Search tips
Search criteria 


Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
Cancer Prev Res (Phila). Author manuscript; available in PMC 2012 June 15.
Published in final edited form as:
PMCID: PMC3375599

Intratumoral Epiregulin Is a Marker of Advanced Disease in Non–Small Cell Lung Cancer Patients and Confers Invasive Properties on EGFR-Mutant Cells


Non–small cell lung cancer (NSCLC) cells with activating epidermal growth factor receptor (EGFR) somatic mutations have unique biological properties, including high expression of the ErbB ligand epiregulin; however, the biological role of epiregulin in these cells has not been elucidated. To examine its role, we used an immunohistochemical approach to detect epiregulin expression in NSCLC biopsy samples and pharmacologic and genetic approaches to inhibit epiregulin in cultured NSCLC cells. In NSCLC biopsy samples, epiregulin was detected in 237 of 366 (64.7%) tumors, which correlated with nodal metastasis and a shorter duration of survival. In EGFR-mutant NSCLC cell lines, treatment with a small-molecule EGFR tyrosine kinase inhibitor diminished mRNA levels of the gene encoding epiregulin (EREG). The ability of EGFR-mutant NSCLC cells to invade through Matrigel in vitro was inhibited by treatment with an anti-epiregulin neutralizing antibody or by transfection with an EREG short hairpin RNA. Collectively, these findings show that epiregulin expression correlated with advanced disease, was EGFR dependent, and conferred invasive properties on NSCLC cells. Additional studies are warranted in NSCLC patients to evaluate whether epiregulin expression predicts the metastatic potential of primary tumors and whether anti-epiregulin treatment strategies are efficacious in the prevention of metastasis.

Treatment with epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors leads to rapid and sustained tumor shrinkage in a subset of patients with non–small cell lung cancer (NSCLC; refs. 13). The tumor cells in these patients have somatic mutations in the EGFR kinase domain that constitutively activate EGFR (13). Mouse models constructed to investigate the oncogenicity of mutant EGFR develop invasive lung adenocarcinomas that regress after treatment of the mice with EGFR tyrosine kinase inhibitors (4, 5). Similarly, immortalized human bronchial epithelial cells acquire malignant properties after transfection with mutant EGFR (6). Treatment with EGFR tyrosine kinase inhibitors induces apoptosis of these EGFR-transfected cells and NSCLC cells with somatic mutations in EGFR (7, 8). Thus, evidence from human, murine, and cellular models indicates that mutant EGFR is oncogenic and confers EGFR dependence on NSCLC for cell survival.

Some of the downstream mediators of mutant EGFR that confer oncogenic properties on NSCLC cells have been identified. For example, EGFR forms a heterodimeric complex with ErbB3, which binds to and directly activates phosphatidylinositol 3-kinase and maintains cell survival through AKT-dependent mechanisms (9, 10). Other prosurvival signals in EGFR-mutant NSCLC cells are mediated through Src family kinases, which are constitutively activated (11, 12), and by the proapoptotic BH3-only BCL2 family member BIM, which is transcriptionally suppressed (1316). Anchorage-independent growth of these cells is maintained by a different set of mediators, including cyclooxygenase-2, EphA2 receptor tyrosine kinase, and the EphA2 ligand ephrin A1 (17). Thus, mutant EGFR regulates the expression and activity of proteins involved in diverse cellular functions that together promote cellular transformation.

To date, there are few reports on downstream mediators of mutant EGFR that promote NSCLC metastasis. In breast cancer models, metastatic properties are conferred by a genetic signature encoding proteins involved in a broad range of cellular functions, including, among others, genes encoding the ErbB ligand epiregulin, cyclooxygenase-2, the chemokine CXCL1, and the metalloproteinase matrix metalloproteinase 1 (18). Epiregulin is a broad-specificity ErbB ligand and is one of several ErbB ligands that are highly expressed in EGFR-mutant NSCLC cells (19). In this study, we hypothesized that epiregulin confers metastatic potential on NSCLC cells and tested this hypothesis in vivo by carrying out studies on NSCLC biopsy samples and in vitro by using pharmacologic and genetic approaches to inhibit epiregulin in NSCLC cell lines.

