PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of mbcLink to Publisher's site
 
Mol Biol Cell. 2012 May 1; 23(9): 1618–1627.
PMCID: PMC3338429

Biogenesis of the preprotein translocase of the outer mitochondrial membrane: protein kinase A phosphorylates the precursor of Tom40 and impairs its import

Benjamin S. Glick, Monitoring Editor
University of Chicago

Abstract

The preprotein translocase of the outer mitochondrial membrane (TOM) functions as the main entry gate for the import of nuclear-encoded proteins into mitochondria. The major subunits of the TOM complex are the three receptors Tom20, Tom22, and Tom70 and the central channel-forming protein Tom40. Cytosolic kinases have been shown to regulate the biogenesis and activity of the Tom receptors. Casein kinase 2 stimulates the biogenesis of Tom22 and Tom20, whereas protein kinase A (PKA) impairs the receptor function of Tom70. Here we report that PKA exerts an inhibitory effect on the biogenesis of the β-barrel protein Tom40. Tom40 is synthesized as precursor on cytosolic ribosomes and subsequently imported into mitochondria. We show that PKA phosphorylates the precursor of Tom40. The phosphorylated Tom40 precursor is impaired in import into mitochondria, whereas the nonphosphorylated precursor is efficiently imported. We conclude that PKA plays a dual role in the regulation of the TOM complex. Phosphorylation by PKA not only impairs the receptor activity of Tom70, but it also inhibits the biogenesis of the channel protein Tom40.

INTRODUCTION

Most mitochondrial proteins are imported from the cytosol. The proteins are synthesized as precursors on cytosolic ribosomes. Targeting signals contained in the precursor proteins direct them to receptors on the mitochondrial surface (Hoogenraad et al., 2002 blue right-pointing triangle; Dolezal et al., 2006 blue right-pointing triangle; Neupert and Herrmann, 2007 blue right-pointing triangle; Chacinska et al., 2009 blue right-pointing triangle; Endo et al., 2011 blue right-pointing triangle). The translocase of the outer mitochondrial membrane (TOM complex) functions as the main entry gate for mitochondrial precursor proteins. After passing through the TOM channel, the precursor proteins follow different import routes to the four mitochondrial subcompartments—outer membrane, intermembrane space, inner membrane, and matrix.

The TOM complex consists of seven subunits: three receptors, a central channel-forming protein, and three small subunits (Meisinger et al., 2001 blue right-pointing triangle; Walther and Rapaport, 2009 blue right-pointing triangle; Endo et al., 2011 blue right-pointing triangle). The receptors Tom20 and Tom22 preferentially recognize precursor proteins that carry amino-terminal targeting signals (presequences), whereas the third receptor, Tom70, mainly binds hydrophobic precursor proteins with internal targeting signals (metabolite carriers; Brix et al., 1999 blue right-pointing triangle; Abe et al., 2000 blue right-pointing triangle; Young et al., 2003 blue right-pointing triangle; Li et al., 2009 blue right-pointing triangle). Each of the receptors is anchored in the outer membrane via a single α-helical transmembrane segment and exposes the preprotein-binding domain to the cytosol. The β-barrel protein Tom40 is the essential core of the TOM complex. Tom40 forms a hydrophilic channel, through which the vast majority of mitochondrial proteins are imported (Hill et al., 1998 blue right-pointing triangle; Ahting et al., 2001 blue right-pointing triangle; Suzuki et al., 2004 blue right-pointing triangle; Becker et al., 2005 blue right-pointing triangle; Harsman et al., 2010 blue right-pointing triangle). The small subunits Tom5, Tom6, and Tom7 are involved in the assembly and stability of the TOM complex (Schmitt et al., 2005 blue right-pointing triangle; Sherman et al., 2005 blue right-pointing triangle; Meisinger et al., 2006b blue right-pointing triangle; Kato and Mihara, 2008 blue right-pointing triangle; Becker et al., 2010 blue right-pointing triangle, 2011 blue right-pointing triangle; Yamano et al., 2010 blue right-pointing triangle). Each subunit of the TOM complex is encoded by a nuclear gene and thus is synthesized as precursor in the cytosol and imported into mitochondria (Model et al., 2001 blue right-pointing triangle; Walther and Rapaport, 2009 blue right-pointing triangle).

For a long time, little has been known about the regulation of the mitochondrial preprotein translocases. Recently, however, mass spectrometric analyses revealed that the subunits of the TOM complex are phosphorylated at multiple sites (Chi et al., 2007 blue right-pointing triangle; Li et al., 2007 blue right-pointing triangle; Albuquerque et al., 2008 blue right-pointing triangle; Gnad et al., 2009 blue right-pointing triangle; Schmidt et al., 2011 blue right-pointing triangle). On the basis of prediction programs for kinase target sites and in vitro assays with recombinant Tom proteins and purified kinases, a number of candidate kinases for TOM phosphorylation were identified (Rao et al., 2011 blue right-pointing triangle; Schmidt et al., 2011 blue right-pointing triangle). So far, a functional role of TOM phosphorylation has been shown for the Tom receptors in vivo and in organello. 1) Cytosolic casein kinase 2 (CK2) phosphorylates the precursor of Tom22 in the cytosol and thereby stimulates its import into the outer membrane. In addition, CK2 also phosphorylates the mitochondrial import protein Mim1, an outer membrane protein that mediates membrane insertion of the precursors of Tom20 and Tom70 (Becker et al., 2008 blue right-pointing triangle; Hulett et al., 2008 blue right-pointing triangle; Popov-Celeketic et al., 2008 blue right-pointing triangle), and thus promotes the import of these two receptors. The assembly of Tom20 with mature Tom22 in the TOM complex is enhanced when Tom22 is in the phosphorylated state. Taken together, CK2 stimulates the biogenesis of the three Tom receptors (Rao et al., 2011 blue right-pointing triangle; Schmidt et al., 2011 blue right-pointing triangle). 2) In contrast, cytosolic protein kinase A (PKA) was found to inhibit the receptor activity of Tom70. Phosphorylation by PKA does not affect the biogenesis of the Tom70 precursor but exerts an inhibitory effect on the mature Tom70 receptor and thus impairs the import of metabolite carriers into mitochondria (Schmidt et al., 2011 blue right-pointing triangle).

We analyzed a possible effect of kinases on the channel protein Tom40. We show that PKA impairs import of the Tom40 precursor into mitochondria. The inhibitory effect is selectively caused by phosphorylation of a specific serine residue of the Tom40 precursor in the cytosol, whereas mature, imported Tom40 is not accessible to phosphorylation by PKA. We conclude that cytosolic kinases not only regulate the biogenesis and activity of Tom receptors, but they also exert an inhibitory effect on the biogenesis of the channel protein Tom40.

RESULTS

Phosphorylation of Tom40 by yeast PKA

The in vitro screen for TOM phosphorylation by Schmidt et al. (2011) blue right-pointing triangle led to the prediction of Ser-54 of Tom40 as PKA target site and the demonstration that purified mouse PKA phosphorylates recombinant Saccharomyces cerevisiae Tom40 at this site. It has not been determined whether the phosphorylation takes place in yeast and whether it is of functional relevance. PKA consists of two catalytic subunits and two regulatory (inhibitory) subunits. In yeast the catalytic subunits are encoded by the genes TPK1, TPK2, and TPK3 and the regulatory subunit by BCY1 (Cannon and Tatchell, 1987 blue right-pointing triangle; Toda et al., 1987a blue right-pointing triangle, 1987b blue right-pointing triangle; Thevelein, 1994 blue right-pointing triangle; Zaman et al., 2008 blue right-pointing triangle; Smets et al., 2010 blue right-pointing triangle). PKA is activated on fermentable growth conditions that lead to increased intracellular cAMP levels (Broach, 1991 blue right-pointing triangle; Thevelein, 1994 blue right-pointing triangle). cAMP binds to Bcy1, leading to a release of the active catalytic subunits (Taylor et al., 1990 blue right-pointing triangle; Thevelein, 1994 blue right-pointing triangle; Tamaki, 2007 blue right-pointing triangle; Zaman et al., 2008 blue right-pointing triangle). BCY1-deficient yeast cells lack cAMP-dependent regulation of PKA activity and are unable to grow under nonfermentable conditions (Matsumoto et al., 1983 blue right-pointing triangle; Toda et al., 1987a blue right-pointing triangle; Cameron et al., 1988 blue right-pointing triangle).

