, MO I2886) was added to a final concentration of 0.5 mM. Cells were examined for ETC4 localization between 1 and 2 h after the addition of IAA.
Chromatin immunoprecipitation
Chromatin immunoprecipitation assays were performed essentially as described (Rusche et al., 2002 blue right-pointing triangle).
Primers
Primers used to assess TFIIIC binding at ETC6 and etc6Δ delete loci (Figure 3B) were as follows:
  • DDO-705 (ATTATTACACGTATCGCAATGG) and
  • DDO-706 (CTATTTCAATTGCGATATACGC)
Primers used to assess binding to lexAOp sequences (Figure 6E) were as follows:
  • DDO-1460 (AAGAAAAAGGGATAAATGCAATG) and
  • DDO-1461 (CTGACTCTTTTCAACAATGCAG).
The primers for the control tDNA R (CCG) on chromosome XII were as follows:
  • DDO-1402 (TACGACATCAAAGTCGCCGAG)
  • DDO-1403 (ATTGACAGCCCTTACGCGAAG)
Other primer sequences are available upon request.
Cytological techniques
Microscopic techniques were performed as described in Hiraga et al. (2006 blue right-pointing triangle). Briefly, a DeltaVision RT (Applied Precision, Issaquah, WA) microscope system with an UPlanApo 100× objective (1.35 numerical aperture; Olympus, Center Valley, PA), CoolSnap HQ monochrome cooled charge-coupled device camera (Photometrics, Tucson, AZ), and SoftWoRx (Applied Precision) acquisition software were used to acquire images. For observation of GFP and mCherry fluorescence, 30 Z-stack images were taken at 250-nm intervals with fluorescein isothiocyanate and tetramethylrhodamine isothiocyanate or DsRed filter sets. Differential interference contrast (DIC) images acquired at the same Z-intervals were used for determination of cell cycle stages by bud size: G1 phase, unbudded; S phase, cells with bud ≤2 μm; G2 phase, cells with a bud >2 μm and a spherical (i.e., nonmitotic) nucleus not at the bud neck.
Quantitative evaluation of GFP-tagged chromosomal dot localization was performed as described (Taddei et al., 2004 blue right-pointing triangle). SoftWoRx Explorer (Applied Precision) was used to measure dot-to–nuclear envelope distance in yeast cells where the GFP dot was located within one of the three equatorial sections of its nucleus. Briefly, localization of the GFP dot was scored in two dimensions against three imaginary concentric zones of equal area, as shown in Figure 1B. At least 300 cells were scored for each isolate measurement (unless otherwise noted). p values were calculated by χ2 test against either random distribution or wild-type values.
Quantitative evaluation of GFP-tagged chromosomal dot colocalization either with the nucleolus or telomere foci was performed as follows. SoftWoRx Explorer was used to measure dot-to-nucleolus or dot-to-telomere foci distance in yeast cells. Briefly, colocalization of the GFP dot to either the nucleolus or telomere foci was scored in two dimensions if the two structures coincided or were juxtaposed (distance <0.26 μm) when observed within the equatorial region of a Z-stack of images (Figure 5, A and B). At least 200 cells were scored for each isolate measurement (unless otherwise noted). p values were calculated by χ2 test against random distribution.
Supplementary Material
Supplemental Materials
Acknowledgments
We thank all the members of the Donaldson group for comments and technical advice. We thank Sue Jaspersen and Susan Gasser for providing strains and constructs. S.B. was funded by a University of Aberdeen Scholarship. This research was supported by Wellcome Trust Grant 082377/Z/07/Z to A.D. and National Science Foundation Grant MCB-0817823 to D.D.
Abbreviations used:
ChIPchromatin immunoprecipitation
COCchromosome-organizing-clamp
ETCextra TFIIIC
GFPgreen fluorescent protein
Pol IIIRNA polymerase III
SUNSad1-UNC-84
TFIIIBtranscription factor IIIB
TFIIICtranscription factor IIIC

Footnotes
This article was published online ahead of print in MBoC in Press (http://www.molbiolcell.org/cgi/doi/10.1091/mbc.E11-04-0365) on April 11, 2012.
