PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Arch Ophthalmol. Author manuscript; available in PMC Jul 9, 2012.
Published in final edited form as:
PMCID: PMC3392190
NIHMSID: NIHMS327225
THE RP2 PHENOTYPE AND PATHOGENETIC CORRELATIONS IN X-LINKED RETINITIS PIGMENTOSA
Thiran Jayasundera,1# Kari EH Branham,1# Mohammad Othman,1 William R Rhoades,1 Athanasios J Karoukis,1 Hemant Khanna,1 Anand Swaroop,1,2,3 and John R. Heckenlively1
1Department of Ophthalmology and Visual Sciences, Kellogg Eye Center, University of Michigan
2Department of Human Genetics, University of Michigan
3Neurobiology, Neurodegeneration, & Repair Laboratory (N-NRL), National Institutes of Health, Bethesda, MD
Corresponding authors: John R. Heckenlively, M.D., University of Michigan, Kellogg Eye Center 1000 Wall Street, Ann Arbor, MI 48105, jrheck/at/umich.edu, Phone: 734-763-2280, Fax: 734-764-3906. Anand Swaroop, Ph.D., National Eye Institute, 9000 Rockville Pike, Building 10 Room 10B11, Bethesda, MD 20892, swaroopa/at/nei.nih.gov, Phone: 301-435-5754, Fax: 301-480-9971
#These authors contributed equally to this investigation
Objective
To assess the phenotype of X-linked retinitis pigmentosa (XLRP) patients with RP2 mutations and correlate the findings with their genotype.
Clinical Relevance
An identifiable phenotype for RP2-XLRP aids in clinical diagnosis and targeted genetic screening.
Methods
Over 600 XLRP patients and carriers were screened during a ten-year period for mutations in the RP2 gene. Twenty-five RP2 patients were evaluated clinically with standardized electroretinography (ERG), Goldmann visual fields, and ocular examinationsl. In addition, well documented cases from the literature were used to augment genotype-phenotype correlations.
Results
In our male cohort under the age of 12 years: 10/11 (91%) patients had macular involvement and 10/11 (91%) had best corrected visual acuities worse than 20/50. Two males from different families (ages 8 and 12) displayed a choroideremia-like fundus, and 9/11( 82%) of male patients were myopic with a mean error of −7.97D. Of patients with ERG data, 9/10 (90%) demonstrated severe rod-cone dysfunction. All three female carriers had macular atrophy in one or both eyes and were myopic (mean −6.23 D). We identified four novel RP2 mutations. All nine nonsense and five of seven missense mutations (71%) resulted in severe clinical presentations.
Conclusion
Screening of the RP2 gene should be prioritized in patients less than 16 years of age characterized by X-linked inheritance, decreased BCVA (e.g.,>20/40), high myopia, and early-onset macular atrophy. We also suggest that patients exhibiting a choroideremia-like fundus appearance who do not have disease-causing mutations in the choroideremia gene (CHM) be screened for variations in RP2. We believe that alterations in function play a significant role in RP2-associated disease pathogenesis.
