PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of toxsciLink to Publisher's site
 
Toxicol Sci. 2012 April; 126(2): 478–486.
Published online 2012 January 12. doi:  10.1093/toxsci/kfs008
PMCID: PMC3307609

Cadmium Associated With Inhaled Cadmium Oxide Nanoparticles Impacts Fetal and Neonatal Development and Growth

Abstract

One industrially important metal oxide nanoparticle (NP) is cadmium oxide (CdO). A study was performed using timed-pregnant CD-1 mice to determine if Cd associated with inhaled CdO NP could reach the placenta and adversely affect the developing fetus and/or neonate. Pregnant mice were exposed by inhalation either every other day to 100 μg of freshly generated CdO/m3 (exposure 1) or daily to 230 μg CdO/m3 (exposure 2). In each exposure, mice were exposed to CdO NP or carrier gas (control) for 2.5 h from 4.5 days post coitus (dpc) through 16.5 dpc. At 17.5 dpc, fetuses and placentas from both exposures 1 and 2 were collected, measured, and weighed. A subgroup from the second exposure was allowed to give birth, and neonates were weighed daily until weaning. Cadmium in the uterus and placenta, as well as in other maternal organs, was elevated in NP-treated mice, but was undetectable in fetuses at 17.5 dpc. Daily inhalation of 230 μg CdO NP/m3 decreased the incidence of pregnancy (i.e., no evidence of implantation) by 23%, delayed maternal weight gain, altered placental weight, and decreased fetal length, as well as delayed neonatal growth. This study demonstrates that inhalation of CdO NP during pregnancy adversely affects reproductive fecundity and alters fetal and postnatal growth of the developing offspring.

Keywords: nanoparticles, prenatal, inhalation, cadmium, developmental, maternal exposure

Recent advancements in synthetic chemistry and physics have given rise to the manufacture of nano-sized materials (any dimension < 100 nm) that are revolutionizing many aspects of life including computer sciences, molecular imaging, medical diagnostics, and therapeutic targeting in human medicine (Maynard, 2007). Indeed, it has been estimated that the nanotechnology industry will have an economic impact of about $1 trillion by 2015 (Roco, 2005). Women of childbearing age are likely to make up a large proportion of workers in the nanomaterial industry. However, although the potential uses for nanomaterials are great, the majority of materials remain untested regarding their safety for human health, particularly during manufacture.

Cadmium (Cd) metal, long used in the manufacture of nickel-Cd batteries, dyes, and in fire-retardant materials, also possesses a potentially wide range of industrial and medical uses as a nanoparticle (NP). At present, nano-sized Cd oxide (CdO) serves as the starting material in the manufacture of quantum dots, which are gaining favor in both medical diagnostic imaging and targeted therapeutics (Bentolila et al., 2005).

When metal compounds are inhaled, penetration into the lung is determined by both chemical form (i.e., ionized or metallic) and physical particle size. Cadmium oxide particles that reach the deep lung stimulate an inflammatory response wherein neutrophils and monocytes entering the lung attempt to ingest the inhaled material (Takenaka et al., 2004). In addition, Cd has been shown in rodent models to leave the lungs following inhalation of both soluble and insoluble compounds and reach distant sites in the body (Oberdörster, 1992; Takenaka et al., 2004).

Most forms of Cd cause significant effects at nearly all levels of female reproduction, and for that reason, it is referred to as a metalloestrogen (Götz, 2004). For example, ip injection of soluble cadmium chloride (CdCl2; up to 2 mg/kg) increased uterine weight in ovariectomized rats (Höfer et al., 2009) and inhalation studies in the same species using both soluble CdCl2 and relatively water-insoluble CdO at 1 mg/m3, decreased pregnancy incidence (Barański, 1984). In addition, Cd associated with cigarette smoke is linked to changes in the fetoplacental unit including disrupted placental oxygen transfer (Bush et al., 2000). In that regard, Padmanabhan (1986) demonstrated that a single ip dose of CdCl2 (4 mg/kg) delivered to mice on day 7 of gestation resulted in growth retardation, fetal resorption, and morphological abnormalities of the fetus along with decreased placental weight.

In light of the well-known female reproductive toxicity associated with both ionic and larger insoluble particulate forms of Cd, a toxicological study was performed to determine the impact of inhaled freshly generated CdO NP on reproductive health and fetal/neonatal growth and development. This study also provided important pharmacokinetic and pharmacodynamic data regarding Cd translocation from the lungs.

MATERIALS AND METHODS

Animals.