  • Albert I, Mavrich TN, Tomsho LP, Qi J, Zanton SJ, Schuster SC, Pugh BF. Translational and rotational settings of H2A.Z nucleosomes across the Saccharomyces cerevisiae genome. Nature. 2007;446:572–576. [PubMed]
  • Andrulis ED, Neiman AM, Zappulla DC, Sternglanz R. Perinuclear localization of chromatin facilitates transcriptional silencing. Nature. 1998;394:592–595. [PubMed]
  • Baker RE, Gabrielsen O, Hall BD. Effects of tRNATyr point mutations on the binding of yeast RNA polymerase III transcription factor C. J Biol Chem. 1986;261:5275–5282. [PubMed]
  • Bartholomew B, Kassavetis GA, Braun BR, Geiduschek EP. The subunit structure of Saccharomyces cerevisiae transcription factor IIIC probed with a novel photocrosslinking reagent. EMBO J. 1990;9:2197–2205. [PubMed]
  • Belgareh N, Doye V. Dynamics of nuclear pore distribution in nucleoporin mutant yeast cells. J Cell Biol. 1997;136:747–759. [PMC free article] [PubMed]
  • Berben G, Dumont J, Gilliquet V, Bolle PA, Hilger F. The YDp plasmids: a uniform set of vectors bearing versatile gene disruption cassettes for Saccharomyces cerevisiae. Yeast. 1991;7:475–477. [PubMed]
  • Bertrand E, Houser-Scott F, Kendall A, Singer RH, Engelke DR. Nucleolar localization of early tRNA processing. Genes Dev. 1998;12:2463–2468. [PubMed]
  • Brickner JH, Walter P. Gene recruitment of the activated INO1 locus to the nuclear membrane. PLoS Biol. 2004;2:e342. [PMC free article] [PubMed]
  • Bupp JM, Martin AE, Stensrud ES, Jaspersen SL. Telomere anchoring at the nuclear periphery requires the budding yeast Sad1-UNC-84 domain protein Mps3. J Cell Biol. 2007;179:845–854. [PMC free article] [PubMed]
  • Carriere L, et al. Genomic binding of Pol III transcription machinery and relationship with TFIIS transcription factor distribution in mouse embryonic stem cells. Nucleic Acids Res. 2012;40:270–283. [PMC free article] [PubMed]
  • Casolari JM, Brown CR, Drubin DA, Rando OJ, Silver PA. Developmentally induced changes in transcriptional program alter spatial organization across chromosomes. Genes Dev. 2005;19:1188–1198. [PubMed]
  • Chung HM, Shea C, Fields S, Taub RN, Van der Ploeg LH, Tse DB. Architectural organization in the interphase nucleus of the protozoan Trypanosoma brucei: location of telomeres and mini-chromosomes. EMBO J. 1990;9:2611–2619. [PubMed]
  • Croft JA, Bridger JM, Boyle S, Perry P, Teague P, Bickmore WA. Differences in the localization and morphology of chromosomes in the human nucleus. J Cell Biol. 1999;145:1119–1131. [PMC free article] [PubMed]
  • D'Ambrosio C, Schmidt CK, Katou Y, Kelly G, Itoh T, Shirahige K, Uhlmann F. Identification of cis-acting sites for condensin loading onto budding yeast chromosomes. Genes Dev. 2008;22:2215–2227. [PubMed]
  • Dawe RK, Sedat JW, Agard DA, Cande WZ. Meiotic chromosome pairing in maize is associated with a novel chromatin organization. Cell. 1994;76:901–912. [PubMed]
  • de Lange T. Human telomeres are attached to the nuclear matrix. EMBO J. 1992;11:717–724. [PubMed]
  • Dieci G, Fiorino G, Castelnuovo M, Teichmann M, Pagano A. The expanding RNA polymerase III transcriptome. Trends Genet. 2007;23:614–622. [PubMed]