Materials and Methods


NSCLC cell lines were passaged in RPMI 1640 supplemented with 10% fetal bovine serum at 37°C in the presence of 5% CO2. We purchased nonradioactive kinase assay kits for p38 (Cell Signaling Technologies, Inc.). We obtained small-molecule inhibitors of EGFR (gefitinib, AstraZeneca), mammalian target of rapamycin (CCI-779, Wyeth-Ayerst), mitogen-activated protein kinase/extracellular signal-regulated kinase kinase 1 (CI-1040, Pfizer Pharmaceuticals), c-jun NH2-terminal kinase (SP600125, Celgene Pharmaceuticals), and AKT (A838450.3, Abbott Pharmaceutical Products).

We purchased an antihuman epiregulin antibody for immunohistochemical and neutralization studies from R&D Systems; secondary antibody for fluorescent detection (murine IgG TRITC) from Sigma Chemicals; anti–total EGFR antibody for Western blotting from Neo-Markers; anti–phospho-EGFR (Y1068), anti–phospho-S6 (S236/235), anti–phospho-extracellular signal-regulated kinase (T202/Y204), anti–phospho-c-Jun (S63), anti–phospho-glycogen synthase kinase-3α/β (S21/9), anti–total S6, anti–total extracellular signal-regulated kinase-1/2, anti–total c-Jun, and anti–total glycogen synthase kinase-3β antibodies from Cell Signaling Technologies; and anti-Flag and anti–β-actin antibodies from Sigma-Aldrich.

Semiquantitative reverse transcription-PCR assays

Total RNA was prepared from cell lines using the TRIzol reagent protocol (Invitrogen). RNA (1 µg) was reverse transcribed and then subjected to PCR with the following epiregulin-specific primers: 5′-GCGCCCGCTCCCATCGCCG-3′ (forward) and 5′-TGGAACCGACGACTGTGATA-3′ (reverse). β-Actin was used as an internal control. PCR products were separated on 1.5% agarose gels.

Quantitative PCR assays

The level of mRNA for each gene was measured with SYBR Green–based real-time PCR. The primers used for real-time PCR were designed by using Primer Express (Applied Biosystems). The EREG primer sequences used were 5′-TGTTTGCATGGACAGTGCATC-3′ and 5′-GCAGTAGTTTTGACTCATGTCCACC-3′, and the L32 ribosomal protein primers were 5′-CCTTGTGAAGCCCAAGATCG-3′ and 5′-TGCCGGATGAACTTCTTGGT-3′. Each cDNA sample (7 µL) was amplified by using SYBR Green PCR Master Mix according to the manufacturer's instructions. The PCR products and their dissociation curves were detected with the 7500 Fast Real-time PCR System (Applied Biosystems). The level of the housekeeping gene ribosomal protein L32 in each sample was used as an internal control.

In vitro assays of cell proliferation and invasion

Cell proliferation was measured using the WST-1 {4-[3-(4-iodophenyl)-2-(4-nitrophenyl)-2H-5-tetrazolio]-1,3-benzene disulfonate} colorimetric dye reduction method (Roche). Cells (2.5 × 103) were cultured in 96-well plates and then subjected to WST-1 assays as specified by the supplier. The percentages of cell densities for each treatment group, relative to the cell densities in control (DMSO-treated) cultures, were determined by measuring WST-1 absorbance at 450 nm.