Retinitis pigmentosa (RP) is a clinically and genetically heterogeneous group of retinal disorders that causes progressive loss of visual function due to rod and cone photoreceptor degeneration. The X-linked forms of RP (XLRP) account for 10–20% of all RP cases.13 Two genes have been cloned for XLRP: Retinitis Pigmentosa GTPase Regulator (RPGR; OMIM 312610)4 and RP2 (OMIM 312600),5, 6 which together account for over 80% of XLRP.710
Mutations in RP2 are reported to cause 7–10% of XLRP. 6, 1115 The RP2 gene is composed of five exons and encodes a widely expressed protein of 350 amino acids.6, 16 The RP2 protein consists of an amino-terminal domain with homology to cofactor C and a carboxyl-terminal domain with homology to nucleoside diphosphate kinase.17 The amino-terminal domain of RP2 binds to a small GTP-binding protein Arl3, which shows homology with ADP-ribosylation factor and is involved in cellular transport regulation mechansims.18 While the 30 amino-terminal residues of RP2 are critical for binding to Arl3, human disease-causing mutations Arg118His and Glu138Gly also reduce the affinity of RP2 to Arl3, indicating a clinically relevant association elsewhere in the protein. Post translational acyl modifications at the N-terminus of RP2 act to target the protein to the plasma membrane, and disruption of this acylation site ultimately leads to the retinitis pigmentosa phenotype.19, 20 The majority of pathogenic sequence alterations found in RP2 represent truncating mutations.11 However, missense mutations have been located in the cofactor C-like domain of RP2.17
Given the considerable phenotypic and genetic heterogeneity associated with XLRP14 and a scarcity of patients with RP2 diagnoses, there has been insufficient information to date to predict the clinical phenotype of a patient based on the RP2 mutation. Although there have been reports containing correlations of RP2 phenotypes with visual function data,9, 12, 14, 21 no large study exists in which clear clinical distinctions have been identified to help make it a recognizable entity to ophthalmologists. A recognizable phenotype would help narrow the differential diagnosis for candidate gene mutational screening for RP2. We have undertaken the present study to carefully analyze the phenotype in a cohort of RP2 patients and carriers found both at our institution and in previously published reports. We have correlated the severity of disease with the predicted effect of the mutation on the putative function of RP2.
Patients
Mutational analysis was performed on 611 DNA samples as part of a larger screening study from the XLRP Repository of the University of Michigan’s Center for Retinal and Macular Degeneration (outside samples not reported). Samples from patients affected with a probable or possible diagnosis of XLRP or X-linked Cone Rod Dystrophy (as described in Breuer et al14) were screened for variations/mutations in the RP2 gene. Mutational analysis was performed as described in Mears et al11 (N = 51), Breuer et al14 (N = 234), or as described below (N = 326).
Included in this genotype-phenotype correlation study are the 18 patients with previously identified RP2 mutations. These patients were clinically evaluated in the Retinal Dystrophy Clinic at the University of Michigan’s Kellogg Eye Center, or at the University of California, Los Angeles’ Jules Stein Eye Institute. All patients gave informed consent and the research was approved by the Institutional Review Board at the University of Michigan. Patients with only a clinical diagnosis of XLRP without documented RP2 mutations were excluded.
The patients are identified throughout the manuscript with a family identification number and an individual identification number (i.e Family Number-Individual Number).
A comprehensive literature search was performed to identify publications containing unambiguous and adequate descriptions of clinical features (age of symptom onset, visual function, electroretinogram (ERG) data, and retinal appearance) of individual patients with RP2 mutations. Data on the seven identified subjects was collected for inclusion and comparison to supplement the cohort from our institution in order to delineate the phenotype of RP2 and make genotype to phenotype correlations.
DNA extraction
DNA was extracted from the whole blood of patients. Primers for amplifying the RP2 exons 2–5 were used as previously reported.6 The sequences for the RP2 exon 1 forward and reverse primers were: 5′ CTTTGATTGGCTCAACAGGC and 5′ GTTCAAGAGAGTGCGGCAG, respectively. These primers amplified 447 bp PCR fragments.
PCR conditions and sequencing
DNA was used at ~ 100 ng per PCR reaction. All the exons except exon 2 were amplified with TaKaRa Ex Taq polymerase. Exon 2 was amplified with AccuPrime high fidelity polymerase (Invitrogen). The annealing temperature for exons 1 and 2 was 59°C. For exons 3, 4 and 5 it was 64°C. All PCR reaction volumes were made to 25 μl, and PCR products were run on 2% agarose gels to verify the sizes and quality of amplification. Prior to submitting the samples for sequencing, the DNA concentration was measured in the NanoDrop 1000 machine. PCR amplicons were then diluted (1–3 ng/μL in distilled water) as required by the sequencing core at the University of Michigan Medical School. Sequencing was done with either forward or reverse primers for exons 1, 3, 4 and 5, and with 4 primers for exon 2.
Mutational data analysis
Sequences were downloaded from the sequencing core server and analyzed using a 4.8 demo version of Sequencher (Gene Code Corporation). The sequences were read by two people independently and mutations were tabulated. The mutations were reconfirmed by running an independent PCR reaction on the samples.