  • Donze D, Adams CR, Rine J, Kamakaka RT. The boundaries of the silenced HMR domain in Saccharomyces cerevisiae. Genes Dev. 1999;13:698–708. [PubMed]
  • Duan Z, Andronescu M, Schutz K, McIlwain S, Kim YJ, Lee C, Shendure J, Fields S, Blau CA, Noble WS. A three-dimensional model of the yeast genome. Nature. 2010;465:363–367. [PMC free article] [PubMed]
  • Dujon B. European Functional Analysis Network (EUROFAN) and the functional analysis of the Saccharomyces cerevisiae genome. Electrophoresis. 1998;19:617–624. [PubMed]
  • Ebrahimi H, Donaldson AD. Release of yeast telomeres from the nuclear periphery is triggered by replication and maintained by suppression of Ku-mediated anchoring. Genes Dev. 2008;22:3363–3374. [PubMed]
  • Ebrahimi H, Robertson ED, Taddei A, Gasser SM, Donaldson AD, Hiraga S. Early initiation of a replication origin tethered at the nuclear periphery. J Cell Sci. 2010;123:1015–1019. [PubMed]
  • Finlan LE, Sproul D, Thomson I, Boyle S, Kerr E, Perry P, Ylstra B, Chubb JR, Bickmore WA. Recruitment to the nuclear periphery can alter expression of genes in human cells. PLoS Genet. 2008;4:e1000039. [PMC free article] [PubMed]
  • Funabiki H, Hagan I, Uzawa S, Yanagida M. Cell cycle-dependent specific positioning and clustering of centromeres and telomeres in fission yeast. J Cell Biol. 1993;121:961–976. [PMC free article] [PubMed]
  • Galli G, Hofstetter H, Birnstiel ML. Two conserved sequence blocks within eukaryotic tRNA genes are major promoter elements. Nature. 1981;294:626–631. [PubMed]
  • Gardner JM, Smoyer CJ, Stensrud ES, Alexander R, Gogol M, Wiegraebe W, Jaspersen SL. Targeting of the SUN protein Mps3 to the inner nuclear membrane by the histone variant H2A.Z. J Cell Biol. 2011;193:489–507. [PMC free article] [PubMed]
  • Ghaemmaghami S, Huh WK, Bower K, Howson RW, Belle A, Dephoure N, O'shea EK, Weissman JS. Global analysis of protein expression in yeast. Nature. 2003;425:737–741. [PubMed]
  • Gotta M, Laroche T, Formenton A, Maillet L, Scherthan H, Gasser SM. The clustering of telomeres and colocalization with Rap1, Sir3, and Sir4 proteins in wild-type Saccharomyces cerevisiae. J Cell Biol. 1996;134:1349–1363. [PMC free article] [PubMed]
  • Gottschling DE, Aparicio OM, Billington BL, Zakian VA. Position effect at S. cerevisiae telomeres: reversible repression of Pol II transcription. Cell. 1990;63:751–762. [PubMed]
  • Guacci V, Hogan E, Koshland D. Centromere position in budding yeast: evidence for anaphase A. Mol Biol Cell. 1997;8:957–972. [PMC free article] [PubMed]
  • Guldener U, Heck S, Fielder T, Beinhauer J, Hegemann JH. A new efficient gene disruption cassette for repeated use in budding yeast. Nucleic Acids Res. 1996;24:2519–2524. [PMC free article] [PubMed]
  • Haeusler RA, Pratt-Hyatt M, Good PD, Gipson TA, Engelke DR. Clustering of yeast tRNA genes is mediated by specific association of condensin with tRNA gene transcription complexes. Genes Dev. 2008;22:2204–2214. [PubMed]
  • Harismendy O, Gendrel CG, Soularue P, Gidrol X, Sentenac A, Werner M, Lefebvre O. Genome-wide location of yeast RNA polymerase III transcription machinery. EMBO J. 2003;22:4738–4747. [PubMed]