For in vitro invasion assays, 2 × 104 to 8 × 104 cells were plated in the upper chamber of Transwell plates (three wells per condition) containing a polyethylene terephthalate filter with 8-µm pores (BD Biosciences). The membranes in the upper chambers were coated with Matrigel (24-well Matrigel invasion chambers). RPMI medium with 10 µg/mL neutralizing anti-epiregulin antibody or control IgG was added to the upper and lower chambers in serum-free conditions to avoid the confounding effects of exogenous chemoattractants. After 22 h of incubation at 37°C, the cells on the upper surface of the membrane were removed with a cotton swab, leaving the cells on the lower surface, which were then stained with Wright's stain in methanol and examined microscopically (×4 magnification). Stained cells were counted in five fields per filter. The assays were repeated thrice.

Western blot analysis

Cells were subjected to Western blot analysis and detection by enhanced chemiluminescence (Amersham) as previously described (19).

Tissue microarrays of NSCLC biopsy specimens

Tissue microarrays were constructed from formalin-fixed, paraffin-embedded blocks using triplicate core samples from each tumor, as previously described (19).

Epiregulin immunohistochemistry

For immunohistochemical analysis, 4-µm tissue sections were deparaffinized, rehydrated, and washed with PBS. Antigens were retrieved by adding 0.01 mol/L citrate buffer (pH 6; DakoCytomation) and incubating the slides in a steamer for 30 min. Samples were blocked for endogenous activity in 3% hydrogen peroxide/PBS, avidin/biotin solution (Zymed Laboratories), and DAKO serum-free protein block (DakoCytomation) and then incubated with polyclonal goat anti-human epiregulin antibody (R&D Systems) overnight at 4°C. After being rinsed, the slides were incubated with a biotinylated link antibody and streptavidin labeled with peroxidase from the labeled streptavidin-biotin kits (DakoCytomation). The slides were then stained by adding three to four drops of 3,3′-diaminobenzidine tetra-hydrochloride solution and counterstained with Mayer's hematoxylin for 1 min. For negative controls to determine the specificity of the immunostaining results, we preincubated the primary antibody with recombinant epiregulin (R&D Systems). Staining intensity and extension were quantified by one investigator (M.G.R.) who was blinded to patient identity. Tissues were visualized at ×20 magnification for scoring.

EREG short hairpin RNA transfection studies

pSM2 retroviral scrambled short hairpin RNA (shRNA) control and human Ereg shRNAmir clones were purchased from Open Biosystems. The four EREG-specific shRNAmir sequences used included EREG-1, TAAGAATCACGGTCAAAGCCA; EREG-2, TATGCATTTATGCATTTGTGGT; EREG-3, TTAACGGTCAGAATATATTGGG; and EREG-4, TTGATACAATTCAGTAATCCGA. PT67 fibroblasts (Becton Dickson) were transfected with control or an EREG-specific shRNAmir construct (1, 2, 3, or 4) and selected for 21 d in 2 µg/mL puromycin to generate mass populations of retrovirus-producing cells. Supernatants from PT67 cells were concentrated using a 0.45-µm polyvinylidene difluoride filter. HCC827 cells were exposed to retrovirus in the presence of 5 µg/mL polybrene (Sigma) overnight. The media were then replaced with fresh media, and the transfectants were incubated overnight. This transfection process was repeated four times to increase the transfection efficiency. Mass populations of transiently transfected cells were used in the experiments.

Terminal deoxyribonucleotidyl transferase–mediated dUTP nick-end labeling assay

HCC827 cells were infected with virus supernatant of shRNA scrambled control, sh-Ereg-1, or sh-Ereg-3. After four cycles of virus infection, cells were plated in 100-mm dishes and grown for 3 d. The adherent and floating cells were then pooled and evaluated for induction of apoptosis by terminal deoxyribonucleotidyl transferase–mediated dUTP nick end labeling (TUNEL; Apo-BRDU kit, Phoenix Flow Systems). Briefly, the cells were fixed in 1% paraformaldehyde containing PBS and then in 70% ethanol, washed, and labeled with bromodeoxyuridine. After additional washing, labeled cells were treated with fluorescein-labeled anti-bromodeoxyuridine monoclonal antibody and propidium iodide/RNase solution before flow cytometric analysis (BD CaliburTM) to determine the percentage of apoptotic cells.