Clinical data
All charts were reviewed for the following clinical features: age at onset of visual disturbance; best corrected visual acuity (BCVA); refractive error (spherical equivalence); macular, pericentral, peripheral retinal, and optic disc appearance (color fundus photographs were also analyzed to supplement the written description in the chart); Goldmann visual field (GVF) data; standardized ERG amplitudes and implicit times. The same information was gathered from previously published cases identified by the literature search. Clinical data was recorded for each patient visit when available; however, not all outcome measures were available at every patient visit.
Clinical severity grading
We devised a novel grading approach to subdivide patients according to two severity categories: less severe and severe (no patients were mild). A patient was considered less severe if he or she had relatively late onset of severe macular dysfunction. Best corrected visual acuity was used as a surrogate for macular function. BCVA was considered severe if worse than 20/50 before age 20 years, worse than 20/100 from age 21–30 years, worse than 20/200 from age 31–40, worse than 20/400 after age 41.
Mutational analysis
Our mutational screening identified 13 families with mutations in RP2 (Table 1). Of these, we have previously reported the genotype of four individuals,11, 14 five mutations we identified have been reported by others, and four are novel changes. The locations of these mutations in relation to all previously reported RP2 mutations are shown in Figure 1. Four novel mutations were identified in these families. They include one missense change (Cys3Ser) identified in exon 1, two missense changes identified in exon 2 (Thr87Ile and Leu253Pro) and one splice site change (IVS1+1 G>A). None of these changes have previously been identified in patients or controls. The chromatograms for these mutations are found in Figure 2. In two of the families, the mutation was also detected in at least one other affected male family member or a carrier female.
Table 1
Table 1
Mutations for families included in this study
Figure 1
Figure 1
Mutations in the RP2 gene
Figure 2
Figure 2
Chromatograms from novel changes identified in RP2 screening
Eighteen patients from 13 families were included from our institution (Table 1). Seven additional patients with well identified phenotypes were added from previously published papers giving a total number of 25 patients (22 affected males and 3 female carriers) for genotype-phenotype correlations.
Clinical Data
Male Cohort Results - Predominant male RP2 phenotype
Fifteen male patients were identified in our mutational screening. We assessed these patients’ macular function based on macular appearance, BCVA, and presence of central scotoma on GVF testing (Table 2). Reported denominators varied slightly with data availability. Of these patients, twelve had good fundus descriptions of their fundus examinations. Eleven out of twelve (92%) patients had manifestations of macular involvement in the form of granularity, atrophy, or a bull’s eye appearance on fundus examination (Figure 3), with 10/11 (91%) of patients showing macular involvement before the age of 12. Nine of eleven patients had BCVA of 20/50 or worse by age 12. Four patients (148–2239, 528–115, 948–2743, and 1167–2760) for whom BCVA was not available from an exam performed before the age of 12 all went on to develop severe vision loss (worse than 20/200) by the 3rd to 7th decade. Tapetal or golden macular sheens were not seen in our RP2 patients, a finding more typical of RPGR X-linked patients. Goldmann visual field testing revealed central scotomata in 50% (5/10) of all male patients for whom testing was performed, including 36% (3/8) of patients under the age of 12. Figure 4 shows examples of RP2-XLRP phenotypes.
Table 2
Table 2
Clinical Characteristics of UM Cohorts and Literature Cohort
Figure 3
Figure 3
Macular atrophy in RP2 patients
Figure 4
Figure 4
Clinical phenotype_variations in XLRP secondary to RP2 mutations
Measurable peripheral GVF data for male patients under the age of 12 years old was found in 8 cases. 75% (6/8) of these patients had constriction of the visual field when tested with the I4e target (median I4e visual field size of 25° OD, 25° OS), and only mild constriction when tested with the IV4e target (median IV4e visual field size of 55° OU). When data was analyzed for patients under the age of 16, 100% (8/8) patients had severe constriction of the visual field when tested with the I4e target (median I4e visual field size of 12.5° OD, 17.5° OS), and still only mild constriction when tested with the IV4e target (median IV4e visual field size of 50° OU).