To test for a possible effect of PKA on Tom40 in vivo, we grew yeast cells on fermentable medium containing sucrose as carbon source (Lemaire et al., 2004 blue right-pointing triangle; Van de Velde and Thevelein, 2008 blue right-pointing triangle). We compared bcy1Δ yeast to rho+ wild-type yeast as well as to rho wild-type yeast that lack mitochondrial DNA and are thus also unable to grow on nonfermentable medium. The steady-state protein levels of Tom40 were reduced in bcy1Δ yeast cells in comparison to rho+ as well as rho wild-type yeast (Figure 1A). The levels of several control proteins, including cytosolic kinases, were not affected. Moreover, the levels of Tom70 were not changed, in agreement with the findings of Schmidt et al. (2011) blue right-pointing triangle that PKA affects neither the biogenesis nor the level of Tom70 but inhibits the receptor activity of the mature, imported Tom70 (in the study by Schmidt et al., 2011 blue right-pointing triangle, glucose was used as carbon source). These results suggest that a constitutive activation of PKA exerts an inhibitory influence on the level of Tom40.

FIGURE 1:
Phosphorylation of Tom40 by yeast PKA. (A) Yeast cells from rho+ wild-type (WT), rho wild type, and bcy1Δ were grown on sucrose-containing medium at 30°C. Protein extracts were prepared by postalkaline lysis and analyzed by SDS–PAGE ...

To analyze whether Tom40 is a substrate of PKA in a homologous system, we generated a yeast strain expressing protein A–tagged Bcy1. Purification of Bcy1 by affinity chromatography led to the efficient copurification of PKA catalytic subunits, shown here with antibodies directed against Tpk1 (Figure 1B; the protein A tag was removed by cleavage with tobacco etch virus [TEV] protease). On stimulation with 8Br-cAMP, the purified yeast PKA was active and phosphorylated the PKA model substrate Kemptide and the receptor domain of Tom70 in the presence of [γ-33P]ATP (Figure 1C, lane 2; Schmidt et al., 2011 blue right-pointing triangle). Purified recombinant yeast Tom40 was phosphorylated by yeast PKA in the presence of 8Br-cAMP (Figure 1C, lane 4). The phosphorylation was specific for the predicted PKA target residue Ser-54 since replacement of this serine by glutamic acid blocked the phosphorylation of Tom40 (Figure 1C, lane 6). As an independent assay, we used a yeast strain containing tagged Tpk1 and purified the enzyme. Purified wild-type Tom40, but not the mutant form Tom40S54E, was phosphorylated by Tpk1 (Figure 1D, lanes 3 and 4). We conclude that Tom40 is a substrate of yeast PKA.

PKA phosphorylates the precursor of Tom40

Phosphate-affinity (Phos-tag) SDS–PAGE leads to a lower gel mobility of many phosphorylated proteins compared with the nonphosphorylated forms (Kinoshita et al., 2006 blue right-pointing triangle). We asked whether the phosphorylation of Tom40 at Ser-54 by PKA could be directly monitored by Phos-tag SDS–PAGE. We incubated purified Tom40 with PKA and indeed observed a slower-migrating form that was generated in a PKA- and time-dependent manner (Figure 2A, lanes 2–4). When Ser-54 was replaced by alanine, no phosphorylated form of Tom40 was detected (Figure 2A, lanes 6–8).

FIGURE 2:
PKA phosphorylates the precursor of Tom40 at serine 54. (A) Recombinant Tom40WT or Tom40S54A was incubated with purified PKA (New England BioLabs). The samples were lysed in Laemmli buffer and analyzed by Phos-tag SDS–PAGE and Western blotting ...

When isolated yeast mitochondria were incubated with PKA, however, a phosphorylated form of Tom40 was not detected (Figure 2B; neither mammalian PKA nor yeast PKA in the presence of 8Br-cAMP led to a detectable phosphorylation of Ser-54). Thus mature Tom40 that is stably integrated into the mitochondrial outer membrane was not accessible to PKA, whereas purified Tom40 in detergent was phosphorylated by PKA (Figures 1, C and D, and and2A).2A). We therefore asked whether Tom40 can be phosphorylated in the cytosol. We synthesized the precursor of Tom40 in reticulocyte lysate in the presence of [35S]methionine. When the synthesis was performed in the presence of PKA, a slower-migrating form of Tom40 was observed by Phos-tag SDS–PAGE (Figure 2C, lanes 2 and 5). This form was sensitive to treatment with alkaline phosphatase (Figure 2C, lane 6). When Tom40S54A was synthesized in reticulocyte lysate, it was not affected by PKA (Figure 2C, lane 4). Taken together, these results indicate that the precursor of Tom40 is phosphorylated by PKA in the cytosol, whereas mature imported Tom40 is not a substrate of PKA.

Phosphorylation impairs the biogenesis of Tom40

To analyze the biogenesis of Tom40, we incubated the 35S-labeled precursor with isolated mitochondria. We used the wild-type precursor of Tom40 and two mutant forms of Ser-54. When serine was replaced by alanine, the binding of Tom40 to mitochondria was only mildly affected compared with the wild-type precursor (Figure 3A, lanes 4–9). When serine was replaced by the phosphomimetic residue glutamate, however, binding of Tom40 to mitochondria was reduced (Figure 3A, lanes 1–3). Treatment of mitochondria with sodium carbonate at alkaline pH leads to the extraction of soluble and peripheral membrane proteins, whereas integral membrane proteins remain in the membrane sheets (Fujiki et al., 1982 blue right-pointing triangle; Stojanovski et al., 2007 blue right-pointing triangle). Mitochondria were incubated with [35S]Tom40 and then treated at alkaline pH, demonstrating that the replacement of Ser-54 by glutamate considerably reduced the membrane integration of Tom40 (Figure 3B, lanes 1–3).

FIGURE 3:
Replacement of serine 54 by glutamate impairs import of Tom40 into mitochondria. 35S-Labeled Tom40S54E, Tom40WT, and Tom40S54A precursors were incubated with isolated yeast wild-type mitochondria at 25°C for the indicated periods. The samples ...

The assembly pathway of Tom40 involves several steps. On initial import of the precursor by the TOM complex to the intermembrane space side, intermembrane space chaperone complexes transfer Tom40 to the sorting and assembly machinery (SAM complex) of the outer membrane (Model et al., 2001 blue right-pointing triangle; Kozjak et al., 2003 blue right-pointing triangle; Paschen et al., 2003 blue right-pointing triangle; Wiedemann et al., 2003 blue right-pointing triangle, 2004 blue right-pointing triangle; Gentle et al., 2004 blue right-pointing triangle; Hoppins and Nargang, 2004 blue right-pointing triangle). The interaction of the Tom40 precursor with the SAM complex can be directly monitored by blue native electrophoresis after lysis of the mitochondria with the nonionic detergent digitonin (Ryan et al., 2001 blue right-pointing triangle; Wittig et al., 2006 blue right-pointing triangle; Stojanovski et al., 2007 blue right-pointing triangle). The SAM intermediate of ~250 kDa is followed by a second intermediate (Int-II) of lower molecular mass and finally the assembly of imported Tom40 into the mature TOM complex of ~400 kDa (Figure 4A, lanes 1–3; Wiedemann et al., 2003 blue right-pointing triangle; Kutik et al., 2008 blue right-pointing triangle). When the precursor of Tom40 was phosphorylated by PKA, formation of the assembly steps was considerably impaired. The inhibition occurred already at an early stage, since the generation of the SAM intermediate was impaired (Figure 4A, lanes 4–6). To exclude that PKA inhibited the assembly of the TOM complex in general, we imported two small Tom precursors—Tom6 and Tom7—whose assembly can be efficiently monitored by blue native electrophoresis (Dembowski et al., 2001 blue right-pointing triangle; Model et al., 2001 blue right-pointing triangle). Both proteins were assembled into the TOM complex independent of the presence or absence of PKA (Figure 4B).