Statistical analysis

Summary statistics were provided for continuous variables (mean, SD, and range) and categorical variables (frequency tables). Each tumor in the tissue microarray was represented by three core samples. The epiregulin staining score for each core sample was quantified on the basis of staining intensity and extension (intensity × extension), and the scores of the three core samples were averaged to determine the tumor score. Epiregulin scores were analyzed as continuous and dichotomized variables. Dichotomization was based on a cutoff score of 100 (positive if ≥100, negative otherwise). Comparisons of continuous variables across levels of clinical factors were made using ANOVA or the Kruskal-Wallis test, when appropriate. Associations between clinical factors were made using the χ2 test or Fisher's exact test, when appropriate. Survival curves were estimated using the Kaplan-Meier method, and comparisons of survival curves between subgroups of patients were made using the log-rank test. The Cox proportional hazards model method was used to build multivariate survival models to assess the effects of biomarkers and clinical factors on patients' overall survival. All tests were two sided, with P ≤ 0.05 considered statistically significant. Statistical analysis was carried out using SAS version 9 software (SAS Institute).


Epiregulin expression correlates with advanced nodal disease

To evaluate epiregulin expression in NSCLC, we performed immunohistochemical analysis on NSCLC biopsy samples. For these studies, we used a tissue microarray constructed from 366 randomly collected NSCLC biopsy samples from patients with localized disease (stages I–III). Most of the tumors had been annotated for relevant clinical variables (see Supplementary Table S1). Negative controls, including omission of the primary antibody and preincubation of the primary antibody with blocking peptide, confirmed the specificity of the immunohistochemical staining (Fig. 1A, a–c).

Fig. 1
Intratumoral epiregulin expression correlates with poor prognosis in NSCLC. A, epiregulin detection by immunohistochemistry. a to c, anti-epiregulin–specific staining. Immunohistochemical analysis of a NSCLC biopsy sample in the presence (a) and ...

The staining varied in intensity and extent between tumor biopsy samples and was detected predominantly in the cytoplasmic compartment (Fig. 1A, d–g). Of the 366 tumors examined, 237 (64.7%) stained positively for epiregulin. Association of staining with clinical variables revealed a correlation between staining and the presence of advanced nodal (N2) disease (P = 0.04; Table 1) and a trend toward a shorter duration of survival (P = 0.054; Fig. 1B) that became more evident (P = 0.014) after we corrected for differences in covariates (age, pathologic nodal and tumor stage, and histologic subtype). We found no correlation of epiregulin expression with other variables (age, race, sex, smoking status, or histologic subtype; data not shown). Thus, epiregulin staining was detected in a subset of NSCLC biopsy samples, and this group of patients had a poorer clinical outcome than those patients with epiregulin-negative tumors had.

Table 1
Intratumoral epiregulin expression correlated with nodal status

Epiregulin expression is EGFR dependent

To evaluate the biological role of epiregulin in NSCLC, we used the NSCLC cell lines HCC827, H3255, and HCC2279, which express the gene encoding epiregulin (EREG; ref. 19). EREG expression was higher in these EGFR-mutant cell lines than in others that express wild-type EGFR (H1299, H460, A549, H322, and H596; Fig. 2A). To examine whether EREG expression was EGFR dependent, HCC827 cells were treated with gefitinib, an EGFR tyrosine kinase inhibitor. Gefitinib sharply reduced EREG mRNA levels (Fig. 2B). Treatment with selective inhibitors of certain serine/threonine kinases known to mediate EGFR actions, including mitogen-activated protein kinase/extracellular signal-regulated kinase kinase 1 (CI-1040) or p38 (SB202190), decreased EREG mRNA levels, whereas treatment with inhibitors of other EGFR-dependent kinases did not (Fig. 2B). Thus, EREG expression was EGFR dependent and was regulated by specific downstream mediators of EGFR.