  • Hartung M, Mirre C, Stahl A. Nucleolar organizers in human oocytes at meiotic prophase I, studied by the silver-NOR method and electron microscopy. Hum Genet. 1979;52:295–308. [PubMed]
  • Hayashi A, Ogawa H, Kohno K, Gasser SM, Hiraoka Y. Meiotic behaviours of chromosomes and microtubules in budding yeast: relocalization of centromeres and telomeres during meiotic prophase. Genes Cells. 1998;3:587–601. [PubMed]
  • Hediger F, Neumann FR, Van Houwe G, Dubrana K, Gasser SM. Live imaging of telomeres: yKu and Sir proteins define redundant telomere-anchoring pathways in yeast. Curr Biol. 2002;12:2076–2089. [PubMed]
  • Heun P, Laroche T, Raghuraman MK, Gasser SM. The positioning and dynamics of origins of replication in the budding yeast nucleus. J Cell Biol. 2001;152:385–400. [PMC free article] [PubMed]
  • Hiraga S, Botsios S, Donaldson AD. Histone H3 lysine 56 acetylation by Rtt109 is crucial for chromosome positioning. J Cell Biol. 2008;183:641–651. [PMC free article] [PubMed]
  • Hiraga S, Robertson ED, Donaldson AD. The Ctf18 RFC-like complex positions yeast telomeres but does not specify their replication time. EMBO J. 2006;25:1505–1514. [PubMed]
  • Iwase M, Luo J, Nagaraj S, Longtine M, Kim HB, Haarer BK, Caruso C, Tong Z, Pringle JR, Bi E. Role of a Cdc42p effector pathway in recruitment of the yeast septins to the presumptive bud site. Mol Biol Cell. 2006;17:1110–1125. [PMC free article] [PubMed]
  • Jambunathan N, Martinez AW, Robert EC, Agochukwu NB, Ibos ME, Dugas SL, Donze D. Multiple bromodomain genes are involved in restricting the spread of heterochromatic silencing at the Saccharomyces cerevisiae HMR-tRNA boundary. Genetics. 2005;171:913–922. [PubMed]
  • Jin Q, Trelles-Sticken E, Scherthan H, Loidl J. Yeast nuclei display prominent centromere clustering that is reduced in nondividing cells and in meiotic prophase. J Cell Biol. 1998;141:21–29. [PMC free article] [PubMed]
  • Kalmarova M, Smirnov E, Masata M, Koberna K, Ligasova A, Popov A, Raska I. Positioning of NORs and NOR-bearing chromosomes in relation to nucleoli. J Struct Biol. 2007;160:49–56. [PMC free article] [PubMed]
  • Kassavetis GA, Bardeleben C, Kumar A, Ramirez E, Geiduschek EP. Domains of the Brf component of RNA polymerase III transcription factor IIIB (TFIIIB): functions in assembly of TFIIIB-DNA complexes and recruitment of RNA polymerase to the promoter. Mol Cell Biol. 1997;17:5299–5306. [PMC free article] [PubMed]
  • Kassavetis GA, Braun BR, Nguyen LH, Geiduschek EP. S. cerevisiae TFIIIB is the transcription initiation factor proper of RNA polymerase III, while TFIIIA and TFIIIC are assembly factors. Cell. 1990;60:235–245. [PubMed]
  • Katou Y, Kanoh Y, Bando M, Noguchi H, Tanaka H, Ashikari T, Sugimoto K, Shirahige K. S-phase checkpoint proteins Tof1 and Mrc1 form a stable replication-pausing complex. Nature. 2003;424:1078–1083. [PubMed]
  • Kendall A, Hull MW, Bertrand E, Good PD, Singer RH, Engelke DR. A CBF5 mutation that disrupts nucleolar localization of early tRNA biosynthesis in yeast also suppresses tRNA gene-mediated transcriptional silencing. Proc Natl Acad Sci USA. 2000;97:13108–13113. [PubMed]