Data on refractive errors was available for 11/15 patients (Range: Plano to −14 Mean: −6.55 D). Nine out of these eleven (82%) were found to be myopic (Mean: −7.97 D), with the majority (78%, 7/9) of those affected classified as high myopes with greater than −6.00 D (Mean: −8.91 D).
Electroretinograms were performed on 10/15 patients; ninety percent (9/10) of patients demonstrated severe rod-cone dysfunction. One patient (1167–2760) showed cone-rod dysfunction. The degree of cone dysfunction was further represented in the delayed photopic b-wave implicit times in 9/9 (100%) of male patients, with mean implicit times of 47.2 ms OD and 46.8 ms OS (mean normal: 32.3 ± 1.2 ms).
Choroidermemia-like phenotype (N=2)
Two patients (933–2420 and 971–2490) with different mutations (Arg118Cys and Ser172fs) had peripheral choroideremia-like atrophy. Both patients were tested for mutations in CHM, and were found to be negative. The clinical features of patient 971–2490 are illustrated in Figure 4b. There is significant choriocapillaris atrophy in the midperiphery and the posterior pole with no notable pigment deposition.
Two male patients demonstrated a characteristic superior visual field loss similar to the visual field changes attributed to retinal phototoxicity in patients with RHO mutations. As an example, patient 1167–2760 is illustrated in Figure 4c.
Female Carrier Cohort Results
Two of our carrier females manifested a phenotype similar to the affected males, exhibiting atrophic macular changes, poor visual acuity and central scotoma. The third carrier female (1015–2553) demonstrating asymmetrical disease had anisometropia of approximately 8.00 D with the severely affected eye being myopic (Figure 4d) further supporting the association of myopia with RP2 retinal disease. In fact, all three female carriers had macular atrophy in one or both eyes and all three were myopic (mean −6.225 D).
Correlation of Severity to Genotype
When the severity grading criteria described above was applied to all 25 patients examined, only 3 (14%) exhibited a less severe phenotype characterized by a relatively older age of onset of macular dysfunction (1090–2262, 951–2448, Published Case 122), while the vast majority (86%) were considered to have a severe phenotype. Table 1 lists the disease severity and the predicted effect of the mutation on RP2 function. All patients with premature truncations (9/9, patients with frameshift or nonsense mutations) fell into the severely affected group. Interestingly, 5/7 (71%) patients with missense mutations predicted to be hypomorphic (reduced protein function), also exhibited a relatively severe phenotype.
This study represents the largest comprehensive clinical analysis of patients with causative RP2 mutations (the cohort from our institution alone). Previous studies have either been case reports with phenotype descriptions2227 or comparative analyses of many XLRP gene subtypes.12, 21 We have gathered supplemental information from previously published cases yielding meta-analysis-type data on the RP2 clinical phenotype. The present report describes a recognizable phenotype consisting of early onset of macular atrophy and poor visual acuity combined with high myopia. This phenotype runs contrary to the typical forms of RP, where the macula is often spared until late in the disease course. We propose that screening of RP2 should be prioritized in male patients presenting with an X-linked pedigree, high myopia, poor visual acuities, and early-onset macular atrophy.
In addition, screening for RP2 mutations is appropriate in the rare male patients who fail CHM mutation screening. Consistent with the fundus findings in patient 933–2420 with an Arg118Cys mutation, Vorster et al26 noted a similar-like phenotype in a male patient with an Arg120stop mutation. Patient 971–2490 also has a similar choroideremia-like phenotype, and the mutation (Ser172fs) shares the same exon (2) and functional ARL3-binding domain). These data suggest that mutations in this domain (Arg118Cys, Arg120stop, and Ser172fs) can lead to a choroideremia-like phenotype.
Female patients from X-linked RP pedigrees who have high myopia, asymmetrical retinal involvement, macular atrophy, or reduced central visual acuity may also have RP2 mutations. Mutational screening of RP2 is warranted in these cases, which are exemplified by our female carrier patients 1015–2553, 1029–2585, and 948–2443.