Fig. 2
EREG expression is EGFR dependent. A, EREG mRNA was detected by semiquantitative PCR analysis of RNA prepared from a panel of NSCLC cell lines in which EGFR is mutant (HCC827, H3255, and HCC2279) or wild-type (H1299, H460, A549, H322, and H596). Actin ...

Epiregulin confers invasive properties and maintains cell survival

To inhibit the actions of epiregulin, we treated NSCLC cells with an anti-epiregulin neutralizing antibody. The cells were maintained in serum-free conditions to eliminate the confounding effects of exogenous growth factors. Using a titer of anti-epiregulin antibody titer that decreased EGFR phosphorylation in HCC827 cells (Fig. 3A), showing its ErbB ligand-inhibitory effect, we examined whether treatment diminished cellular proliferation in monolayer cultures and invasion through Matrigel. We used the same titer of anti-epiregulin antibody on serum-starved HCC2279 cells, in which basal EGFR phosphorylation was at the lower limits of detection by Western blot analysis (data not shown). For these assays, we used HCC827 and HCC2279 cells but not H3255 cells because the latter exhibited no detectable invasive activity under these conditions. Relative to the effect of IgG control, the anti-epiregulin neutralizing antibody inhibited the ability of HCC827 and HCC2279 cells to invade (Fig. 3B) but not to proliferate (data not shown).

Fig. 3
Pharmacologic inhibition of epiregulin in NSCLC cell lines. A, EGFR phosphorylation is epiregulin dependent. Western blotting of HCC827 cells treated for 24 h with an anti-epiregulin neutralizing antibody (+) or IgG control (−). Bands were quantified ...

To evaluate the role of epiregulin by another approach, we depleted EREG from EGFR-mutant NSCLC cells by transiently transfecting them with EREG shRNA retroviral vectors that targeted different EREG coding sequences (constructs 1–4) to examine whether the different shRNA sequences induced consistent biological effects. We obtained efficient EREG depletion in HCC827 cells and H3255 cells (Fig. 4A) but not in HCC2279 cells (data not shown). EREG depletion diminished the number of HCC827 cells and H3255 cells in monolayer cultures (Fig. 4B) and induced apoptosis, as shown in HCC827 cells by cleavage of poly(ADP-ribose) polymerase (PARP), a caspase-3 substrate, and by TUNEL assays to quantify the percentages of cells with DNA fragmentation (Fig. 4C). EREG depletion caused no evidence of cell cycle arrest based on propidium iodide staining to assess DNA content in the transfectants (data not shown). Before the onset of apoptosis, EREG-depleted HCC827 cells exhibited reduced invasive ability, as shown by Matrigel assays done 24 hours after transfection (Fig. 4D). Thus, EREG was required for the invasive capacity and survival of these cells.

Fig. 4
Genetic inhibition of epiregulin in NSCLC cells. A, efficient EREG depletion by shRNA constructs. Quantitative PCR analysis of EREG mRNA in NSCLC cell lines transiently transfected with retroviral vectors expressing EREG shRNA constructs (14 ...


Here, we showed that intratumoral epiregulin expression correlated with lymph node metastasis and a shorter duration of survival in NSCLC patients and that epiregulin enhanced the invasive and proliferative activities of NSCLC cell lines. Of note, cell proliferation was inhibited by EREG shRNA transfection but not by treatment with an anti-epiregulin neutralizing antibody. Although the reason for this discrepancy is not clear, one possibility is that EREG shRNA transfection achieved a more efficient inhibition of epiregulin than the neutralizing antibody did. The genetic focus of this study was on EGFR-mutant NSCLC cells, but the findings presented here might be relevant to NSCLC cells with other mutated proto-oncogenes. Supporting this possibility is the fact that epiregulin is highly expressed in K-ras–mutant cancer cells, including those of KrasLA1 mice, which develop lung adenocarcinoma due to somatic K-ras mutations (19, 20). Moreover, these findings build on previous reports that ErbB ligands maintain the proliferation and survival of EGFR-mutant NSCLC cells (7, 21) by showing that epiregulin is a crucial mediator of NSCLC invasion.