Male and female CD-1 mice (Charles River Laboratories, Kingston, NY), 5–7 weeks of age upon arrival, were housed individually in temperature- and humidity-regulated rooms (~22°C and 55% relative humidity) in polycarbonate cages with Sani-Chip bedding (< 0.1 ppm Cd; P.J. Murphy Forest Products Corp., Montville, NJ). Acidified deionized water and a specialized Cd-reduced phytoestrogen-free diet (AIN-93G; TestDiet, Richmond, IN) were provided ad libitum except during exposures. Light and dark periods were maintained on 12-h cycles. All animal procedures were conducted under a protocol approved by the New York University Institutional Animal Care and Use Committee.

Experimental design.

As shown in Figure 1A, female mice were examined daily by vaginal cytology for estrous cycle status beginning 1 day after arrival. On the third proestrus following two normal cycles, a single female mouse was paired overnight with one male. The following morning, mating was confirmed by the presence of either a seminal plug or sperm in vaginal flushings. Upon detection of breeding (considered 0.5 days post coitus [dpc]), females were randomly assigned to either air control or CdO NP treatment group.

FIG. 1.
Experimental design and exposure schematic. (A) Exposure to CdO NP or to filtered air began at 4.5 dpc and ended at either 16.5 dpc for mice being euthanized or 17.5 dpc for those giving birth. (B) CdO NP generation and nose-only exposure system.

The mice were acclimated to the nose-only exposure tubes (Battelle, Columbus, OH) beginning 2 days after arrival for 10 min/day, which then increased to 1 h by the time of breeding. Mated mice, weighed daily prior to exposure, were exposed by nose-only inhalation to CdO NP for 2.5 h beginning at 4.5 dpc in one of either two exposures as described below.

At 16.5 dpc, inhalation exposures ceased and dams were either allowed to give birth (~19.5 dpc) or were euthanized 24 h later (at 17.5 dpc) via ip injection of pentobarbital (0.2 ml of Sleepaway [Fort Dodge Animal Health, Fort Dodge, IA] diluted 1:10 in PBS). Blood was collected from the femoral artery at the time of euthanasia, and the lungs, liver, kidneys, spleen, thymus, brain, and ovaries were weighed and stored at −20°C for later analyses of Cd burden by graphite furnace atomic absorption spectroscopy (gAAS). The uterus was weighed after the removal of the amniotic sacs. Each fetus, after dissection out of its individual amniotic sac and separation from the placenta (by severing the umbilical cord), was weighed, and then the crown to rump length was measured using a standard protocol (Parker, 2006). Specifically, each pup was placed on its right side and distance from the top of the head to the base of the tail was measured using calipers. Each individual placenta was then separated from the extraembryonic membranes and weighed. In addition, a small piece of fetal tail was taken for PCR-based sex determination (see below).

Selected dams allowed to give birth were weighed daily until parturition. At birth, pups from each litter were counted and weighed individually from the morning of birth to weaning at 3 weeks of age. After birth, pups were randomly euthanized (by ip injection of 0.05 ml pentobarbital) on postnatal days (PND) 1, 5, and 10 for determination of whole-body Cd burden. A small piece of tail was collected from the pups euthanized on PND 1 and 5 for genetic sexing.

Cadmium oxide NP generation and inhalation exposure.

NPs of CdO were generated in a Palas (Model GFG-1000) arc furnace (Karlsruhe, Germany) in an argon (Ar, Ultrapure; AGI, NJ) chamber with two opposing Cd metal bars (99.995% pure; ESPI, Ashland, OR) as electrodes (Fig. 1B), as previously described by others for different freshly generated metal oxide NPs (Cuevas et al., 2010; Elder et al., 2006; Gillespie et al., 2010). The high voltage frequency set at 40 Hz (exposure 1) and 85 Hz (exposure 2) resulted in target NP concentrations of ~100 μg CdO/m3 and 230 μg CdO/m3, respectively. Generated NP were carried by 3.5 l/min Ar flow and mixed with 23.5 l/min particle-free air. Carrier gas, cooled using ice packs prior to entering the system, was mixed with 1 l/min oxygen (Ultrapure; AGI, NJ) resulting in a 20% oxygen level in the exposure air.

Mated mice were exposed by (nose-only) inhalation either every other day to ~100 μg CdO/m3 (exposure 1) or daily to ~230 μg CdO/m3 (exposure 2). In all cases, mice were exposed for 2.5 h/day starting at 4.5 dpc through to 16.5 dpc. The controls were exposed to cooled carrier air from which all NPs had been high efficiency particulate air-filtered out prior to entering the chamber. Mouse body temperatures were monitored throughout the exposure using thin wire J-thermocouples (J-Kem, St Louis, MO) attached to a Model 210 monitor (J-Kem) to assure constant body temperature during restraint. At the end of each exposure, the entire exposure system was purged for 20–30 min with NP-free carrier gas.

Physicochemical characterization of CdO NP.