Although previously published reports have shown macular atrophy atypical of classic RP23 with poor visual acuity in patients with RP2 mutations,12, 21 a clear clinical phenotype for RP2 mutations has not been described. An overwhelming majority of patients (10/11, 91%) in the cohort of male patients from our institution demonstrated macular atrophy starting at an early age (before age 12). This atrophy progressed into central scotomata in 50% of the patients, and runs counter to the typical RP presentation where the macula is spared until late in the natural history of disease progression. Our results indicate that early macular involvement is a distinguishing clinical feature of disease due to RP2 mutations.
The severe degree of cone photoreceptor dysfunction in RP2 mutations is further supported by the ERG data demonstrating large delays in the photopic b-wave implicit times in all 12/12 (100%) patients in our combined male and female cohorts for whom data was available. This data corroborates the implicit times found by Sharon et al. in patients with RP2 mutations.12 However, only one patient had a clear cone-rod dysfunction pattern on ERG testing, suggesting that rod photoreceptor degeneration is still a prominent feature in this disease.
Predilection for superior visual field loss (inferior retinal disease) attributed to retinal phototoxicity has been described in autosomal dominant RP associated with RHO mutations.28 We encountered a similar superior field loss in four patients: two patients evaluated at our institution, and two in the cohort of published cases, but the role of sunlight in the disease mechanism for RP2 mutations is currently unknown.
The association of high myopia with RP2 mutations has been demonstrated in other studies,17 and we have confirmed this finding in our group of patients. Interestingly, the female carrier (1015–2553) manifesting asymmetrical disease had anisometropia of approximately 8.00 D with the severely affected eye having myopia (Figure 4d), further supporting the concomitance of myopia and RP2.
Correlating the wide spectrum of clinical phenotypes in RP2 patients to their genotypes has been an intriguing puzzle. In general, missense or in-frame deletion mutations are considered hypomorphic as they may result in a mutant protein with reduced function, whereas truncation mutations in RP2 (frameshift or splice site defects) cause severe phenotypes likely due to loss of protein function. However, our examination revealed that missense RP2 mutations are also associated with a severe phenotype. As most of the truncation mutations are found in the amino-terminal domain of RP2, the carboxyl-terminal region may be involved in either providing stability to the protein or is important for maintaining a functional conformation of RP2.
The Arg118His and Arg118Cys mutations are associated with a severe phenotype although previous in vitro biochemical studies predict that mutations at Arg118 result in residual, but not abolished, activity of RP2 and its affinity to Arl3. On the other hand, RP2 Cys3Ser or Ser6del mutations have previously been shown to affect the localization of RP2 to plasma membrane in cultured cells.16, 19 In fact, RP2 Ser6del mutant protein is present at relatively low levels likely due to decreased stability. These results demonstrate that the localization of RP2 to plasma membrane may not be critical for its function. Clinically, we successfully correlated the genotypes from our patient with a Cys3Ser mutation (1090–2262) and a patient from the published literature with a Ser6del mutation (Literature Patient 115) with a less severe phenotype. It is also possible that alternative localization of RP2 within the cells may be affected by some of the mutations. Since Arl3 localizes to photoreceptor sensory cilium and the mouse mutant of Arl3 develops a ciliary phenotype,29 RP2 may be involved in the targeting of Arl3 or modulating its activity at the cilium. Further studies are necessary to resolve these issues.
Splice mutations present another level of complexity associated with the prediction of the phenotype. Such mutations can result in a severe phenotype if they occur early in the gene, resulting in premature truncation.
Taken together, our data provide a platform for clinical identification of XLRP patients with RP2 mutations that can assist in better disease management and genetic counseling. We propose that RP2 be the first gene screened in male patients presenting with an X-linked pedigree, high myopia, poor visual acuities, and macular atrophy in childhood. Future therapeutic modalities for RP2-XLRP should carefully consider the quality and character of the mutant protein expressed in the diseased photoreceptors. Resolving the crystal structure of RP2 has increased our understanding of the role of different aminoacid residues in the protein’s function and the probable effect of disease-associated mutations on its three-dimensional structure and putative function. Our genotype-phenotype analysis has shown that a mutant RP2 protein with reduced activity can result in the same severe phenotype caused by mutations that result in protein degradation. As the biochemical activity of RP2 has not been demonstrated in vivo, further investigations are necessary to carefully analyze the correlation between RP2 mutations and their associated phenotypes, which will aid the design of appropriate clinical treatments.