The biological effects of EREG depletion observed here were similar to those of the EGFR-neutralizing antibody cetuximab, which induces apoptosis of HCC827 cells (7). Epiregulin has no affinity for ErbB3 or ErbB4; low affinity for EGFR; and low to moderate affinity for the heterodimeric complexes EGFR/ErbB2, ErbB2/3, and ErbB2/4 (22, 23). The ErbB heterodimeric complexes identified thus far in EGFR-dependent NSCLC cells include ErbB2/3 and EGFR/ErbB3, both of which activate prosurvival signals through phosphatidylinositol 3-kinase (9, 10, 21). Collectively, these findings suggest that ErbB ligands promote the invasive capacity and survival of EGFR-mutant NSCLC cells through EGFR-dependent and EGFR-independent mechanisms.

We found that EREG expression was attenuated by specific inhibitors of EGFR and two of its downstream mediators, p38 and mitogen-activated protein kinase/extracellular signal-regulated kinase kinase 1. A similar pattern of regulation has been reported for the mRNA encoding the cytokine macrophage inflammatory protein-2 (MIP-2). The 3′-untranslated region of MIP-2 contains AU-rich elements that bind to heterogeneous ribonucleoprotein A0 in a p38- and mitogen-activated protein kinase/extracellular signal-regulated kinase kinase 1–dependent manner and thereby stabilize MIP-2 mRNA (2426). Through this mechanism, proinflammatory stimuli such as lipopolysaccharide regulate the expression of MIP-2 and other cytokines in macrophages (2426). EREG also contains AU-rich elements in its 3′-untranslated region, raising the possibility that EREG is regulated through a posttranscriptional mechanism similar to that of MIP-2. If so, then proinflammatory and oncogenic stimuli converge on EREG and MIP-2 through a common posttranscriptional mechanism. Moreover, these findings indicate that EREG is part of a feed-forward loop by which EGFR maintains the activity of ErbB dimeric complexes in EGFR-mutant NSCLC cells.

Findings reported here have potential clinical implications. In patients with EGFR-mutant NSCLC who receive treatment with an EGFR tyrosine kinase inhibitor, their disease typically shrinks initially and then recurs due to the emergence of tyrosine kinase inhibitor–resistant clones that have undergone additional EGFR mutations that abrogate tyrosine kinase inhibitor binding (2729). Given the high likelihood of disease recurrence, treatment approaches are needed to prevent the invasion and subsequent metastasis of EGFR-mutant NSCLC before the emergence of tyrosine kinase inhibitor–resistant disease. On the basis of the findings reported here, metastasis prevention might be achieved by the use of anti-epiregulin neutralizing antibodies alone or in combination with other agents that target the ErbB axis at multiple levels. For example, strategies have been developed to inhibit the tyrosine kinase activities of multiple ErbB family members (e.g., the EGFR/ErbB2 inhibitor lapatinib), the formation of specific ErbB dimeric complexes (e.g., the ErbB2 dimerization inhibitor 2C4), receptor neutralization (e.g., cetuximab and the ErbB2 inhibitor Herceptin), or ErbB proligand cleavage (e.g., inhibitors of specific proteases such as “a disintegrin and metalloproteinases”; refs. 22, 30, 31). Clinical trials should be considered to investigate the efficacy of these approaches, alone and in combination, in patients with EGFR-mutant NSCLC.


Grant support: NIH grants R01 CA117965 and P50 CA70907.


Disclosure of Potential Conflicts of Interest

No potential conflicts of interest were disclosed.