  • Kim SH, McQueen PG, Lichtman MK, Shevach EM, Parada LA, Misteli T. Spatial genome organization during T-cell differentiation. Cytogenet Genome Res. 2004;105:292–301. [PubMed]
  • Klein F, Laroche T, Cardenas ME, Hofmann JF, Schweizer D, Gasser SM. Localization of RAP1 and topoisomerase II in nuclei and meiotic chromosomes of yeast. J Cell Biol. 1992;117:935–948. [PMC free article] [PubMed]
  • Kleinschmidt RA, LeBlanc KE, Donze D. Autoregulation of an RNA polymerase II promoter by the RNA polymerase III transcription factor III C (TF(III)C) complex. Proc Natl Acad Sci USA. 2011;108:8385–8389. [PubMed]
  • Maillet L, Gaden F, Brevet V, Fourel G, Martin SG, Dubrana K, Gasser SM, Gilson E. Ku-deficient yeast strains exhibit alternative states of silencing competence. EMBO Rep. 2001;2:203–210. [PubMed]
  • Marzouki N, Camier S, Ruet A, Moenne A, Sentenac A. Selective proteolysis defines two DNA binding domains in yeast transcription factor tau. Nature. 1986;323:176–178. [PubMed]
  • Michaelis C, Ciosk R, Nasmyth K. Cohesins: chromosomal proteins that prevent premature separation of sister chromatids. Cell. 1997;91:35–45. [PubMed]
  • Moqtaderi Z, Struhl K. Genome-wide occupancy profile of the RNA polymerase III machinery in Saccharomyces cerevisiae reveals loci with incomplete transcription complexes. Mol Cell Biol. 2004;24:4118–4127. [PMC free article] [PubMed]
  • Moqtaderi Z, Wang J, Raha D, White RJ, Snyder M, Weng Z, Struhl K. Genomic binding profiles of functionally distinct RNA polymerase III transcription complexes in human cells. Nat Struct Mol Biol. 2010;17:635–640. [PMC free article] [PubMed]
  • Newman AJ, Ogden RC, Abelson J. tRNA gene transcription in yeast: effects of specified base substitutions in the intragenic promoter. Cell. 1983;35:117–125. [PubMed]
  • Nishimura K, Fukagawa T, Takisawa H, Kakimoto T, Kanemaki M. An auxin-based degron system for the rapid depletion of proteins in nonplant cells. Nat Methods. 2009;6:917–922. [PubMed]
  • Noma K, Cam HP, Maraia RJ, Grewal SI. A role for TFIIIC transcription factor complex in genome organization. Cell. 2006;125:859–872. [PubMed]
  • Oza P, Jaspersen SL, Miele A, Dekker J, Peterson CL. Mechanisms that regulate localization of a DNA double-strand break to the nuclear periphery. Genes Dev. 2009;23:912–927. [PubMed]
  • Parada LA, McQueen PG, Misteli T. Tissue-specific spatial organization of genomes. Genome Biol. 2004;5:R44. [PMC free article] [PubMed]
  • Parelho V, et al. Cohesins functionally associate with CTCF on mammalian chromosome arms. Cell. 2008;132:422–433. [PubMed]
  • Roberts DN, Stewart AJ, Huff JT, Cairns BR. The RNA polymerase III transcriptome revealed by genome-wide localization and activity-occupancy relationships. Proc Natl Acad Sci USA. 2003;100:14695–14700. [PubMed]
  • Robinett CC, Straight A, Li G, Willhelm C, Sudlow G, Murray A, Belmont AS. In vivo localization of DNA sequences and visualization of large-scale chromatin organization using lac operator/repressor recognition. J Cell Biol. 1996;135:1685–1700. [PMC free article] [PubMed]