Acknowledgments
This research is supported by grants from The Foundation Fighting Blindness, the National Eye Institute Intramural Research Program, and National Eye Institute R01 EY007961. Richard Hackel assisted with fundus photography and illustrations. Dr. Paul Sieving evaluated several patients, Dr. Naheed Khan assisted with ERG illustrations, and Jill Oversier assisted with patient coordination.
1. Boughman JA, Conneally PM, Nance WE. Population genetic studies of retinitis pigmentosa. Am J Hum Genet. 1980;32:223–35. [PubMed]
2. Fishman GA. Retinitis pigmentosa. Genetic percentages. Arch Ophthalmol. 1978;96:822–6. [PubMed]
3. Bird AC. X-linked retinitis pigmentosa. Br J Ophthalmol. 1975;59:177–99. [PMC free article] [PubMed]
4. Musarella MA, Burghes A, Anson-Cartwright L, et al. Localization of the gene for X-linked recessive type of retinitis pigmentosa (XLRP) to Xp21 by linkage analysis. Am J Hum Genet. 1988;43:484–94. [PubMed]
5. Bhattacharya SS, Wright AF, Clayton JF, et al. Close genetic linkage between X-linked retinitis pigmentosa and a restriction fragment length polymorphism identified by recombinant DNA probe L1. 28. Nature. 1984;309:253–5. [PubMed]
6. Schwahn U, Lenzner S, Dong J, et al. Positional cloning of the gene for X-linked retinitis pigmentosa 2. Nat Genet. 1998;19:327–32. [PubMed]
7. Musarella MA, Anson-Cartwright L, Leal SM, et al. Multipoint linkage analysis and heterogeneity testing in 20 X-linked retinitis pigmentosa families. Genomics. 1990;8:286–96. [PubMed]
8. Ott J, Bhattacharya S, Chen JD, et al. Localizing multiple X chromosome-linked retinitis pigmentosa loci using multilocus homogeneity tests. Proc Natl Acad Sci U S A. 1990;87:701–4. [PubMed]
9. Pelletier V, Jambou M, Delphin N, et al. Comprehensive survey of mutations in RP2 and RPGR in patients affected with distinct retinal dystrophies: genotype-phenotype correlations and impact on genetic counseling. Hum Mutat. 2007;28:81–91. [PubMed]
10. Teague PW, Aldred MA, Jay M, et al. Heterogeneity analysis in 40 X-linked retinitis pigmentosa families. Am J Hum Genet. 1994;55:105–11. [PubMed]
11. Mears AJ, Gieser L, Yan D, et al. Protein-truncation mutations in the RP2 gene in a North American cohort of families with X-linked retinitis pigmentosa. Am J Hum Genet. 1999;64:897–900. [PubMed]
12. Sharon D, Bruns GA, McGee TL, Sandberg MA, Berson EL, Dryja TP. X-linked retinitis pigmentosa: mutation spectrum of the RPGR and RP2 genes and correlation with visual function. Invest Ophthalmol Vis Sci. 2000;41:2712–21. [PubMed]
13. Hardcastle AJ, Thiselton DL, Van Maldergem L, et al. Mutations in the RP2 gene cause disease in 10% of families with familial X-linked retinitis pigmentosa assessed in this study. Am J Hum Genet. 1999;64:1210–5. [PubMed]
14. Breuer DK, Yashar BM, Filippova E, et al. A comprehensive mutation analysis of RP2 and RPGR in a North American cohort of families with X-linked retinitis pigmentosa. Am J Hum Genet. 2002;70:1545–54. [PubMed]
15. Bader I, Brandau O, Achatz H, et al. X-linked retinitis pigmentosa: RPGR mutations in most families with definite X linkage and clustering of mutations in a short sequence stretch of exon ORF15. Invest Ophthalmol Vis Sci. 2003;44:1458–63. [PubMed]