Note: Supplementary data for this article are available at Cancer Prevention Research Online (


1. Lynch TJ, Bell DW, Sordella R, et al. Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small-cell lung cancer to gefitinib. N Engl J Med. 2004;350:2129–2139. [PubMed]
2. Paez JG, Janne PA, Lee JC, et al. EGFR mutations in lung cancer: correlation with clinical response to gefitinib therapy. Science. 2004;304:1497–1500. [PubMed]
3. Pao W, Miller V, Zakowski M, et al. EGF receptor gene mutations are common in lung cancers from “never smokers” and are associated with sensitivity of tumors to gefitinib and erlotinib. Proc Natl Acad Sci U S A. 2004;101:13306–13311. [PubMed]
4. Ji H, Li D, Chen L, et al. The impact of human EGFR kinase domain mutations on lung tumorigenesis and in vivo sensitivity to EGFR-targeted therapies. Cancer Cell. 2006;9:485–495. [PubMed]
5. Politi K, Zakowski MF, Fan PD, Schonfeld EA, Pao W, Varmus HE. Lung adenocarcinomas induced in mice by mutant EGF receptors found in human lung cancers respond to a tyrosine kinase inhibitor or to down-regulation of the receptors. Genes Dev. 2006;20:1496–1510. [PubMed]
6. Sato M, Vaughan MB, Girard L, et al. Multiple oncogenic changes (K-RAS(V12), p53 knockdown, mutant EGFRs, p16 bypass, telomerase) are not sufficient to confer a full malignant phenotype on human bronchial epithelial cells. Cancer Res. 2006;66:2116–2128. [PubMed]
7. Amann J, Kalyankrishna S, Massion PP, et al. Aberrant epidermal growth factor receptor signaling and enhanced sensitivity to EGFR inhibitors in lung cancer. Cancer Res. 2005;65:226–235. [PubMed]
8. Sordella R, Bell DW, Haber DA, Settleman J. Gefitinib-sensitizing EGFR mutations in lung cancer activate anti-apoptotic pathways. Science. 2004;305:1163–1167. [PubMed]
9. Engelman JA, Janne PA, Mermel C, et al. ErbB-3 mediates phosphoinositide 3-kinase activity in gefitinib-sensitive non-small cell lung cancer cell lines. Proc Natl Acad Sci U S A. 2005;102:3788–3793. [PubMed]
10. Engelman JA, Mukohara T, Zejnullahu K, et al. Allelic dilution obscures detection of a biologically significant resistance mutation in EGFR-amplified lung cancer. J Clin Invest. 2006;116:2695–2706. [PubMed]
11. Song L, Morris M, Bagui T, Lee FY, Jove R, Haura EB. Dasatinib (BMS-354825) selectively induces apoptosis in lung cancer cells dependent on epidermal growth factor receptor signaling for survival. Cancer Res. 2006;66:5542–5548. [PubMed]
12. Zhang J, Kalyankrishna S, Wislez M, et al. SRC-family kinases are activated in non-small cell lung cancer and promote the survival of epidermal growth factor receptor-dependent cell lines. Am J Pathol. 2007;170:366–376. [PubMed]
13. Gong Y, Somwar R, Politi K, et al. Induction of BIM is essential for apoptosis triggered by EGFR kinase inhibitors in mutant EGFR-dependent lung adenocarcinomas. PLoS Med. 2007;4:e294. [PubMed]
14. Costa DB, Halmos B, Kumar A, et al. BIM mediates EGFR tyrosine kinase inhibitor-induced apoptosis in lung cancers with oncogenic EGFR mutations. PLoS Med. 2007;4:1669–1679. [PMC free article] [PubMed]
15. Cragg MS, Kuroda J, Puthalakath H, Huang DC, Strasser A. Gefitinib-induced killing of NSCLC cell lines expressing mutant EGFR requires BIM and can be enhanced by BH3 mimetics. PLoS Med. 2007;4:1681–1689. [PMC free article] [PubMed]
