PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
J Immunol. Author manuscript; available in PMC 2012 June 13.
Published in final edited form as:
PMCID: PMC3374343
NIHMSID: NIHMS310236

Early Response of Mucosal Epithelial Cells During Toxoplasma gondii Infection

Abstract

The innate immune response of mucosal epithelial cells during pathogen invasion plays a central role in immune regulation in the gut. Toxoplasma gondii (T. gondii) is a protozoan intracellular parasite that is usually transmitted through oral infection. Although much of the information on immunity to T. gondii has come from intraperitoneal infection models, more recent studies have revealed the importance of studying immunity following infection through the natural per-oral route. Oral infection studies have identified many of the key players in the intestinal response; however, they have relied on responses detected days to weeks following infection. Much less is known about how the gut epithelial layer senses and reacts during initial contact with the pathogen. Given the importance of epithelial cells during pathogen invasion, this study uses an in vitro approach to isolate the key players and examine the early response of intestinal epithelial cells during infection by T. gondii. We show that human intestinal epithelial cells infected with T. gondii elicit rapid MAPK phosphorylation, NF-κB nuclear translocation, and secretion of interleukin (IL)-8. Both ERK1/2 activation and IL-8 secretion responses were shown to be MyD88 dependent and TLR2 was identified to be involved in the recognition of the parasite regardless of the parasite genotype. Furthermore, we were able to identify additional T. gondii-regulated genes in the infected cells using a pathway-focused array. Together, our findings suggest that intestinal epithelial cells were able to recognize T. gondii during infection, and the outcome is important for modulating intestinal immune responses.

Introduction

A single layer of intestinal epithelial cells that line the mucosal surface must prevent the entry of exogenous antigens, allow absorption of essential nutrients and yet initiate effective and appropriate immune responses when pathogens are present (1). Host defenses at mucosal surfaces include the secretion of IgA, defensins, and cytokines and chemokines. IgA and defensins prevent bacterial adherence and contribute to pathogen elimination, while cytokines and chemokines participate in gut homeostasis as well as recruitment of immune cells during infection. Epithelial cells express several innate immune receptors including nucleotide oligomerization domain (NODs) proteins and Toll-like receptors (TLRs) that participate in initiating the immune response (2). However, activation is tightly controlled to prevent pathology due to mucosal inflammation (2-6). Upon encounter with pathogenic bacteria, epithelial cells elicit a potent response that shapes the ensuing immune response (7, 8)

T. gondii is an orally acquired apicomplexan protozoan parasite (9). Human infections are usually asymptomatic, but reactivation of chronic infection in immunosuppressed individuals results in toxoplasmic encephalitis (10, 11). Serological surveys have estimated that one third of the world’s population has been exposed to this parasite (12). However, there is no vaccine and therapeutic treatment regimens have significant side effects. T. gondii infections are controlled primarily by T lymphocytes. IL-12, and TNF-α, are critical cytokines for stimulating Th1 CD4+ T cell induced protection (13, 14), while interferon gamma (IFN-γ) plays a major role in protection through CD8+ T cells (14, 15).

TLRs are innate immune receptors that directly recognize microbial structures and initiate an inflammatory response. All TLRs, except TLR3, use the adapter molecule MyD88 to initiate the signaling cascade. MyD88 deficient mice are highly susceptible to T. gondii infection due to a failure to produce IL-12 (16). Multiple TLRs have been linked to protective immunity against T. gondii infection. In mice, TLR11 expressed by DCs is required for secretion of IL-12 in response to stimulation with the T. gondii protein profilin (17, 18). TLR2 deficient mice show increased susceptibility with high dose intraperitoneal infection (19). Oral infection of mice results in intestinal inflammation, ileitis, in wild type but not mice deficient in TLR9 or TLR4 (20, 21). This suggests that TLR9 and TLR4 may play a much more important role in initiating immunity to T. gondii at the mucosal surface. The role of TLRs in human cell recognition of T. gondii infection is much less well studied. Human TLR2 can respond to glycosylphosphatidylinositols (GPIs) from T. gondii, but the role of TLRs during live infection of human cells, especially in the gut has not been studied.

T. gondii can infect the gut mucosa by direct invasion of epithelial cells in the small intestine (22). Therefore, epithelial cells may respond directly to T. gondii infection and initiate early local mucosal immune responses. This is supported by in vitro RNAse protection studies using an immortalized mouse small intestinal enterocyte cell line, which demonstrated that the chemokines MCP-1, MIP-1 and eotaxin were induced upon infection (23). In the present study, we have investigated whether human intestinal epithelial cells respond directly to infection with T. gondii and by what mechanism this recognition occurs.

Materials and Methods

Cell culture and parasites

Henle 407 (human embryonic intestinal epithelial cells), HEK293 (human embryonic kidney cells), and HS27 (human foreskin fibroblast) were maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with containing 2 mM L-glutamine, 50 units/ml penicillin, 50 μg/ml streptomycin, 10 mM HEPES, 1 mM sodium pyruvate, and 10% low endotoxin fetal bovine serum. T. gondii tachyzoites strain were maintained by serial 2 days passages on HS27 monolayers in DMEM. All cell cultures and parasites were routinely checked for mycoplasma by a high sensitivity PCR-ELISA based Mycoplasma detection kit (Roche, Indianapolis IN).

In vitro infections

T. gondii tachyzoites were added to Henle 407 cells and were briefly centrifuged (400 × g, 1 min) to initiate parasite and cell contact. At time points indicated in each figure legends, supernatants or cell lysates were collected for further analyses. In some experiments, 50ng/mL wortmannin (WM) was added 2 hours prior infection.