  • Ruben GJ, Kirkland JG, MacDonough T, Chen M, Dubey RN, Gartenberg MR, Kamakaka RT. Nucleoporin mediated nuclear positioning and silencing of HMR. PLoS One. 2011;6:e21923. [PMC free article] [PubMed]
  • Rusche LN, Kirchmaier AL, Rine J. Ordered nucleation and spreading of silenced chromatin in Saccharomyces cerevisiae. Mol Biol Cell. 2002;13:2207–2222. [PMC free article] [PubMed]
  • Schimmang T, Tollervey D, Kern H, Frank R, Hurt EC. A yeast nucleolar protein related to mammalian fibrillarin is associated with small nucleolar RNA and is essential for viability. EMBO J. 1989;8:4015–4024. [PubMed]
  • Schmid M, Arib G, Laemmli C, Nishikawa J, Durussel T, Laemmli UK. Nup-PI: the nucleopore-promoter interaction of genes in yeast. Mol Cell. 2006;21:379–391. [PubMed]
  • Schober H, Ferreira H, Kalck V, Gehlen LR, Gasser SM. Yeast telomerase and the SUN domain protein Mps3 anchor telomeres and repress subtelomeric recombination. Genes Dev. 2009;23:928–938. [PubMed]
  • Sexton T, Schober H, Fraser P, Gasser SM. Gene regulation through nuclear organization. Nat Struct Mol Biol. 2007;14:1049–1055. [PubMed]
  • Shu X, Shaner NC, Yarbrough CA, Tsien RY, Remington SJ. Novel chromophores and buried charges control color in mFruits. Biochemistry. 2006;45:9639–9647. [PubMed]
  • Simms TA, Dugas SL, Gremillion JC, Ibos ME, Dandurand MN, Toliver TT, Edwards DJ, Donze D. TFIIIC binding sites function as both heterochromatin barriers and chromatin insulators in Saccharomyces cerevisiae. Eukaryot Cell. 2008;7:2078–2086. [PMC free article] [PubMed]
  • Sun FL, Elgin SC. Putting boundaries on silence. Cell. 1999;99:459–462. [PubMed]
  • Taddei A, Gasser SM. Multiple pathways for telomere tethering: functional implications of subnuclear position for heterochromatin formation. Biochim Biophys Acta. 2004;1677:120–128. [PubMed]
  • Taddei A, Hediger F, Neumann FR, Bauer C, Gasser SM. Separation of silencing from perinuclear anchoring functions in yeast Ku80, Sir4 and Esc1 proteins. EMBO J. 2004;23:1301–1312. [PubMed]
  • Tanabe H, Habermann FA, Solovei I, Cremer M, Cremer T. Non-random radial arrangements of interphase chromosome territories: evolutionary considerations and functional implications. Mutat Res. 2002;504:37–45. [PubMed]
  • Thompson M, Haeusler RA, Good PD, Engelke DR. Nucleolar clustering of dispersed tRNA genes. Science. 2003;302:1399–1401. [PubMed]
  • Towbin BD, Meister P, Gasser SM. The nuclear envelope—a scaffold for silencing? Curr Opin Genet Dev. 2009;19:180–186. [PubMed]
  • Valenzuela L, Dhillon N, Kamakaka RT. Transcription independent insulation at TFIIIC-dependent insulators. Genetics. 2009;183:131–148. [PubMed]
  • Venters BJ, et al. A comprehensive genomic binding map of gene and chromatin regulatory proteins in Saccharomyces. Mol Cell. 2011;41:480–492. [PMC free article] [PubMed]
  • Wallace JA, Felsenfeld G. We gather together: insulators and genome organization. Curr Opin Genet Dev. 2007;17:400–407. [PMC free article] [PubMed]
  • West AG, Gaszner M, Felsenfeld G. Insulators: many functions, many mechanisms. Genes Dev. 2002;16:271–288. [PubMed]
Articles from Molecular Biology of the Cell are provided here courtesy of
American Society for Cell Biology