Size distribution and number concentration of freshly generated CdO NP were determined in real time using a nano-differential mobility analyzer (DMA) scanning mobility particle sizer (SMPS) consisting of an electrostatic classifier (model 3080), a nano-DMA (model 3085), and a condensation particle counter (model 3010) (all purchased from TSI, St Paul, MN). The particle sampling stream leaving the exposure chamber was split with half directed toward the SMPS and the remainder going toward a particle filter sampling system containing a preweighed Teflon filter (37 mm, 0.2 μm pore size) that collected particles throughout the exposure. Particle-laden Teflon filters were equilibrated overnight in a temperature/humidity-controlled weighing room (21°C ± 0.5°C and 40 ± 5% relative humidity) and then weighed gravimetrically on an MT5 microbalance (Mettler Toledo, Hightstown, NJ). Three preweighed filters were also analyzed by x-ray fluorescence (XRF; RTI, Inc., Research Triangle Park, NC) to determine metal purity of the generated CdO NP.

NP size distribution and concentration were measured at a high voltage frequency setting of 40 Hz using a 13-stage Electric Low Pressure Impactor (ELPI, Dekati, Finland). Particles, collected on 10 mm mica substrates (Highest Grade V1, Ted Pella, CA) placed at the center of the filter stage, were imaged topographically to determine physical size of the NP using atomic force microscopy (AFM) (Autoprobe II; Veeco Instruments, CA) in noncontact mode with a silicon ultralever tip (Model MPP-11123; Veeco, CA). The surface scan data were processed and analyzed using image analysis software, SIMAGIS Research (Smart Imaging Technology, TX).

Determination of Cd tissue content.

Preweighed maternal samples of lung, liver, kidney, blood, uterus, placentas, as well as 17.5 dpc fetuses, and whole neonates were assessed for total Cd using a previously described procedure (Cohen et al., 2003). Briefly, tissues were placed into Teflon beakers with ultrapure nitric acid (Optima grade; Fisher Scientific) and heated to 100°C –110°C and allowed to cool overnight. After incubation, digests were reheated, hydrogen peroxide (Optima grade; Fisher Scientific) added until the digestate was nearly colorless, and Milli-Q water added to a final volume of 2 ml. Cadmium content was determined using a GF95 gAAS (Thermo Scientific, Waltham, MA) against a five-point standard curve constructed from a certified Cd standard (Fisher Scientific). Fetal Cd burden was determined using both gAAS and inductively coupled plasma mass spectrometry (ICP-MS, Dr Brian Buckley).

Sexing.

To determine sex, primers were designed to simultaneously amplify genomic portions of interleukin-3 (0.4μM each; 5′ GGGACTCCAAGCTTCAATCA; 3′ TGGAGGAGGAAGAAAAGCAA) and sex-determining region of the Y-chromosome (0.65μM each; 5′ TGGGACTGGTGACAATTGTC; 3′ GAGTACAGGTGTGCAGCTCT) using either fetal or neonatal tail digests as described by Truett et al. (2000). The cycling conditions were as follows: 95°C for 4.5 min, followed by 33 cycles of 95°C for 35 s, 50°C for 1 min, 72°C for 1 min, followed by a final extension at 72°C for 10 min. After PCR, reactions were separated on agarose gels, and sex was determined by visualization of ethidium bromide bands under ultraviolet light.

Statistical analysis.

Control- and CdO NP–treated groups were compared using two-way ANOVA using the general linear models of SAS (SAS Institute, Cary, NC). All tissue weights were normalized to bodyweight (BW) prior to analyses and are expressed as organ-to-BW. Tissue Cd burdens were normalized to mass of tissue digested and presented as nanograms per milligram tissue or nanograms per microliter blood. Changes in litter growth rates were determined using litter as the representative unit and employing repeated measures from day of birth through weaning on PND 21. Comparisons were considered to be significantly different at p < 0.05. Data are presented as the means ± SE.