In vivo passage of T. gondii tachyzoites

To pass the parasite through mice, 5×104 RH tachyzoites were infected to C57BL/6 mice by intraperitoneal (i.p.) infections. After 3 days of infection, the parasites were collected from the peritoneal fluid and washed once with HBSS. The parasites were then expanded by one additional passage in HS27 fibroblast prior stimulation.

Antibodies

Abs specific to total and phosphorylated forms of ERK1/2, p38, and PKB (Akt) were from Cell Signaling Technology (Danvers, MA). Anti-MyD88 polyclonal Ab was from Alexis Biotechnology (San Diego, CA). NF-κB p65 antibody was from Santa Cruz Biotechnology, Inc (Santa Cruz, CA), and AlexaFluor 594 was from Molecular Probes (Invitrogen, Carlsbad, CA).

NF-κB translocation assay

For immunofluorescence analyses, Henle 407 cells were plated at a density of 2-3 × 105 cells per well on sterile coverslips placed in 24-well plate. Cell monolayers were infected with T. gondii RH-YFP tachyzoites and were then fixed with 3% paraformaldehyde in PBS for 20 min at room temperature. Fixed cells were permeabilized with 0.1% Triton X-100 in TBS (TBS-TX) for 15 min and blocked in 1% BSA in TBS-TX for 20 min. The cells were then stained with primary rabbit anti-NF-κB p65 (1:1000) followed by secondary antibody goat anti–rabbit IgG conjugated to AlexaFluor 594. Nuclei were stained using DAPI (1:10000). Confocal images were taken with a Leica laser scanning confocal microscope using a 63×lens. Contrast and brightness of individual channels were adjusted linearly in Photoshop (Adobe). For Western Blot analyses, Henle 407 cells were plated at a density of 1.5 × 106 cells per well in 6-well plate and infected with T. gondii RH for the indicated times. Cytoplasmic and nuclear proteins were isolated according to previous protocols (24) and blotted for p65 (1:500).

RNA interference

SureSilencing human MyD88 shRNA, TLR2, and TLR9 shRNA and control plasmids were purchased from SuperArray Bioscience Corp (Frederick, MD). Henle 407 cells were transfected using TransIT Transfection Reagent (Mirus Bio, Madison, WI) according to manufacturer’s protocols. Transfected cells were selected with neomycin (1.0 mg/mL) for 14 days, and antibiotic-resistant individual colonies were isolated for further analysis and maintained in the presence of neomycin. For transient transfections, Henle 407 cells were transfected with shRNA plasmids by electroporation. Cells were used at 48 to 96 hr post transfection.

RNA extraction and PCR analysis

Total RNA of Henle 407 cells infected with T. gondii was extracted using the RNeasy mini kit (QIAGEN, Valencia, CA). Reverse transcription of the RNA (1 μg) was performed using ImProm-II™ Reverse Transcription System (Promega, Madison, WI). PCR was performed in 25 μL of a reaction mixture containing 1 μL of the reverse-transcribed RNA. The final PCR products were electrophoresed on 2% agarose gels and visualized using UV light illumination after ethidium bromide staining. Real-time PCR was performed in the Applied Biosystems 7500 Real-Time PCR System (Applied Biosystems Inc., Foster City, CA) according to the manufacture instructions. The reaction was performed using the Power SYBR Green PCR Master Mix. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as internal controls for each sample. The primers used are as follows: IL-8 forward: AGCCTTCCTGATTTCTGCAGCTCT; IL-8 reverse: AATTTCTGTGTTGGCGCAGTGTGG; CCL20 forward: AGTTTGCTCCTGGCTGCTTTGATG; CCL20 reverse CTGCCGTGTGAAGCCCACAATAAA; CCL15 forward: TTGGATCCCAGGCCCAGTTCATAA; CCL15 reverse: AGCAGTCAGCAGCAAAGTGAAAGC; CCL24 forward: ATGCCTCAAGGCAGGAGTGATCTT; CCL24 reverse: TCTTCATGTACCTCTGGACCCACT; MyD88 forward: AGATGATCCGGCAACTGGAACAGA; MyD88 reverse: AGTCACATTCCTTGCTCTGCAGGT. TLR and GAPDH primers are used as previously described (25, 26).

Luciferase reporter assays

HEK293 cells were plated at 1 × 104 cells/well in 96-well plates. Cells were transfected using TransIT Transfection Reagent (Mirus) and a total of 200 ng DNA/well consisting of human TLR2 plasmids, and NF-κB or IL-8 luciferase reporters. Cells were stimulated with TLR2 ligand, or infected with T. gondii tachyzoites, lysed in reporter lysis buffer (Promega), and assayed for luciferase (Promega) activity. NF-κB activity was calculated and processed by Microsoft Excel.

Gene array analysis

The commercial pathway-focused oligonucleotide microarrays (OHS-011, Human Inflammatory Cytokines & Receptors Microarray) were purchased from SuperArray Bioscience Corp. The array analyses were performed using a chemiluminescence-based detection system according to the manufacturer’s instructions. Images of the array were developed on X-ray films. Image data sets were scanned and analyzed using ScanAlyze (Eisen Lab), and Microsoft Excel software. Background adjustment was performed by subtracting the lowest measured value on the membrane from the values of all genes. The signals from the expression of each gene on the array were normalized against the signal from the internal housekeeping gene GAPDH to obtain the processed data sets. Fold changes were calculated as the normalized ratio of average experimental processed data sets divided by the average medium control processed data sets. Thresholds were set to select for genes up-regulated two fold or more. The original array data were deposited in National Center for Biotechnology Information GEO database under accession number GSE18085.

Cytokine ELISA

Production of IL-8 was measured with the human CXCL8/IL-8 DuoSet ELISA Development Kits (R&D Systems, Minneapolis, MN) according to the manufacturer’s instructions.

Statistical Analysis

Minitab® 15 Statistical Software (Minitab, State College, PA) was used for Student’s t tests. A P value of < 0.05 was considered significant.