FIGURE 4:
Phosphorylation of Tom40 by PKA impairs formation of the SAM import intermediate. (A) 35S-Labeled precursor of Tom40 was synthesized in the presence or absence of PKA (New England BioLabs) as indicated and incubated with isolated yeast wild-type mitochondria ...

To analyze whether the inhibitory effect of PKA was specific for the phosphorylation of Ser-54 of Tom40, we compared formation of the SAM intermediate of the wild-type Tom40 precursor to the mutant precursor Tom40S54A. In the absence of PKA, wild-type precursor and mutant precursor accumulated at the SAM after a short-term import reaction (Figure 4C, lanes 1 and 4). PKA only inhibited the formation of the SAM intermediate of the wild-type precursor and not of the mutant precursor (Figure 4C, lanes 2 and 3), demonstrating that PKA inhibits the biogenesis of Tom40 selectively via phosphorylation of Ser-54. Taking the data together, we conclude that phosphorylation by PKA impairs the biogenesis pathway of Tom40 at an early that is, at or before formation of the SAM intermediate.

Mitochondria import the nonphosphorylated form of Tom40

The initial stage of Tom40 import, that is, translocation via the TOM complex to the intermembrane space side, does not involve a blue native–stable intermediate and thus cannot be directly monitored by native gel analysis (Wiedemann et al., 2004 blue right-pointing triangle). Therefore we used the accessibility to externally added protease to determine a possible role of PKA phosphorylation in this initial import step. To distinguish between phosphorylated and nonphosphorylated Tom40 precursors, we analyzed the mitochondria by Phos-tag SDS–PAGE. The nonphosphorylated Tom40 was protected against added proteinase K, indicating that it was imported into mitochondria (Figure 5A; Model et al., 2001 blue right-pointing triangle; Wiedemann et al., 2003 blue right-pointing triangle). The phosphorylated Tom40 precursor, however, was almost completely degraded by proteinase K (Figure 5A), demonstrating that the precursor was still located on the mitochondrial surface and not imported.

FIGURE 5:
Mitochondria import the nonphosphorylated precursor of Tom40, whereas phosphorylated Tom40 remains on the mitochondrial surface. (A) [35S]Tom40 was synthesized in the presence of PKA (New England BioLabs) and incubated with isolated wild-type mitochondria ...

Tom20, Tom22, and Tom70 function as receptors for import of nuclear-encoded precursor proteins into mitochondria (Kiebler et al., 1993 blue right-pointing triangle; Brix et al., 1997 blue right-pointing triangle, 1999 blue right-pointing triangle; van Wilpe et al., 1999 blue right-pointing triangle; Yamano et al., 2008 blue right-pointing triangle; Rimmer et al., 2011 blue right-pointing triangle; Shiota et al., 2011 blue right-pointing triangle). Pretreatment of mitochondria with trypsin removes the receptor domains and inhibits preprotein import into mitochondria (Ryan et al., 2001 blue right-pointing triangle). Trypsin pretreatment considerably impaired the interaction of the nonphosphorylated precursor of Tom40 with mitochondria but not the phosphorylated precursor (Figure 5B). We thus studied mutant mitochondria deficient in Tom receptors. The import of radiolabeled Tom40 precursor was strongly inhibited in mitochondria lacking the central receptor Tom22 (Figure 5C, lanes 7 and 8; Model et al., 2001 blue right-pointing triangle). Analysis by Phos-tag SDS–PAGE revealed that interaction of the nonphosphorylated precursor with mitochondria was strongly inhibited when Tom22 was lacking, whereas binding of the phosphorylated form to mitochondria was not affected (Figure 5C, lanes 11 and 12). As observed with wild-type mitochondria, the phosphorylated Tom40 interacting with tom22Δ mitochondria was digested by externally added protease (Figure 5C, lanes 13–16), demonstrating that phosphorylated Tom40 was not imported into mitochondria. Similarly, mitochondria lacking Tom20 or Tom70 were impaired in the interaction with nonphosphorylated Tom40, whereas the binding of phosphorylated Tom40 to the isolated mitochondria was not affected by lack of the receptors (Figure 5, D and E).

Swelling of mitochondria leads to a release of intermembrane space chaperones and thus inhibits the biogenesis of Tom40 (Wiedemann et al., 2004 blue right-pointing triangle). Swollen mitochondria (mitoplasts) were inhibited in the interaction with nonphosphorylated Tom40 but not phosphorylated Tom40 (Figure 5F). tim10-2 mutant mitochondria are impaired in the activity of the Tim9–Tim10 intermembrane space chaperone and thus in the import of Tom40 (Truscott et al., 2002 blue right-pointing triangle; Wiedemann et al., 2004 blue right-pointing triangle). Only nonphosphorylated Tom40, and not the phosphorylated form of Tom40, was affected by the tim10-2 mutant (Figure 5G).

Taking the data together indicates that the nonphosphorylated precursor of Tom40 shows the characteristics of specific import into mitochondria, including dependence on Tom receptors and intermembrane space chaperones. In contrast, phosphorylated Tom40 remains on the mitochondrial surface in a receptor-independent manner and is not imported into mitochondria, indicating that the binding observed with mitochondria is nonproductive. We conclude that mitochondria specifically import the nonphosphorylated form of Tom40.

PKA inhibits Tom40 import independently of Tom70 phosphorylation

Phosphorylation of the receptor Tom70 by PKA impairs the interaction of the cytosolic chaperone Hsp70 with Tom70 (Schmidt et al., 2011 blue right-pointing triangle). Hsp70 delivers hydrophobic precursor proteins such as the inner membrane metabolite carriers to Tom70 (Young et al., 2003 blue right-pointing triangle; Li et al., 2009 blue right-pointing triangle; Zara et al., 2009 blue right-pointing triangle). PKA selectively phosphorylates Ser-174 of Tom70, which is located close to the chaperone-binding site of Tom70, and thus disturbs the Hsp70–Tom70 interaction (Schmidt et al., 2011 blue right-pointing triangle). We asked whether the phosphorylation of Tom70 influenced the import of Tom40. In yeast mitochondria in which Ser-174 of Tom70 was replaced by alanine, the import of carrier precursors was enhanced, whereas a replacement of Ser-174 by glutamate inhibited carrier import (Schmidt et al., 2011 blue right-pointing triangle). In the case of Tom40, however, neither replacement of Ser-174 by alanine nor replacement by glutamate affected the import of the precursor in comparison to wild-type mitochondria (Figure 6, lanes 1, 2, 5, 6, 9, and 10). Phosphorylation of the Tom40 precursor by PKA inhibited its import into Tom70S174A and Tom70S174E mitochondria like that into wild-type mitochondria (Figure 6, lanes 3, 4, 7, 8, 11. and 12). Given that Ser-174 is the only PKA target site of Tom70 (Schmidt et al., 2011 blue right-pointing triangle), these results demonstrate that the inhibitory effect of PKA on the import of Tom40 occurs independently of the phosphorylation of Tom70.