16. Chapple JP, Hardcastle AJ, Grayson C, Spackman LA, Willison KR, Cheetham ME. Mutations in the N-terminus of the X-linked retinitis pigmentosa protein RP2 interfere with the normal targeting of the protein to the plasma membrane. Hum Mol Genet. 2000;9:1919–26. [PubMed]
17. Kuhnel K, Veltel S, Schlichting I, Wittinghofer A. Crystal structure of the human retinitis pigmentosa 2 protein and its interaction with Arl3. Structure. 2006;14:367–78. [PubMed]
18. Nie Z, Hirsch DS, Randazzo PA. Arf and its many interactors. Curr Opin Cell Biol. 2003;15:396–404. [PubMed]
19. Chapple JP, Hardcastle AJ, Grayson C, Willison KR, Cheetham ME. Delineation of the plasma membrane targeting domain of the X-linked retinitis pigmentosa protein RP2. Invest Ophthalmol Vis Sci. 2002;43:2015–20. [PubMed]
20. Veltel S, Gasper R, Eisenacher E, Wittinghofer A. The retinitis pigmentosa 2 gene product is a GTPase-activating protein for Arf-like 3. Nat Struct Mol Biol. 2008;15:373–80. [PubMed]
21. Sharon D, Sandberg MA, Rabe VW, Stillberger M, Dryja TP, Berson EL. RP2 and RPGR mutations and clinical correlations in patients with X-linked retinitis pigmentosa. Am J Hum Genet. 2003;73:1131–46. [PubMed]
22. Rosenberg T, Schwahn U, Feil S, Berger W. Genotype-phenotype correlation in X-linked retinitis pigmentosa 2 (RP2) Ophthalmic Genet. 1999;20:161–72. [PubMed]
23. Dandekar SS, Ebenezer ND, Grayson C, et al. An atypical phenotype of macular and peripapillary retinal atrophy caused by a mutation in the RP2 gene. Br J Ophthalmol. 2004;88:528–32. [PMC free article] [PubMed]
24. Jin ZB, Liu XQ, Hayakawa M, Murakami A, Nao-i N. Mutational analysis of RPGR and RP2 genes in Japanese patients with retinitis pigmentosa: identification of four mutations. Mol Vis. 2006;12:1167–74. [PubMed]
25. Mashima Y, Saga M, Hiida Y, Imamura Y, Kudoh J, Shimizu N. Novel mutation in RP2 gene in two brothers with X-linked retinitis pigmentosa and mtDNA mutation of leber hereditary optic neuropathy who showed marked differences in clinical severity. Am J Ophthalmol. 2000;130:357–9. [PubMed]
26. Vorster AA, Rebello MT, Coutts N, et al. Arg120stop nonsense mutation in the RP2 gene: mutational hotspot and germ line mosaicism? Clin Genet. 2004;65:7–10. [PubMed]
27. Wada Y, Nakazawa M, Abe T, Tamai M. A new Leu253Arg mutation in the RP2 gene in a Japanese family with X-linked retinitis pigmentosa. Invest Ophthalmol Vis Sci. 2000;41:290–3. [PubMed]
28. Heckenlively JR, Rodriguez JA, Daiger SP. Autosomal dominant sectoral retinitis pigmentosa. Two families with transversion mutation in codon 23 of rhodopsin. Arch Ophthalmol. 1991;109:84–91. [PubMed]
29. Schrick JJ, Vogel P, Abuin A, Hampton B, Rice DS. ADP-ribosylation factor-like 3 is involved in kidney and photoreceptor development. Am J Pathol. 2006;168:1288–98. [PubMed]
30. De Luca A, Torrente I, Mangino M, Danesi R, Dallapiccola B, Novelli G. Three novel mutations causing a truncated protein within the RP2 gene in Italian families with X-linked retinitis pigmentosa. Mutat Res. 2001;432:79–82. [PubMed]