Results

Intestinal epithelial cells respond to T. gondii infection in vitro

Oral infection with T. gondii results in ileitis in C57BL/6 mice mediated by a robust Th1 type of response (23). CD4+ T cells synergize with intestinal epithelial cells to drive the secretion of Th1 type cytokines and various chemokines. The response of intestinal epithelial cells directly to the parasite during the early stage of infection in mouse, and especially in human, remains unclear. To determine if human intestinal epithelial cells respond directly to T. gondii, we incubated T. gondii tachyzoites (RH strain) with human intestinal epithelial cell lines. Consistent with other studies on large intestine, colon cell lines did not activate mitogen-activated protein kinases (MAPKs) in response to T. gondii infection even though they were permissive for infection and parasite replication (data not shown). T. gondii also infected the human small intestinal epithelial cell line Henle 407 (Supplementary Fig. 1). The kinetics of infected Henle 407 cells showed increased parasite invasion during the first few hours, followed by parasite replication after 8 hours as indicated by the appearance of rosettes (Supplementary Fig. 1 arrows). Unlike colon cell lines, T. gondii infection of Henle 407 cells induced phosphorylation of both ERK1/2 and p38 MAPKs by 15 minutes (Fig. 1A). ERK1/2 and p38 phosphorylation decreased at 30 minutes and was reduced nearly to baseline by 45 minutes.

Figure 1
Intestinal epithelial cells respond to T. gondii infection. (A) Henle 407 cells were infected with RH tachyzoites (parasite to cell ratio 6:1) for the indicated times. Whole cell lysates were collected for immunoblotting with antibodies against total ...

NF-κB regulates proinflammatory and anti-apoptotic genes in response to pathogens. To determine whether T. gondii infection of Henle 407 cells results in activation of NF-κB, we infected the cells for various times with RH tachyzoites and immunoblotted cytosolic and nuclear extracts for p65 NF-κB. Translocation of NF-κB to the nucleus was observed as early as 15 minutes, peaked at 60 minutes, and was still detected two hours post infection (Fig. 1C). Infection with transgenic parasites expressing YFP allowed the visualization of infected cells. Staining for p65 NF-κB demonstrated that infected, but not uninfected, cells translocated NF-κB to the nucleus (Fig. 1D).

Early immune defense against T. gondii involves recruitment of several innate immune cell populations including neutrophils, macrophages, dendritic cells and eosinophils (27-30). Neutrophils, recruited by IL-8 (MIP-2 in mice), are often the first cell type recruited to the area of infection and provide the initial source of IL-12 that triggers Th1 T cell mediated immunity (27, 31). Therefore, we next tested if epithelial cells could participate in the recruitment of neutrophils by secreting IL-8 in response to T. gondii infection. Henle 407 cells produced significant levels of IL-8 at 12 hours after infection with T. gondii (Fig. 1B). IL-8 levels continued to rise up to 24 hours post infection. Taken together these data demonstrate that human small intestinal epithelial cells directly respond to infection with T. gondii tachyzoites by activating MAPK and NF-κB signaling cascades as well as producing chemokines that actively participate in the innate immune response to T. gondii.

T. gondii infected intestinal epithelial cells express several inflammatory genes

Oral infection studies have demonstrated an increase in several cytokines and chemokines in response to T.gondii infection; however, the mixed population of the intestinal mucosa did not allow for the determination of the relative role that specific cell populations play in the production of these mediators. To address the role of intestinal epithelial cells to modulate the cytokine environment early following infection, we used specific pathway arrays to identify cytokines and chemokines induced 4 hours after exposure to T. gondii. At this time point most cells have become infected, but the parasites have not replicated. Consistent with previous studies on late responses, infected epithelial cells expressed higher levels of proinflammatory chemokines including macrophage inflammatory protein-1a (MIP-1a/CCL3) and -2 (MIP-2/CXCL2), RANTES/CCL5, monocyte chemotactic protein-2 (MCP-2/CCL8), -3 (MCP-3/CCL7), and INF-γ-inducible protein-10 (IP-10) (Table 1). The induced cytokines and chemokines included ones that induce neutrophil chemotaxis (IL-8, MIP-2/CXCL2), homing of mucosal DCs (CCL20), and migration of DCs to sites of infection (MIP-1α/CCL3 and RANTES/CCL5) (27) (32). Of note, IL-18, which enhances IL-12 mediated immune responses to T. gondii, was highly induced in infected epithelial cells (33-35). By PCR analysis, there was little to no IL-8 mRNA, but a low level of IL-18 mRNA in uninfected cells. Four hours after infection, both IL-8 and IL-18 mRNA were upregulated, supporting our array data (Supplementary Fig. 2). Real-time PCR analysis confirmed the upregulation of several neutrophil and monocyte chemoattractants including IL-8, CCL15, CCL20, and CCL24 upon T. gondii infection (Fig. 2). Together, these data demonstrate that human intestinal epithelial cells induce chemotactic and inflammatory mediators capable of modulating the local immune response early (minutes to hours) after infection.

Figure 2
Cytokine and chemokine induction by T. gondii infection. Human IL-8, CCL15, CCL20, and CCL24 gene transcripts levels were measured by Real-time PCR analysis 4 hours post T. gondii infection. The data are normalized to GAPDH and compared against uninfected ...