FIGURE 6:
Inhibition of Tom40 import by PKA is not connected to the phosphorylation of Tom70 by PKA. 35S-Labeled precursor of Tom40 was imported into mitochondria, which were isolated from Tom70S174E, Tom70WT, or Tom70S174A yeast strains, at 25°C in the ...

DISCUSSION

We report a new mechanism of how cytosolic kinases regulate the preprotein translocase of the outer mitochondrial membrane. PKA phosphorylates the precursor of Tom40, the channel-forming core component of the TOM complex, and thus inhibits the import of Tom40 into mitochondria. So far, cytosolic kinases had been shown either to stimulate the biogenesis of Tom subunits (phosphorylation of Tom22 and Mim1 by CK2) or to inhibit the receptor activity of a Tom receptor without affecting its biogenesis (phosphorylation of Tom70 by PKA; Schmidt et al., 2011 blue right-pointing triangle). We found that the PKA effect on Tom40 biogenesis was independent of the phosphorylation status of Tom70, demonstrating that PKA exerts two different inhibitory effects on the TOM complex: inhibition of receptor activity (Tom70) and inhibition of precursor import (Tom40). In agreement with these observations, in a yeast strain lacking the inhibitory PKA subunit Bcy1, the steady-state level of Tom40, but not that of Tom70, was reduced.

PKA is rapidly activated by addition of fermentable carbon sources such as glucose and sucrose that lead to increased intracellular cAMP levels in yeast cells (Broach, 1991 blue right-pointing triangle; Thevelein, 1994 blue right-pointing triangle; Santangelo, 2006 blue right-pointing triangle; Tamaki, 2007 blue right-pointing triangle; Zaman et al., 2008 blue right-pointing triangle; Smets et al., 2010 blue right-pointing triangle). PKA was shown to affect numerous cellular processes, including morphology of the mitochondrial membranes, programmed cell death, and oxidative metabolism. In addition, a few precursor proteins were found to be phosphorylated in a cAMP-dependent manner, affecting their interaction with molecular chaperones and translocation into mitochondria (Anandatheerthavarada et al., 1999 blue right-pointing triangle; Cho et al., 2001 blue right-pointing triangle; Robin et al., 2002 blue right-pointing triangle, 2003 blue right-pointing triangle; Pagliarini and Dixon, 2006 blue right-pointing triangle; Chang and Blackstone, 2007 blue right-pointing triangle; Carlucci et al., 2008 blue right-pointing triangle; De Rasmo et al., 2008 blue right-pointing triangle; Santel and Frank, 2008 blue right-pointing triangle; Soubannier and McBride, 2009 blue right-pointing triangle). The inhibitory effects of PKA on TOM biogenesis (this study) and function (Schmidt et al., 2011 blue right-pointing triangle) provide a direct means to control the mitochondrial preprotein entry gate upon shift to fermentable growth conditions, under which a lower mitochondrial activity is required. Under nonfermentable, respiratory conditions the cAMP levels and PKA activity are low (Russell et al., 1993 blue right-pointing triangle; Thevelein, 1994 blue right-pointing triangle; Zaman et al., 2008 blue right-pointing triangle; Smets et al., 2010 blue right-pointing triangle), and thus Tom40 is efficiently imported.

The biogenesis pathway of Tom40 can be dissected into several steps, involving transport by the TOM complex, intermembrane space chaperones, and the SAM complex (Model et al., 2001 blue right-pointing triangle; Wiedemann et al., 2003 blue right-pointing triangle; Waizenegger et al., 2004 blue right-pointing triangle; Habib et al., 2005 blue right-pointing triangle; Kutik et al., 2008 blue right-pointing triangle). Phosphorylation of the Tom40 precursor by PKA inhibits the initial stage of precursor translocation through the TOM complex to a protease-protected location. Whereas nonphosphorylated Tom40 precursor is efficiently imported, the phosphorylated form remains nonproductively bound to the mitochondrial surface and is not translocated. Numerous mutational studies have been performed with Tom40 (Rapaport and Neupert, 1999 blue right-pointing triangle; Rapaport et al., 2001 blue right-pointing triangle; Taylor et al., 2003 blue right-pointing triangle, Humphries et al., 2005 blue right-pointing triangle; Sherman et al., 2006 blue right-pointing triangle; Kutik et al., 2008 blue right-pointing triangle). A linear sorting signal for binding of Tom40 to the SAM complex has been identified in the carboxy-terminal region of the precursor (Kutik et al., 2008 blue right-pointing triangle); however, a targeting signal that is responsible for the initial recognition of Tom40 by the TOM complex has not been found. It is conceivable that several elements of the precursor may contribute to the targeting process. Serine 54 is not essential for the targeting of Tom40, since this residue can be deleted (Rapaport and Neupert, 1999 blue right-pointing triangle; Rapaport et al., 2001 blue right-pointing triangle; Taylor et al., 2003 blue right-pointing triangle; Humphries et al., 2005 blue right-pointing triangle; Sherman et al., 2006 blue right-pointing triangle; Kutik et al., 2008 blue right-pointing triangle) or replaced by alanine (this study) without blocking Tom40 targeting. Harsman et al. (2010) blue right-pointing triangle reconstituted purified Tom40WT and Tom40S54E into planar lipid bilayers and observed a similar gating behavior of the Tom40 channel of wild type and mutant, indicating that the replacement of Ser-54 by the phosphomimetic residue glutamate did not disturb the overall folding of Tom40. Of interest, the association rate of positively charged presequence peptides with Tom40 was altered when Ser-54 was replaced by glutamate (Harsman et al., 2010 blue right-pointing triangle), suggesting that modification of this residue can affect the interaction properties of Tom40 in vitro. We analyzed the biogenesis of Tom40S54E in organello and observed an impairment of import into mitochondria. Using PKA, we showed that phosphorylation of Ser-54 inhibits the translocation of Tom40 via the TOM complex, demonstrating that phospho–Ser-54 interferes with the targeting process. Although the exact nature of the Tom40 targeting signal remains elusive, the strong inhibitory effect of a single phosphorylation event provides an efficient mechanism to control the import of Tom40.

Taking our results together with the findings by Schmidt et al., (2011) blue right-pointing triangle, we conclude that cytosolic kinases regulate biogenesis and function of the TOM complex at multiple levels. The main protein entry gate of mitochondria is not functioning autonomously but is tightly integrated into a network of regulatory kinases.

MATERIALS AND METHODS

Yeast strains and cloning

Most S. cerevisiae strains used in this study are derived from the strain YPH499 (MATa, ade2-101, his3-Δ200, leu2-Δ1, ura3-52, trp1-Δ63, lys2-801; Sikorski and Hieter, 1989 blue right-pointing triangle). YPH499-tom40Δ+pFL39-TOM40 was made by transforming the shuffling strain tom40Δ+Yep-TOM40 (Kutik et al., 2008 blue right-pointing triangle) with the plasmid pFL39-TOM40 as described (Schmidt et al., 2011 blue right-pointing triangle). The mutations Tom40S54A and Tom40S54E were generated by site-directed mutagenesis. Clones were verified by sequencing. The Tom70S174E and Tom70S174A yeast strains, tom20Δ strain, tom22Δ strain, tom70Δ strain, tim10-2 strain, and bcy1Δ strain have been described previously (Moczko et al., 1994 blue right-pointing triangle; van Wilpe et al., 1999 blue right-pointing triangle; Truscott et al., 2002 blue right-pointing triangle; Stojanovski et al., 2007 blue right-pointing triangle; Schmidt et al., 2011 blue right-pointing triangle). The Bcy1ProtA strain was constructed by amplifying the HIS3MX6-pNOP-ProtA-TEV plasmid (Meisinger et al., 2007 blue right-pointing triangle) with primers A1 (5′ ATTACAACAAGC AGATTATTTTCAAAAGACAACAGTAAGAATAAACGGGAATACGAATTCGAGCTC 3′) and A2 (5′ GTTCTGGAACAGTTGCAATTCGGCTTGCGATTCCTTGGGCAAAGA AGATACCACGTCACTCATACCCTGA 3′) and integrating into the BCY1 open reading frame by homologous recombination. The Tom70WT/pET19 and Kemptide-GST/pETGEXct constructs were reported previously (Brix et al., 1997 blue right-pointing triangle; Schmidt et al., 2011 blue right-pointing triangle).