16. Deng J, Shimamura T, Perera S, et al. Proapoptotic BH3-only BCL-2 family protein BIM connects death signaling from epidermal growth factor receptor inhibition to the mitochondrion. Cancer Res. 2007;67:11867–11875. [PubMed]
17. Choi K, Creighton CJ, Stivers D, Fujimoto N, Kurie JM. Transcriptional profiling of non-small cell lung cancer cells with activating EGFR somatic mutations. PLoS ONE. 2007;2:e1226. [PMC free article] [PubMed]
18. Minn AJ, Gupta GP, Siegel PM, et al. Genes that mediate breast cancer metastasis to lung. Nature. 2005;436:518–524. [PMC free article] [PubMed]
19. Fujimoto N, Wislez M, Zhang J, et al. High expression of ErbB family members and their ligands in lung adenocarcinomas that are sensitive to inhibition of epidermal growth factor receptor. Cancer Res. 2005;65:11478–11485. [PubMed]
20. Baba I, Shirasawa S, Iwamoto R, et al. Involvement of deregulated epiregulin expression in tumorigenesis in vivo through activated Ki-Ras signaling pathway in human colon cancer cells. Cancer Res. 2000;60:6886–6889. [PubMed]
21. Zhou BB, Peyton M, He B, et al. Targeting ADAM-mediated ligand cleavage to inhibit HER3 and EGFR pathways in non-small cell lung cancer. Cancer Cell. 2006;10:39–50. [PubMed]
22. Jones JT, Akita RW, Sliwkowski MX. Binding specificities and affinities of egf domains for ErbB receptors. FEBS Lett. 1999;447:227–231. [PubMed]
23. Shelly M, Pinkas-Kramarski R, Guarino BC, et al. Epiregulin is a potent pan-ErbB ligand that preferentially activates heterodimeric receptor complexes. J Biol Chem. 1998;273:10496–10505. [PubMed]
24. Ridley SH, Dean JL, Sarsfield SJ, Brook M, Clark AR, Saklatvala J. A p38 MAP kinase inhibitor regulates stability of interleukin-1-induced cyclooxygenase-2 mRNA. FEBS Lett. 1998;439:75–80. [PubMed]
25. Rousseau S, Morrice N, Peggie M, Campbell DG, Gaestel M, Cohen P. Inhibition of SAPK2a/p38 prevents hnRNP A0 phosphorylation by MAPKAP-K2 and its interaction with cytokine mRNAs. EMBO J. 2002;21:6505–6514. [PubMed]
26. Winzen R, Kracht M, Ritter B, et al. The p38 MAP kinase pathway signals for cytokine-induced mRNA stabilization via MAP kinase-activated protein kinase 2 and an AU-rich region-targeted mechanism. EMBO J. 1999;18:4969–4980. [PubMed]
27. Pao W, Miller VA, Politi KA, et al. Acquired resistance of lung adenocarcinomas to gefitinib or erlotinib is associated with a second mutation in the EGFR kinase domain. PLoS Med. 2005;2:e73. [PubMed]
28. Carter TA, Wodicka LM, Shah NP, et al. Inhibition of drug-resistant mutants of ABL, KIT, and EGF receptor kinases. Proc Natl Acad Sci U S A. 2005;102:11011–11016. [PubMed]
29. Kobayashi S, Boggon TJ, Dayaram T, et al. EGFR mutation and resistance of non-small-cell lung cancer to gefitinib. N Engl J Med. 2005;352:786–792. [PubMed]
30. Agus DB, Akita RW, Fox WD, et al. Targeting ligand-activated ErbB2 signaling inhibits breast and prostate tumor growth. Cancer Cell. 2002;2:127–137. [PubMed]
31. Heymach JV, Nilsson M, Blumenschein G, Papadimitrakopoulou V, Herbst R. Epidermal growth factor receptor inhibitors in development for the treatment of non-small cell lung cancer. Clin Cancer Res. 2006;12 4441–5s. [PubMed]