Epithelial cell response to T. gondii is PI-3 kinase independent

T. gondii infection of mouse macrophages induces MAPK and protein kinase B (PKB, also known as Akt) activation through a Gi-dependent PI-3 kinase signaling pathway (36). Similar to macrophages, phosphorylation of Akt occurred in Henle 407 cells 60 minutes after T. gondii infection (Fig. 3A). The PI-3 kinase inhibitor wortmannin completely blocked T. gondii induced phosphorylation of Akt, but only slightly reduced the phosphorylation of ERK1/2 and p38 at 15 minutes and had no detectable effect on ERK1/2 at 60 minutes (Fig. 3A). Constitutive production of IL-8 was dramatically inhibited by treatment with wortmannin (Fig. 3B compared to no infection controls). However, T. gondii infection of wortmannin treated cells still resulted in an induction of IL-8 secretion with similar fold induction as untreated cells (Fig. 3B). Real-time PCR analysis demonstrated that IL-8 mRNA upregulation was not affected by wortmannin in infected or uninfected cells (Fig. 3C). This suggests that while the steady state production of IL-8, but not mRNA production, is dependent on PI-3 kinase, T. gondii induced upregulation is independent of PI-3 kinase.

Figure 3
T. gondii induced MAPK activation and IL-8 secretion in intestinal epithelial cells is PI-3 kinase signaling independent. (A) Henle 407 cells were preincubated 2 hr with or without PI-3 kinase inhibitor wortmannin (WM, 50 ng/mL) followed by infection ...

Epithelial cell response to T. gondii infection is MyD88 dependent

TLR9 has been implicated in the host response to oral infection with T. gondii since TLR9 deficient mice fail to develop ileitis that is observed in wild type mice (21). Both hematopoietic and non-hematopoietic cells express TLR9, and experiments using bone marrow chimeras suggest that both compartments are critical for the host response. However, it is unclear if non-hematopoietic cells, such as epithelial cells, respond directly to T. gondii through TLR9, or if the response is secondary to commensal bacterial leak into the lamina propria following damage to the epithelium. To determine if TLR9, or other TLRs, play a role in early response of epithelial cells to T. gondii, we depleted MyD88 from Henle 407 cells by stable expression of a short hairpin RNA (shRNA) against MyD88. All TLRs, except TLR3, are dependent on MyD88 for signal transduction. Control shRNA transfected Henle 407 cells expressed similar levels of MyD88 protein as non-transfected cells. However, cells transfected with the MyD88 shRNA expressed significantly less MyD88 protein, confirming the effect of the RNAi mediated knockdown (Fig. 4A). Upon T. gondii infection, cells deficient in MyD88 had a significantly reduced level of ERK1/2 phosphorylation, and a slightly reduced level of p38 phosphorylation, compared to control cells (Fig. 4B and data not shown). Furthermore, MyD88 deficient cells failed to induce IL-8 upon exposure to T. gondii (Fig 4C). MyD88 is also an adapter protein for IL-1 and IL-18. Since IL-18 is induced upon T. gondii infection, and contributes to small intestinal pathology in C57BL/6 mice (33, 34), it remains possible that the MyD88 dependence is via IL-18 signaling. However, in Henle 407 cells, both the bioactive form of IL-18 and caspase-1 were not detected until 6 hours post T. gondii infection (unpublished observation). This suggested that while IL-18 mRNA level is regulated after infection, the post-translational cleavage to generate the bioactive form of IL-18 did not occur until later. Therefore, MyD88 plays a critical role in the response of Henle 407 small intestine epithelial cells to T. gondii infection most likely through a TLR.

Figure 4
T. gondii induced MAPK activation and IL-8 secretion is MyD88 dependent. (A) Henle 407 cells were either untransfected, transfected with control shRNA plasmids, or MyD88 shRNA plasmids carrying the MyD88 RNA interference sequence. Cell lysates from the ...

T. gondii activates TLR2 on intestinal epithelial cells

Similar to other studies on primary human small intestine cells, Henle 407 cells expressed most of the TLRs except TLR8 (37) (Fig. 5A). Stimulation with TLR ligands, or phorbol-12-myristate-13-acetate (PMA) as a control, induced phosphorylation of ERK1/2 and p38 within 15 minutes (TLR1/2: Pam3Cys; TLR2/6: Malp-2; TLR3: polyI:C; TLR4: LPS; TLR5: flagellin; TLR7: loxoribine; TLR9: CpG DNA) (Fig. 5B and data not shown). To specifically identify which human TLR was involved in T. gondii recognition, we reconstituted HEK293 cells with each human TLR independently and measured activation of NF-κB following stimulation with positive control ligands, soluble Toxoplasma antigen (STAg) or live T.gondii infection using a luciferase reporter. While each positive control ligand stimulated NF-κB activation in the respective TLR expressing cells, only TLR2 expression was permissive for NF-κB response to live T.gondii infection (Fig. 6A). STAg failed to activate NF-κB, suggesting that live infection was required.

Figure 5
TLR genes are expressed in Henle 407 cells. (A) Total RNA was collected from Henle 407 cells, reverse transcribed to cDNA and then amplified for human TLR or GAPDH by PCR. Genomic DNA was used as a positive control. (B) Henle 407 cells were treated with ...
Figure 6
Human TLR2 is involved in recognition of T. gondii. (A) HEK293 cells were transfected with different human TLRs and an NF-κB luciferase reporter plasmid. The transfected HEK293 cells were stimulated with TLR ligands, STAg, or infected with live ...

To confirm the role of TLR2 in Henle 407 cell response to T. gondii infection, we knocked down TLR2 expression using shRNA. Transient transfection with TLR2 shRNA depleted the mRNA relative expression levels to 6% of wild type (Fig. 6B). Knockdown of TLR2 reduced the activation of ERK1/2, p38, and IL-8 induction in response to T. gondii infection (Fig. 6C and D). Transient transfection of MyD88 shRNA gave similar results compared to stably transfected cells (Fig. 6C and D compared to Fig. 4). TLR2 knockdown in Henle 407 cells does not completely block the response of MAPK activation and IL-8 induction. Therefore, the response is almost entirely MyD88 dependent, but only partially dependent on TLR2. Attempts to combine TLR2 with other TLRs, including TLR4 and TLR9, in our HEK293 based stimulation assay did not result in further increases in NF-κB activation (data not shown). TLR2 was required for IL-8 production since its expression in HEK293 cells was sufficient to permit induction of an IL-8 regulated luciferase reporter (Fig. 6E). Pretreatment with ERK1/2 inhibitor U0126 inhibited IL-8 luciferase. These data demonstrate that TLR2 induced IL-8 production was through the ERK1/2 pathway (Fig. 6E). In our system, TLR9 was neither necessary nor sufficient for epithelial cell response to T. gondii infection (Supplementary Fig. 3 and Fig. 6A). Taken together, T. gondii induced IL-8 is dependent on ERK1/2, MyD88, and TLR2.