Isolation of mitochondria and preparation of yeast protein extracts

Yeast strains were typically grown on nonfermentable YPG medium (1% [wt/vol] yeast extract, 2% [wt/vol] bactopeptone, 3% [wt/vol] glycerol, pH 5.0) at 23°C until an OD600 of 0.5–1.0 was reached. Mitochondria were isolated by differential centrifugation (Meisinger et al., 2006a blue right-pointing triangle). Mitochondria were resuspended in SEM buffer (250 mM sucrose, 1 mM EDTA, and 10 mM 3-(N-morpholino)propanesulfonic acid–KOH, pH 7.2), adjusted to a protein concentration of 10 mg/ml, frozen in liquid nitrogen, and stored at −80°C. For preparation of yeast protein extracts, yeast cells were grown on fermentable YPS medium (1% [wt/vol] yeast extract, 2% [wt/vol] bactopeptone, 2% [wt/vol] sucrose), and extracts corresponding to the same OD600 were prepared by postalkaline lysis.

Purification of yeast PKA

The yeast strain expressing Bcy1ProtA and the corresponding wild-type strain (YPH499) were grown in YPG medium at 30°C to an OD600 of 2.0, harvested, and lysed as described for the preparation of mitochondria (Meisinger et al., 2006a blue right-pointing triangle) but using homogenization buffer with 2 mg/ml bovine serum albumin, 2 mM phenylmethylsulfonyl fluoride (PMSF), and complete EDTA-free protease inhibitors (Roche, Indianapolis, IN). The lysate was cleared by centrifugation (30,000 × g) and was added to human immunoglobulin G–coupled Sepharose beads. Unbound material was removed by washing with excess homogenization buffer. The Bcy1-Tpk complexes were eluted by cleavage with TEV protease in homogenization buffer. After addition of 10–20% (vol/vol) glycerol and 2 mM dithiothreitol (DTT), the eluates were stored at −80°C. Alternatively, a yeast strain expressing Tpk1TAP was grown on fermentable YPD medium (1% [wt/vol] yeast extract, 2% [wt/vol] bactopeptone, 2% [wt/vol] glucose) until an OD600 of 1.0, and extracts were purified as described (Mah et al., 2005 blue right-pointing triangle). The kinase was eluted by cleavage with TEV protease in kinase buffer (100 mM Tris, pH 7.4, 100 mM NaCl, 10 mM MgCl2, 20% glycerol, 1 mM PMSF, 1× PhosStop [Roche]). Eluates were stored at −80°C.

In vitro phosphorylation assays

Tom40 was purified from inclusion bodies as described (Hill et al., 1998 blue right-pointing triangle). The inclusion bodies were solubilized in urea buffer (8 M urea, 50 mM Tris/HCl pH 8.0, 1 mM EDTA, and 100 mM DTT). Kemptide-GST and Tom70cd were prepared as described (Schmidt et al., 2011 blue right-pointing triangle).

In vitro phosphorylation reactions with recombinant mouse PKA (New England BioLabs, Ipswich, MA) and [γ-33P]ATP were performed as described (Schmidt et al., 2011 blue right-pointing triangle). For analysis by Phos-tag SDS–PAGE and immunoblotting, 5–10 mM ATP and 50 U/μl PKA (New England BioLabs) were used. Tom40 in vitro phosphorylation was performed in a buffer with 25 mM tricine, 7.5 mM BisTris, and 0.5% (vol/vol) heptyl-thio-glucopyranoside, pH 7.0.

Bcy1-Tpk complexes were supplemented with 1× PKA assay buffer (New England BioLabs), 1× PhosStop (Roche), 2 mM PMSF, 0.2 mM ATP, 5 mCi of [γ-33P]ATP (PerkinElmer, Waltham, MA), 50–100 μM 8Br-cAMP (Sigma-Aldrich, St. Louis, MO; or Biaffin, Kassel, Germany) where indicated, Kemptide-GST, or Tom70cdWT in a total volume of 18 μl and incubated for 30 min at 25°C under constant shaking. The reactions were stopped by addition of Laemmli buffer and heating to 95°C.

For Tom40, the Bcy1-Tpk complexes or the Tpk1 eluate were incubated with 1 μg of Tom40WT, Tom40S54E, or Tom40S54A, 50–100 μM 8Br-cAMP (where indicated), 0.2 mM ATP, and 5 mCi [γ-33P]ATP (PerkinElmer) in a total volume of 20 μl for 90 min at 25°C under constant shaking. The reactions were stopped by addition of Laemmli buffer and heating to 95°C.

Isolated mitochondria were supplemented with 1× PKA assay buffer, 1× PhosStop, 5–10 mM ATP, and either 50 U/μl recombinant PKA in SEM buffer or Bcy1-Tpk complexes with 50–100 μM 8Br-cAMP and incubated at 25°C. For Phos-tag and immunoblot analysis, 5–10 mM ATP and recombinant Tom40WT or Tom40S54A were used in a total volume of 15 μl.

For Phos-tag SDS–PAGE, standard discontinuous 8–12.5% polyacrylamide gels were prepared with the modification that 50 μM Phos-tag reagent (Kinoshita et al., 2006 blue right-pointing triangle) and 100 μM MnCl2 were added to the separation gel mix prior to polymerization.

Protein import assays

35S-Labeled precursor proteins were generated by in vitro translation and incubated with isolated mitochondria in import buffer as described (Ryan et al., 2001 blue right-pointing triangle; Stojanovski et al., 2007 blue right-pointing triangle). Where indicated, the reactions were supplemented with 50 U/μl recombinant PKA (New England BioLabs) during translation or import. The import efficiency of different precursor forms was directly compared by adjusting the levels of the radiolabeled proteins added to the import reactions.

The import reactions were stopped on ice, and mitochondria were reisolated, washed in SEM buffer, and either lysed directly in sample buffer or treated with 100 mM Na2CO3 (pH 11.5) and centrifuged at 100,000 × g for 1 h before lysis in sample buffer to test for membrane integration (Fujiki et al., 1982 blue right-pointing triangle; Stojanovski et al., 2007 blue right-pointing triangle). SDS–PAGE or Phos-tag SDS–PAGE was followed by digital autoradiography (GE Healthcare, Piscataway, NJ). To analyze protein complex formation, mitochondria were lysed in 1% digitonin-containing buffer and analyzed by blue native electrophoresis (Ryan et al., 2001 blue right-pointing triangle; Wittig et al., 2006 blue right-pointing triangle; Stojanovski et al., 2007 blue right-pointing triangle) and digital autoradiography.

Acknowledgments

We thank C. Gerbeth and B. Kulawiak for discussion. This work was supported by the Deutsche Forschungsgemeinschaft, Excellence Initiative of the German Federal and State Governments (GSC-4 Spemann Graduate School; EXC 294 BIOSS), Trinationales Graduiertenkolleg GRK 1478, Sonderforschungsbereich 746, Bundesministerium für Bildung und Forschung (Dynamo), Landesforschungspreis Baden-Württemberg, and Gottfried Wilhelm Leibniz Program.