Genotype of T. gondii does not influence epithelial cell response

T.gondii strains have been classified into 3 clonal lineages that differ in their pathogenicity in mouse models (38). Several strains of each clonal lineage were tested for their ability to induce epithelial cell response and activate TLR2. Henle 407 cells phosphorylated ERK1/2 in response to all strains from each of the three lineages (Fig. 7A, and data not shown; Type 1: RH, GT; Type 2: PT-G, CC, DEG; and Type 3: VEG). The various strains differed dramatically in their capacity to induce phosphorylation of p38, but there was no correlation with genotype (Fig. 7A). All strains induced NF-κB activation through TLR2 (Fig. 7B, and data not shown). The type I RH strain had a lower capacity to induce NF-κB when compared to another Type I strain, GT-1 (data not shown). RH tachyzoites grown in cell cultures have reduced virulence when compared to those passaged in mice (39). Similarly, we observed that RH tachyzoites passaged in mice induced significantly more TLR2-dependent NF-κB activation than those passaged through fibroblasts in vitro (data not shown). The ability of live T. gondii to activate cellular responses through TLR2 was not unique to human cells, since cells transfected with mouse TLR2 responded similarly (data not shown). Together, we conclude that TLR2 dependent activation of signaling cascades by T. gondii is not genotype dependent.

Figure 7
MAPK activation and TLR2 dependent response to T. gondii is not strain type specific. (A) Henle 407 cells were infected with, GT-1 (Type I), CC, DEG (Type II), and VEG (Type III) T. gondii strains for the indicated time points. Total cell lysates were ...

Discussion

In the present study, we evaluated the initial cellular responses of human intestinal epithelial cells to T. gondii infection. This type of study is critical for identifying the very early innate immune responses to parasitic infection of the intestinal mucosa. Using an in vitro model, where an isolated cell type is directly exposed to the infectious agent offers the advantage over mixed cell populations in identifying the response of a specific cell type. Most studies on the immune response to T. gondii infection have used a peritoneal challenge model for this orally acquired pathogen. More recently, the importance of studying the natural route of infection has revealed the importance of epithelial cell response in influencing the outcome of the local and systemic immune response (40, 41). By examining the response of the cells most likely to first encounter the pathogen, we can begin to uncover the early responses that may limit, or induce, the spread of T. gondii to other tissues such as muscle and brain, where a persistent infection results. Therefore, it is highly relevant to study the response of these cells during T. gondii infection, which occurs both locally in the intestine and systemically.

Very little is known about the human intestinal response to T. gondii infection; therefore, a major finding of this study is that human small intestinal epithelial cells directly respond to T. gondii within minutes to activate signaling cascades. The neutrophil chemoattractant IL-8 is upregulated both at the protein and mRNA level within hours. Several additional cytokines and chemokines are also upregulated at the mRNA level within 4 hours. During mouse infections with T. gondii, neutrophils are critical for host defense and are one of the first cells recruited to the site of infection. They play a key role in the recruitment and activation of macrophages and DCs (27, 31, 42). Therefore, our findings that the human small intestine epithelial cell line, Henle 407, directly responds to T. gondii infection suggests that in vivo epithelial response would modulate the local inflammatory environment to initiate host defense against infection.

This series of studies also elucidates the molecular mechanism for epithelial response to T. gondii infection. We show that, similar to macrophages and DCs, epithelial cells activate the MAPK pathway. The inability of MyD88 deficient epithelial cells to secrete IL-8 and activate ERK1/2 during infection suggests that TLRs play a critical role in the initiation of mucosal inflammatory process. Human TLR2 responds to live T. gondii infection in our heterologous reconstitution assay. However, knocking down TLR2 with short hairpin RNAs in intestinal epithelial cells only partially reduced the activation of ERK1/2. So while TLR2 contributes to epithelial response to T. gondii infection, there is likely an interaction with additional TLRs or other receptors that we could not detect in our assay. In fact, preliminary examination of the dependence of several cytokines and chemokines on MyD88 and TLR2 using shRNA knockdown revealed a complex pattern. While several genes were TLR2 dependent (IL-8, CCL10, CCL15), a few were TLR2 independent, MyD88 dependent (CCL5 (RANTES) and CCL11). IL-18 and CCL20 did not depend on either MyD88 or TLR2 (data not shown). TLR4 and TLR9 are candidates to work in concert with TLR2 for the production of cytokines and chemokines since mice deficient in these TLRs have reduced intestinal pathology during oral T. gondii infection. Furthermore, TLR9 in either hematopoietic or nonhematopoietic compartments is important for efficient T cell responses to oral infection (21). However, in our in vitro system, knocking down TLR9 in Henle 407 cells or reconstituting TLR9 in HEK293 cells does not affect the MAPK or elicit NF-κB response to T. gondii. Commensal bacteria are present in the intestine and are capable of activating TLR9. Therefore, it is likely that the TLR9 dependent pathology induced during oral infection with T. gondii is secondary to epithelial damage and recognition by TLR9 of bacteria that penetrate the epithelial barrier.

Ligands for TLR2 include lipopeptides, lipoproteins and GPIs. GPI anchored proteins are abundant on the surface of T. gondii tachyzoites, and GPIs from Trypanosoma cruzi, Plasmodium falciparum activate TLR2 (43, 44). T. gondii GPIs also stimulate cytokine production in macrophages through TLR2 and TLR4 (45, 46). Direct studies on the role of TLR2 in human intestinal epithelial cells during T. gondii infection are lacking. Our data suggest that activation of TLR2 requires live parasites, or at least components not present in STAg, or damaged or lost during the preparation of STAg. The molecular component of T. gondii that intestinal epithelial cells recognize via TLR2 remains unknown.

The molecular mechanisms by which T. gondii activates of epithelial cells and macrophages are different. In macrophages, T. gondii exploits Gi-protein mediated signaling to activate PI-3 kinase that leads to Akt and ERK1/2 activation, a process that is independent of MyD88 signaling (36). We show that inhibition of PI-3 kinase had no effect on the ability of epithelial cells to respond to infection. T. gondii infection of macrophages fails to induce NF-κB nuclear translocation and in fact inhibits activation in response to TLR ligands such as LPS (47, 48). In epithelial cells, NF-κB translocation to the nucleus was not impaired. Similar results in infected murine embryonic fibroblasts (MEFs) have been reported (49, 50). Both ERK1/2 and p38 kinases were activated by T. gondii infection of epithelial cells; however, activation was almost entirely dependent on MyD88 but only partially dependent on TLR2. Additional innate immune receptors or other recognition mechanisms present in the intestinal epithelial cells may cooperate to regulate the immune response of T. gondii infection. These other receptors are unlikely to be TLRs since attempts to co-express other TLRs with TLR2 did not enhance the response in our HEK293 based stimulation assay.

There are three clonal lineages of T. gondii that differ ability to induce cytokines and in virulence. Low virulence type II parasites show higher induction level of IL-12p40, IL-10, IL-1β, and IL-6, where as high virulence type I parasites attract more neutrophils during infection (51, 52). We predicted that ability to activate TLR2 might correlate with lower virulence due to an increased activation of the immune response especially since NF-κB activation and cytokine secretion in immune cells correlates with genotype (53). However, all types elicited ERK1/2 and p38 MAPK activation through TLR2. Although the strains varied in the level of activation, there was no correlation with genotype. Virulence and cytokine induction differences among strains are not due to ability to activate epithelial cells via TLR2.

In summary, this study demonstrates that human intestinal epithelial cells directly respond to T. gondii infection via MyD88 and TLR2 driven ERK1/2 kinase and NF-κB signaling pathways. An interesting question for future studies is how epithelial cells cross talk and influence immune cells during infection. Our preliminary data point to a complex pattern of cytokine regulation, in which TLR2 is important but not the whole story. Understanding the local immune response against pathogens in the intestine will provide insight into the development of intestinal disorders, mechanisms for enhancing immune response to infection, or targets for vaccine development.

Supplementary Material

Acknowledgments

We thank Jitender P Dubey and Eric Denkers for the providing the parasites. We gratefully thank Hélène Marquis and Eric Denkers for providing intellectual discussions on this manuscript.