Abbreviations used:

CK2
casein kinase 2
Mim1
mitochondrial import protein 1 of the outer membrane
PKA
protein kinase A
TEV
tobacco etch virus
TOM
translocase of the outer mitochondrial membrane

Footnotes

This article was published online ahead of print in MBoC in Press (http://www.molbiolcell.org/cgi/doi/10.1091/mbc.E11-11-0933) on March 14, 2012.

REFERENCES

  • Abe Y, Shodai T, Muto T, Mihara K, Torii H, Nishikawa S, Endo T, Kohda D. Structural basis of presequence recognition by the mitochondrial protein import receptor Tom20. Cell. 2000;100:551–560. [PubMed]
  • Ahting U, Thieffry M, Engelhardt H, Hegerl R, Neupert W, Nussberger S. Tom40, the pore-forming component of the protein-conducting TOM channel in the outer membrane of mitochondria. J Cell Biol. 2001;153:1151–1160. [PMC free article] [PubMed]
  • Albuquerque CP, Smolka MB, Payne SH, Bafna V, Eng J, Zhou H. A multidimensional chromatography technology for in-depth phosphoproteome analysis. Mol Cell Proteomics. 2008;7:1389–1396. [PMC free article] [PubMed]
  • Anandatheerthavarada HK, Biswas G, Mullick J, Sepuri NB, Otvos L, Pain D, Avadhani NG. Dual targeting of cytochrome P4502B1 to endoplasmic reticulum and mitochondria involves a novel signal activation by cyclic AMP-dependent phosphorylation at ser128. EMBO J. 1999;18:5494–5504. [PubMed]
  • Becker L, Bannwarth M, Meisinger C, Hill K, Krimmer T, Casadio R, Truscott KN, Schulz GE, Pfanner N, Wagner R. Preprotein translocase of the outer mitochondrial membrane: reconstituted Tom40 forms a characteristic TOM pore. J Mol Biol. 2005;353:1011–1020. [PubMed]
  • Becker T, Guiard B, Thornton N, Zufall N, Stroud DA, Wiedemann N, Pfanner N. Assembly of the mitochondrial protein import channel: role of Tom5 in two-stage interaction of Tom40 with the SAM complex. Mol Biol Cell. 2010;21:3106–3113. [PMC free article] [PubMed]
  • Becker T, Pfannschmidt S, Guiard B, Stojanovski D, Milenkovic D, Kutik S, Pfanner N, Meisinger C, Wiedemann N. Biogenesis of the mitochondrial TOM complex: Mim1 promotes insertion and assembly of signal-anchored receptors. J Biol Chem. 2008;283:120–127. [PubMed]
  • Becker T, Wenz LS, Thornton N, Stroud D, Meisinger C, Wiedemann N, Pfanner N. Biogenesis of mitochondria: dual role of Tom7 in modulating assembly of the preprotein translocase of the outer membrane. J Mol Biol. 2011;405:113–124. [PubMed]
  • Brix J, Dietmeier K, Pfanner N. Differential recognition of preproteins by the purified cytosolic domains of the mitochondrial import receptors Tom20, Tom22, and Tom70. J Biol Chem. 1997;272:20730–20735. [PubMed]
  • Brix J, Rüdiger S, Bukau B, Schneider-Mergener J, Pfanner N. Distribution of binding sequences for the mitochondrial import receptors Tom20, Tom22, and Tom70 in a presequence-carrying preprotein and a non-cleavable preprotein. J Biol Chem. 1999;274:16522–16530. [PubMed]
  • Broach JR. RAS genes in Saccharomyces cerevisiae: signal transduction in search of a pathway. Trends Genet. 1991;7:28–33. [PubMed]
  • Cameron S, Levin L, Zoller M, Wigler M. cAMP-independent control of sporulation, glycogen metabolism, and heat shock resistance in S. cerevisiae. Cell. 1988;53:555–566. [PubMed]
  • Cannon JF, Tatchell K. Characterization of Saccharomyces cerevisiae genes encoding subunits of cyclic AMP-dependent protein kinase. Mol Cell Biol. 1987;8:2653–2663. [PMC free article] [PubMed]
  • Carlucci A, Lignitto L, Feliciello A. Control of mitochondria dynamics and oxidative metabolism by cAMP, AKAPs and the proteasome. Trends Cell Biol. 2008;18:604–613. [PubMed]
  • Chacinska A, Koehler CM, Milenkovic D, Lithgow T, Pfanner N. Importing mitochondrial proteins: machineries and mechanisms. Cell. 2009;138:628–644. [PMC free article] [PubMed]
  • Chang CR, Blackstone C. Cyclic AMP-dependent protein kinase phosphorylation of Drp1 regulates its GTPase activity and mitochondrial morphology. J Biol Chem. 2007;282:21583–21587. [PubMed]
  • Chi A, Huttenhower C, Geer LY, Coon JJ, Syka JE, Bai DL, Shabanowitz J, Burke DJ, Troyanskaya OG, Hunt DF. Analysis of phosphorylation sites on proteins from Saccharomyces cerevisiae by electron transfer dissociation (ETD) mass spectrometry. Proc Natl Acad Sci USA. 2007;104:2193–2198. [PubMed]
  • Cho JH, Lee YK, Chae CB. The modulation of the biological activities of mitochondrial histone Abf2p by yeast PKA and its possible role in the regulation of mitochondrial DNA content during glucose repression. Biochim Biophys Acta. 2001;1522:175–186. [PubMed]
  • De Rasmo D, Panelli D, Sardanelli AM, Papa S. cAMP-dependent protein kinase regulates the mitochondrial import of the nuclear encoded NDUFS4 subunit of complex I. Cell Signal. 2008;20:989–997. [PubMed]
  • Dembowski M, Künkele KP, Nargang FE, Neupert W, Rapaport D. Assembly of Tom6 and Tom7 into the TOM core complex of Neurospora crassa. J Biol Chem. 2001;276:17679–17685. [PubMed]
  • Dolezal P, Likic V, Tachezy J, Lithgow T. Evolution of the molecular machines for protein import into mitochondria. Science. 2006;313:314–318. [PubMed]
  • Endo T, Yamano K, Kawano S. Structural insight into the mitochondrial protein import system. Biochim Biophys Acta. 2011;1808:955–970. [PubMed]
  • Fujiki Y, Hubbard AL, Fowler S, Lazarow PB. Isolation of intracellular membranes by means of sodium carbonate treatment: application to endoplasmic reticulum. J Cell Biol. 1982;93:97–102. [PMC free article] [PubMed]
  • Gentle I, Gabriel K, Beech P, Waller R, Lithgow T. The Omp85 family of proteins is essential for outer membrane biogenesis in mitochondria and bacteria. J Cell Biol. 2004;164:19–24. [PMC free article] [PubMed]
  • Gnad F, de Godoy LM, Cox J, Neuhauser N, Ren S, Olsen JV, Mann M. High-accuracy identification and bioinformatic analysis of in vivo protein phosphorylation sites in yeast. Proteomics. 2009;9:4642–4652. [PubMed]
  • Habib SJ, Waizenegger T, Lech M, Neupert W, Rapaport D. Assembly of the TOB complex of mitochondria. J Biol Chem. 2005;280:6434–6440. [PubMed]
  • Harsman A, Krüger V, Bartsch P, Honigmann A, Schmidt O, Rao S, Meisinger C, Wagner R. Protein conducting nanopores. J Phys Condens Matter. 2010;22:454102. [PubMed]
  • Hill K, Model K, Ryan MT, Dietmeier K, Martin F, Wagner R, Pfanner N. Tom40 forms the hydrophilic channel of the mitochondrial import pore for preproteins. Nature. 1998;395:516–521. [PubMed]