References

1. Shao L, Serrano D, Mayer L. The role of epithelial cells in immune regulation in the gut. Semin Immunol. 2001;13:163–176. [PubMed]
2. Sanderson IR, Walker WA. TLRs in the Gut I. The role of TLRs/Nods in intestinal development and homeostasis. Am J Physiol Gastrointest Liver Physiol. 2007;292:G6–10. [PMC free article] [PubMed]
3. Cario E, Gerken G, Podolsky DK. Toll-like receptor 2 controls mucosal inflammation by regulating epithelial barrier function. Gastroenterology. 2007;132:1359–1374. [PubMed]
4. Rakoff-Nahoum S, Paglino J, Eslami-Varzaneh F, Edberg S, Medzhitov R. Recognition of commensal microflora by toll-like receptors is required for intestinal homeostasis. Cell. 2004;118:229–241. [PubMed]
5. Shibolet O, Podolsky DK. TLRs in the Gut. IV. Negative regulation of Toll-like receptors and intestinal homeostasis: addition by subtraction. Am J Physiol Gastrointest Liver Physiol. 2007;292:G1469–1473. [PubMed]
6. Xiao H, Gulen MF, Qin J, Yao J, Bulek K, Kish D, Altuntas CZ, Wald D, Ma C, Zhou H, Tuohy VK, Fairchild RL, de la Motte C, Cua D, Vallance BA, Li X. The Toll-interleukin-1 receptor member SIGIRR regulates colonic epithelial homeostasis, inflammation, and tumorigenesis. Immunity. 2007;26:461–475. [PubMed]
7. Rescigno M, Rotta G, Valzasina B, Ricciardi-Castagnoli P. Dendritic cells shuttle microbes across gut epithelial monolayers. Immunobiology. 2001;204:572–581. [PubMed]
8. Rimoldi M, Chieppa M, Salucci V, Avogadri F, Sonzogni A, Sampietro GM, Nespoli A, Viale G, Allavena P, Rescigno M. Intestinal immune homeostasis is regulated by the crosstalk between epithelial cells and dendritic cells. Nat Immunol. 2005;6:507–514. [PubMed]
9. Dubey JP. Advances in the life cycle of Toxoplasma gondii. Int J Parasitol. 1998;28:1019–1024. [PubMed]
10. Araujo FG, Remington JS. Toxoplasmosis in immunocompromised patients. Eur J Clin Microbiol. 1987;6:1–2. [PubMed]
11. Ambroise-Thomas P, Pelloux H. Toxoplasmosis - congenital and in immunocompromised patients: a parallel. Parasitol Today. 1993;9:61–63. [PubMed]
12. Hill DE, Chirukandoth S, Dubey JP. Biology and epidemiology of Toxoplasma gondii in man and animals. Anim Health Res Rev. 2005;6:41–61. [PubMed]
13. Scharton-Kersten T, Contursi C, Masumi A, Sher A, Ozato K. Interferon consensus sequence binding protein-deficient mice display impaired resistance to intracellular infection due to a primary defect in interleukin 12 p40 induction. J Exp Med. 1997;186:1523–1534. [PMC free article] [PubMed]
14. Denkers EY, Gazzinelli RT. Regulation and function of T-cell-mediated immunity during Toxoplasma gondii infection. Clin Microbiol Rev. 1998;11:569–588. [PMC free article] [PubMed]
15. Gazzinelli R, Xu Y, Hieny S, Cheever A, Sher A. Simultaneous depletion of CD4+ and CD8+ T lymphocytes is required to reactivate chronic infection with Toxoplasma gondii. J Immunol. 1992;149:175–180. [PubMed]
16. Scanga CA, Aliberti J, Jankovic D, Tilloy F, Bennouna S, Denkers EY, Medzhitov R, Sher A. Cutting edge: MyD88 is required for resistance to Toxoplasma gondii infection and regulates parasite-induced IL-12 production by dendritic cells. J Immunol. 2002;168:5997–6001. [PubMed]
17. Yarovinsky F, Kanzler H, Hieny S, Coffman RL, Sher A. Toll-like receptor recognition regulates immunodominance in an antimicrobial CD4+ T cell response. Immunity. 2006;25:655–664. [PubMed]
18. Yarovinsky F, Zhang D, Andersen JF, Bannenberg GL, Serhan CN, Hayden MS, Hieny S, Sutterwala FS, Flavell RA, Ghosh S, Sher A. TLR11 activation of dendritic cells by a protozoan profilin-like protein. Science. 2005;308:1626–1629. [PubMed]
19. Mun HS, Aosai F, Norose K, Chen M, Piao LX, Takeuchi O, Akira S, Ishikura H, Yano A. TLR2 as an essential molecule for protective immunity against Toxoplasma gondii infection. Int Immunol. 2003;15:1081–1087. [PubMed]
20. Heimesaat MM, Fischer A, Jahn HK, Niebergall J, Freudenberg M, Blaut M, Liesenfeld O, Schumann RR, Gobel UB, Bereswill S. Exacerbation of murine ileitis by Toll-like receptor 4 mediated sensing of lipopolysaccharide from commensal Escherichia coli. Gut. 2007;56:941–948. [PMC free article] [PubMed]
21. Minns LA, Menard LC, Foureau DM, Darche S, Ronet C, Mielcarz DW, Buzoni-Gatel D, Kasper LH. TLR9 is required for the gut-associated lymphoid tissue response following oral infection of Toxoplasma gondii. J Immunol. 2006;176:7589–7597. [PubMed]
22. Dubey JP, Speer CA, Shen SK, Kwok OC, Blixt JA. Oocyst-induced murine toxoplasmosis: life cycle, pathogenicity, and stage conversion in mice fed Toxoplasma gondii oocysts. The Journal of parasitology. 1997;83:870–882. [PubMed]
23. Mennechet FJ, Kasper LH, Rachinel N, Li W, Vandewalle A, Buzoni-Gatel D. Lamina propria CD4+ T lymphocytes synergize with murine intestinal epithelial cells to enhance proinflammatory response against an intracellular pathogen. J Immunol. 2002;168:2988–2996. [PubMed]
24. Schreiber E, Matthias P, Muller MM, Schaffner W. Rapid Detection of Octamer Binding-Proteins with Mini-Extracts, Prepared from a Small Number of Cells. Nucleic Acids Research. 1989;17:6419–6419. [PMC free article] [PubMed]
25. Hornung V, Rothenfusser S, Britsch S, Krug A, Jahrsdorfer B, Giese T, Endres S, Hartmann G. Quantitative expression of toll-like receptor 1-10 mRNA in cellular subsets of human peripheral blood mononuclear cells and sensitivity to CpG oligodeoxynucleotides. J Immunol. 2002;168:4531–4537. [PubMed]
26. Zarember KA, Godowski PJ. Tissue expression of human Toll-like receptors and differential regulation of Toll-like receptor mRNAs in leukocytes in response to microbes, their products, and cytokines. J Immunol. 2002;168:554–561. [PubMed]
27. Del Rio L, Bennouna S, Salinas J, Denkers EY. CXCR2 deficiency confers impaired neutrophil recruitment and increased susceptibility during Toxoplasma gondii infection. J Immunol. 2001;167:6503–6509. [PubMed]
28. Suzuki Y, Orellana MA, Schreiber RD, Remington JS. Interferon-gamma: the major mediator of resistance against Toxoplasma gondii. Science. 1988;240:516–518. [PubMed]
29. Lambert H, Hitziger N, Dellacasa I, Svensson M, Barragan A. Induction of dendritic cell migration upon Toxoplasma gondii infection potentiates parasite dissemination. Cell Microbiol. 2006;8:1611–1623. [PubMed]
30. Nickdel MB, Roberts F, Brombacher F, Alexander J, Roberts CW. Counter-protective role for interleukin-5 during acute Toxoplasma gondii infection. Infect Immun. 2001;69:1044–1052. [PMC free article] [PubMed]
31. Bliss SK, Gavrilescu LC, Alcaraz A, Denkers EY. Neutrophil depletion during Toxoplasma gondii infection leads to impaired immunity and lethal systemic pathology. Infect Immun. 2001;69:4898–4905. [PMC free article] [PubMed]
32. McColl SR. Chemokines and dendritic cells: a crucial alliance. Immunol Cell Biol. 2002;80:489–496. [PubMed]
33. Vossenkamper A, Struck D, Alvarado-Esquivel C, Went T, Takeda K, Akira S, Pfeffer K, Alber G, Lochner M, Forster I, Liesenfeld O. Both IL-12 and IL-18 contribute to small intestinal Th1-type immunopathology following oral infection with Toxoplasma gondii, but IL-12 is dominant over IL-18 in parasite control. Eur J Immunol. 2004;34:3197–3207. [PubMed]
34. Cai G, Kastelein R, Hunter CA. Interleukin-18 (IL-18) enhances innate IL-12-mediated resistance to Toxoplasma gondii. Infect Immun. 2000;68:6932–6938. [PMC free article] [PubMed]
35. Yap GS, Ortmann R, Shevach E, Sher A. A heritable defect in IL-12 signaling in B10.Q/J mice. II. Effect on acute resistance to Toxoplasma gondii and rescue by IL-18 treatment. J Immunol. 2001;166:5720–5725. [PubMed]
36. Kim L, Denkers EY. Toxoplasma gondii triggers Gi-dependent PI 3-kinase signaling required for inhibition of host cell apoptosis. J Cell Sci. 2006;119:2119–2126. [PubMed]
37. Cario E, Podolsky DK. Differential alteration in intestinal epithelial cell expression of toll-like receptor 3 (TLR3) and TLR4 in inflammatory bowel disease. Infect Immun. 2000;68:7010–7017. [PMC free article] [PubMed]
38. Boothroyd JC, Grigg ME. Population biology of Toxoplasma gondii and its relevance to human infection: do different strains cause different disease? Curr Opin Microbiol. 2002;5:438–442. [PubMed]
39. Mavin S, Joss AW, Ball J, Ho-Yen DO. Do Toxoplasma gondii RH strain tachyzoites evolve during continuous passage? Journal of clinical pathology. 2004;57:609–611. [PMC free article] [PubMed]
40. Speer CA, Dubey JP. Ultrastructure of early stages of infections in mice fed Toxoplasma gondii oocysts. Parasitology. 1998;116(Pt 1):35–42. [PubMed]
41. Bout D, Moretto M, Dimier-Poisson I, Gatel DB. Interaction between Toxoplasma gondii and enterocyte. Immunobiology. 1999;201:225–228. [PubMed]
42. Bliss SK, Zhang Y, Denkers EY. Murine neutrophil stimulation by Toxoplasma gondii antigen drives high level production of IFN-gamma-independent IL-12. J Immunol. 1999;163:2081–2088. [PubMed]
43. Campos MA, Closel M, Valente EP, Cardoso JE, Akira S, Alvarez-Leite JI, Ropert C, Gazzinelli RT. Impaired production of proinflammatory cytokines and host resistance to acute infection with Trypanosoma cruzi in mice lacking functional myeloid differentiation factor 88. J Immunol. 2004;172:1711–1718. [PubMed]
44. Krishnegowda G, Hajjar AM, Zhu J, Douglass EJ, Uematsu S, Akira S, Woods AS, Gowda DC. Induction of proinflammatory responses in macrophages by the glycosylphosphatidylinositols of Plasmodium falciparum: cell signaling receptors, glycosylphosphatidylinositol (GPI) structural requirement, and regulation of GPI activity. J Biol Chem. 2005;280:8606–8616. [PubMed]
45. Debierre-Grockiego F, Azzouz N, Schmidt J, Dubremetz JF, Geyer H, Geyer R, Weingart R, Schmidt RR, Schwarz RT. Roles of glycosylphosphatidylinositols of Toxoplasma gondii. Induction of tumor necrosis factor-alpha production in macrophages. J Biol Chem. 2003;278:32987–32993. [PubMed]
46. Debierre-Grockiego F, Campos MA, Azzouz N, Schmidt J, Bieker U, Resende MG, Mansur DS, Weingart R, Schmidt RR, Golenbock DT, Gazzinelli RT, Schwarz RT. Activation of TLR2 and TLR4 by glycosylphosphatidylinositols derived from Toxoplasma gondii. J Immunol. 2007;179:1129–1137. [PubMed]
47. Butcher BA, Kim L, Johnson PF, Denkers EY. Toxoplasma gondii tachyzoites inhibit proinflammatory cytokine induction in infected macrophages by preventing nuclear translocation of the transcription factor NF-kappa B. J Immunol. 2001;167:2193–2201. [PubMed]
48. Shapira S, Speirs K, Gerstein A, Caamano J, Hunter CA. Suppression of NF-kappaB activation by infection with Toxoplasma gondii. J Infect Dis. 2002;185(Suppl 1):S66–72. [PubMed]
49. Molestina RE, Payne TM, Coppens I, Sinai AP. Activation of NF-kappaB by Toxoplasma gondii correlates with increased expression of antiapoptotic genes and localization of phosphorylated IkappaB to the parasitophorous vacuole membrane. J Cell Sci. 2003;116:4359–4371. [PubMed]
50. Payne TM, Molestina RE, Sinai AP. Inhibition of caspase activation and a requirement for NF-kappaB function in the Toxoplasma gondii-mediated blockade of host apoptosis. J Cell Sci. 2003;116:4345–4358. [PubMed]
51. Robben PM, Mordue DG, Truscott SM, Takeda K, Akira S, Sibley LD. Production of IL-12 by macrophages infected with Toxoplasma gondii depends on the parasite genotype. J Immunol. 2004;172:3686–3694. [PubMed]
52. Schade B, Fischer HG. Toxoplasma gondii induction of interleukin-12 is associated with acute virulence in mice and depends on the host genotype. Vet Parasitol. 2001;100:63–74. [PubMed]
53. Kim L, Butcher BA, Lee CW, Uematsu S, Akira S, Denkers EY. Toxoplasma gondii genotype determines MyD88-dependent signaling in infected macrophages. J Immunol. 2006;177:2584–2591. [PubMed]