  • Hoogenraad NJ, Ward LA, Ryan MT. Import and assembly of proteins into mitochondria of mammalian cells. Biochim Biophys Acta. 2002;1592:97–105. [PubMed]
  • Hoppins SC, Nargang FE. The Tim8-Tim13 complex of Neurospora crassa functions in the assembly of proteins into both mitochondrial membranes. J Biol Chem. 2004;279:12396–12405. [PubMed]
  • Hulett JM, Lueder F, Chan NC, Perry AJ, Wolynec P, Likic VA, Gooley PR, Lithgow T. The transmembrane segment of Tom20 is recognized by Mim1 for docking to the mitochondrial TOM complex. J Mol Biol. 2008;376:694–704. [PubMed]
  • Humphries AD, Streimann IC, Stojanovski D, Johnston AJ, Yano M, Hoogenraad NJ, Ryan MT. Dissection of the mitochondrial import and assembly pathway of human Tom40. J Biol Chem. 2005;280:11535–11543. [PubMed]
  • Kato H, Mihara K. Identification of Tom5 and Tom6 in the preprotein translocase complex of human mitochondrial outer membrane. Biochem Biophys Res Commun. 2008;369:958–963. [PubMed]
  • Kiebler M, Keil P, Schneider H, van der Klei IJ, Pfanner N, Neupert W. The mitochondrial receptor complex: a central role of MOM22 in mediating preprotein transfer from receptors to the general insertion pore. Cell. 1993;74:483–492. [PubMed]
  • Kinoshita E, Kinoshita-Kikuta E, Takiyama K, Koike T. Phosphate-binding tag, a new tool to visualize phosphorylated proteins. Mol Cell Proteomics. 2006;5:749–757. [PubMed]
  • Kozjak V, Wiedemann N, Milenkovic D, Lohaus C, Meyer HE, Guiard B, Meisinger C, Pfanner N. An essential role of Sam50 in the protein sorting and assembly machinery of the mitochondrial outer membrane. J Biol Chem. 2003;278:48520–48523. [PubMed]
  • Kutik S, et al. Dissecting membrane insertion of mitochondrial β-barrel proteins. Cell. 2008;132:1011–1024. [PubMed]
  • Lemaire K, Van de Velde S, Van Dijck P, Thevelein JM. Glucose and sucrose act as agonist and mannose as antagonist ligands of the G protein-coupled receptor Gpr1 in the yeast Saccharomyces cerevisiae. Mol Cell. 2004;16:293–299. [PubMed]
  • Li J, Qian X, Hu J, Sha B. Molecular chaperone Hsp70/Hsp90 prepares the mitochondrial outer membrane translocon receptor Tom71 for preprotein loading. J Biol Chem. 2009;284:23852–23859. [PMC free article] [PubMed]
  • Li X, Gerber SA, Rudner AD, Beausoleil SA, Haas W, Villen J, Elias JE, Gygi SP. Large-scale phosphorylation analysis of α-factor-arrested Saccharomyces cerevisiae. J Proteome Res. 2007;6:1190–1197. [PubMed]
  • Mah AS, Elia AE, Devgan G, Ptacek J, Schutkowski M, Snyder M, Yaffe MB, Deshaies RJ. Substrate specificity analysis of protein kinase complex Dbf2-Mob1 by peptide library and proteome array screening. BMC Biochem. 2005;6:22. [PMC free article] [PubMed]
  • Matsumoto K, Uno I, Ishikawa T, Oshima Y. Cyclic AMP may not be involved in catabolite repression in Saccharomyces cerevisiae: evidence from mutants unable to synthesize it. J Bacteriol. 1983;156:898–900. [PMC free article] [PubMed]
  • Meisinger C, Pfanner N, Truscott KN. Isolation of yeast mitochondria. Methods Mol Biol. 2006a;313:33–39. [PubMed]
  • Meisinger C, Ryan MT, Hill K, Model K, Lim JH, Sickmann A, Müller H, Meyer HE, Wagner R, Pfanner N. Protein import channel of the outer mitochondrial membrane: a highly stable Tom40-Tom22 core structure differentially interacts with preproteins, small Tom proteins, and import receptors. Mol Cell Biol. 2001;21:2337–2348. [PMC free article] [PubMed]
  • Meisinger C, Wiedemann N, Rissler M, Strub A, Milenkovic D, Schönfisch B, Müller H, Kozjak V, Pfanner N. Mitochondrial protein sorting: differentiation of β-barrel assembly by Tom7-mediated segregation of Mdm10. J Biol Chem. 2006b;281:22819–22826. [PubMed]
  • Meisinger C, et al. The morphology proteins Mdm12/Mmm1 function in the major β-barrel assembly pathway of mitochondria. EMBO J. 2007;26:2229–2239. [PubMed]
  • Moczko M, Ehmann B, Gärtner F, Hönlinger A, Schäfer E, Pfanner N. Deletion of the receptor MOM19 strongly impairs import of cleavable preproteins into Saccharomyces cerevisiae mitochondria. J Biol Chem. 1994;269:9045–9051. [PubMed]
  • Model K, Meisinger C, Prinz T, Wiedemann N, Truscott KN, Pfanner N, Ryan MT. Multistep assembly of the protein import channel of the mitochondrial outer membrane. Nat Struct Biol. 2001;8:361–370. [PubMed]
  • Neupert W, Herrmann JM. Translocation of proteins into mitochondria. Annu Rev Biochem. 2007;76:723–749. [PubMed]
  • Pagliarini DJ, Dixon JE. Mitochondrial modulation: reversible phosphorylation takes center stage? Trends Biochem Sci. 2006;31:26–34. [PubMed]
  • Paschen SA, Waizenegger T, Stan T, Preuss M, Cyrklaff M, Hell K, Rapaport D, Neupert W. Evolutionary conservation of biogenesis of β-barrel membrane proteins. Nature. 2003;426:862–866. [PubMed]
  • Popov-Celeketic J, Waizenegger T, Rapaport D. Mim1 functions in an oligomeric form to facilitate the integration of Tom20 into the mitochondrial outer membrane. J Mol Biol. 2008;376:671–680. [PubMed]
  • Rao S, Gerbeth C, Harbauer A, Mikropoulou D, Meisinger C, Schmidt O. Signaling at the gate: phosphorylation of the mitochondrial protein import machinery. Cell Cycle. 2011;10:2083–2090. [PubMed]
  • Rapaport D, Neupert W. Biogenesis of Tom40, core component of the TOM complex of mitochondria. J Cell Biol. 1999;146:321–331. [PMC free article] [PubMed]
  • Rapaport D, Taylor RD, Käser M, Langer T, Neupert W, Nargang FE. Structural requirements of Tom40 for assembly into preexisting TOM complexes of mitochondria. Mol Biol Cell. 2001;12:1189–1198. [PMC free article] [PubMed]
  • Rimmer KA, Foo JH, Ng A, Petrie EJ, Shilling PJ, Perry AJ, Mertens HD, Lithgow T, Mulhern TD, Gooley PR. Recognition of mitochondrial targeting sequences by the import receptors Tom20 and Tom22. J Mol Biol. 2011;405:804–818. [PubMed]
  • Robin MA, Anandatheerthavarada HK, Biswas G, Sepuri NB, Gordon DM, Pain D, Avadhani NG. Bimodal targeting of microsomal CYP2E1 to mitochondria through activation of an N-terminal chimeric signal by cAMP-mediated phosphorylation. J Biol Chem. 2002;277:40583–40593. [PMC free article] [PubMed]
  • Robin MA, Prabu SK, Raza H, Anandatheerthavarada HK, Avadhani NG. Phosphorylation enhances mitochondrial targeting of GSTA4-4 through increased affinity for binding to cytoplasmic Hsp70. J Biol Chem. 2003;278:18960–18970. [PubMed]
  • Russell M, Bradshaw-Rouse J, Markwardt D, Heideman W. Changes in gene expression in the Ras/adenylate cyclase system of Saccharomyces cerevisiae: correlation with cAMP levels and growth arrest. Mol Biol Cell. 1993;4:757–765. [PMC free article] [PubMed]
  • Ryan MT, Voos W, Pfanner N. Assaying protein import into mitochondria. Methods Cell Biol. 2001;65:189–215. [PubMed]
  • Santangelo GM. Glucose signaling in Saccharomyces cerevisiae. Microbiol Mol Biol Rev. 2006;70:253–282. [PMC free article] [PubMed]
  • Santel A, Frank S. Shaping mitochondria: the complex posttranslational regulation of the mitochondrial fission protein DRP1. IUBMB Life. 2008;60:448–455. [PubMed]
  • Schmidt O, et al. Regulation of mitochondrial protein import by cytosolic kinases. Cell. 2011;144:227–239. [PubMed]
  • Schmitt S, Ahting U, Eichacker L, Granvogl B, Go NE, Nargang FE, Neupert W, Nussberger S. Role of Tom5 in maintaining the structural stability of the TOM complex of mitochondria. J Biol Chem. 2005;280:14499–14506. [PubMed]
  • Sherman EL, Go NE, Nargang FE. Functions of the small proteins in the TOM complex of Neurospora crassa. Mol Biol Cell. 2005;16:4172–4182. [PMC free article] [PubMed]
  • Sherman EL, Taylor RD, Go NE, Nargang FE. Effect of mutations in Tom40 on stability of the translocase of the outer mitochondrial membrane (TOM) complex, assembly of Tom40, and import of mitochondrial preproteins. J Biol Chem. 2006;281:22554–22565. [PubMed]
  • Shiota T, Mabuchi H, Tanaka-Yamano S, Yamano K, Endo T. In vivo protein-interaction mapping of a mitochondrial translocator protein Tom22 at work. Proc Natl Acad Sci USA. 2011;108:15179–15183. [PubMed]
  • Sikorski RS, Hieter P. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics. 1989;122:19–27. [PubMed]
  • Smets B, Ghillebert R, De Snijder P, Binda M, Swinnen E, De Virgilio C, Winderickx J. Life in the midst of scarcity: adaptations to nutrient availability in Saccharomyces cerevisiae. Curr Genet. 2010;56:1–32. [PubMed]
  • Soubannier V, McBride HM. Positioning mitochondrial plasticity within cellular signaling cascades. Biochim Biophys Acta. 2009;1793:154–170. [PubMed]
  • Stojanovski D, Pfanner N, Wiedemann N. Import of proteins into mitochondria. Methods Cell Biol. 2007;80:783–806. [PubMed]
  • Suzuki H, Kadowaki T, Maeda M, Sasaki H, Nabekura J, Sakaguchi M, Mihara K. Membrane-embedded C-terminal segment of rat mitochondrial TOM40 constitutes protein-conducting pore with enriched beta-structure. J Biol Chem. 2004;279:50619–50629. [PubMed]
  • Tamaki H. Glucose-stimulated cAMP-protein kinase A pathway in yeast Saccharomyces cerevisiae. J Biosci Bioeng. 2007;104:245–250. [PubMed]
  • Taylor RD, McHale BJ, Nargang FE. Characterization of Neurospora crassa Tom40-deficient mutants and effect of specific mutations on Tom40 assembly. J Biol Chem. 2003;278:765–775. [PubMed]
  • Taylor SS, Buechler JA, Yonemoto W. cAMP-dependent protein kinase: framework for a diverse family of regulatory enzymes. Annu Rev Biochem. 1990;59:971–1005. [PubMed]
  • Thevelein JM. Signal transduction in yeast. Yeast. 1994;10:1753–1790. [PubMed]
  • Toda T, Cameron S, Sass P, Zoller M, Scott JD, McMullen B, Hurwitz M, Krebs EG, Wigler M. Cloning and characterization of BCY1, a locus encoding a regulatory subunit of the cyclic AMP-dependent protein kinase in Saccharomyces cerevisiae. Mol Cell Biol. 1987a;7:1371–1377. [PMC free article] [PubMed]
  • Toda T, Cameron S, Sass P, Zoller M, Wigler M. Three different genes in S. cerevisiae encode the catalytic subunits of the cAMP-dependent protein kinase. Cell. 1987b;50:277–287. [PubMed]
  • Truscott KN, Wiedemann N, Rehling P, Müller H, Meisinger C, Pfanner N, Guiard B. Mitochondrial import of the ADP/ATP carrier: the essential TIM complex of the intermembrane space is required for precursor release from the TOM complex. Mol Cell Biol. 2002;22:7780–7789. [PMC free article] [PubMed]
  • Van de Velde S, Thevelein JM. Cyclic AMP-protein kinase A and Snf1 signaling mechanisms underlie the superior potency of sucrose for induction of filamentation in Saccharomyces cerevisiae. Eukaryot Cell. 2008;7:286–293. [PMC free article] [PubMed]
  • van Wilpe S, et al. Tom22 is a multifunctional organizer of the mitochondrial preprotein translocase. Nature. 1999;401:485–489. [PubMed]
  • Waizenegger T, Habib SJ, Lech M, Mokranjac D, Paschen SA, Hell K, Neupert W, Rapaport D. Tob38, a novel essential component in the biogenesis ofβ-barrel proteins of mitochondria. EMBO Rep. 2004;5:704–709. [PubMed]
  • Walther DM, Rapaport D. Biogenesis of mitochondrial outer membrane proteins. Biochim Biophys Acta. 2009;1793:42–51. [PubMed]
  • Wiedemann N, Kozjak V, Chacinska A, Schönfisch B, Rospert S, Ryan MT, Pfanner N, Meisinger C. Machinery for protein sorting and assembly in the mitochondrial outer membrane. Nature. 2003;424:565–571. [PubMed]
  • Wiedemann N, Truscott KN, Pfannschmidt S, Guiard B, Meisinger C, Pfanner N. Biogenesis of the protein import channel Tom40 of the mitochondrial outer membrane: intermembrane space components are involved in an early stage of the assembly pathway. J Biol Chem. 2004;279:18188–18194. [PubMed]
  • Wittig I, Carrozzo R, Santorelli FM, Schägger H. Supercomplexes and subcomplexes of mitochondrial oxidative phosphorylation. Biochim Biophys Acta. 2006;1757:1066–1072. [PubMed]
  • Yamano K, Tanaka-Yamano S, Endo T. Tom7 regulates Mdm10-mediated assembly of the mitochondrial import channel protein Tom40. J Biol Chem. 2010;285:41222–41231. [PMC free article] [PubMed]
  • Yamano K, Yatsukawa Y, Esaki M, Hobbs AE, Jensen RE, Endo T. Tom20 and Tom22 share the common signal recognition pathway in mitochondrial protein import. J Biol Chem. 2008;283:3799–3807. [PubMed]
  • Young JC, Hoogenraad NJ, Hartl FU. Molecular chaperones Hsp90 and Hsp70 deliver preproteins to the mitochondrial import receptor Tom70. Cell. 2003;112:41–50. [PubMed]
  • Zaman S, Lippman SI, Zhao X, Broach JR. How Saccharomyces responds to nutrients. Annu Rev Genet. 2008;42:27–81. [PubMed]
  • Zara V, Ferramosca A, Robitaille-Foucher P, Palmieri F, Young JC. Mitochondrial carrier protein biogenesis: role of the chaperones Hsc70 and Hsp90. Biochem J. 2009;419:369–375. [PubMed]

Articles from Molecular Biology of the Cell are provided here courtesy of American Society for Cell Biology