RESULTS

Characterization of Generated CdO NP

Physicochemical characteristics of CdO NP were measured in real time and data are shown in Table 1. Target concentrations of 100 and 230 μg CdO/m3 yielded actual mass concentrations of CdO (based on gravimetric analyses) of 97 ± 5 and 225 ± 4 μg/m3, for exposures 1 and 2, respectively. The number concentration of particles (per cm3) in exposure 1 was 53% higher than that measured in exposure 2, and particle mass concentration rose as the inhaled NP concentration increased from 100 μg to 230 μg CdO/m3. However, raising the particle mass slightly increased the NP geometric mean diameter (i.e., 11.0 ± 0.1 vs. 15.3 ± 0.1 nm, respectively). Increasing the generator frequency led to a decrease in particle number (no. /cm3) without a change in particle surface area concentration (nm2/cm3). In addition, increasing particle generation frequency from 40 to 85 Hz decreased NP density by 53%. NPs generated at both frequencies were polydispersed with a geometric SD of ~1.5. The number-weighted size distribution of CdO aerosol particles measured by both nano-DMA SMPS and ELPI demonstrated agreement between both systems (see Supplementary fig. 1). AFM (scan size 10 × 10 μm and resolution of 1024 × 1024 [cf, Supplementary fig. 1A]) revealed a particle size (generated at a high voltage frequency setting of 40 Hz) slightly larger than that measured by SMPS (15 ± 2 nm [cf, Supplementary Figs. 1B and 1C]). XRF analysis of the particles (generated at the same setting) confirmed that Cd represented > 99% of the total metal mass.

TABLE 1
Size and Mass Concentration of CdO NP

Tissue Cd Distribution and Effects on Maternal Physiology

Cadmium burdens associated with inhaled CdO NP were measured in maternal lungs, liver, kidneys, blood, uterus, and placenta using gAAS (Fig. 2A). As expected, the lungs contained the greatest burden of Cd, and pulmonary levels were directly related to the inhaled NP concentration. All tissues analyzed from control mice had small but measurable Cd levels. Exposure to both CdO NP concentrations resulted in significantly elevated levels of Cd in all tissues. At the lower NP concentration, tissue Cd levels in the liver and kidney were the same as those measured in blood; kidney burden of Cd was significantly greater at the higher NP concentration compared with that seen at the lower inhaled dose. Examination of the uterus and placenta demonstrated Cd concentrations that were independent of dose. Histological analysis of hematoxylin- and eosin-stained placentas failed to reveal any gross abnormalities in those mice exposed to either NP concentration (data not shown). Cadmium was undetectable in the fetuses at 17.5 dpc, as measured either by gAAS (detection limit [DL] = 0.02 ng/ml) or by ICP-MS (DL = 0.1 ppb).

FIG. 2.
Translocation of NP-associated Cd and tissue burdens. (A) Data represent mean (n = 5–21 mice per tissue per NP concentration) tissue Cd levels normalized to total amount of tissue (mg, solid tissue or μl, whole blood) ± SE. As ...

Daily exposure to 230 μg CdO NP/m3 increased relative maternal lung and uterine weights compared with control mice and to those exposed to the lower NP concentration. In contrast, exposure of pregnant mice every other day to the lower NP concentration did not affect relative maternal organ weights (Fig. 2B). There was a modest but significant increase in liver weights between the two CdO NP exposure groups.

Serum 17β-estradiol (E2) decreased by ~50% in mice exposed to the higher CdO NP concentration compared with air-treated controls (22.8 ± 3.6 vs. 11.0 ± 1.1 pg/ml, respectively, p = 0.02). In contrast, circulating levels of progesterone and testosterone (both upstream precursors in the biosynthesis of E2) in NP-exposed dams were unchanged compared with the control groups (control values 58.0 ± 4.5 and 0.34 ± 0.03 ng/ml, respectively). In addition, messenger RNA expression of estrogen receptor (ER)α and ERβ was ~1.4-fold higher and ~3.5-fold lower, respectively, in the uteri of mice exposed to the higher NP concentration at 17.5 dpc. Expression of these receptors was unchanged in the ovaries (compared with controls).

Daily inhalation of 230 μg CdO/m3 decreased the incidence of pregnancy (observed evidence of implantation) in mated females compared with control mice (83 vs. 60%, respectively). In contrast, females exposed every other day to 100 μg CdO NP/m3 appeared to be unaffected (89% incidence). Maternal exposure to either CdO NP concentration had no effect on numbers of fetal resorptions, average litter size, or male:female sex ratio, nor were any obvious structural defects observed.

Daily percentage of maternal BW gain was determined from the morning of breeding detection (0.5 dpc) through 17.5 dpc (Fig. 3). By 4.5 dpc, dams from all three treatment groups (i.e., control, 100 μg, and 230 μg CdO/m3) gained ~2% compared with their respective groups at 0.5 dpc. However, by 5.5 dpc, BW gain in the highest NP exposure group was significantly decreased, a trend that persisted through 9.5 dpc. This tendency was not seen in control mice or in mice exposed to 100 μg CdO/m3. At 10.5 dpc, maternal weight gain in the 230 μg CdO/m3 treatment group began to increase in a similar fashion to that seen for the control- and 100 μg CdO/m3-exposed animals. By the end of the exposure period (i.e., 16.5 dpc), pregnant mice from all treatment groups increased ~70% over their 0.5 dpc BW.

FIG. 3.
Inhalation of 230 μg CdO NP/m3 decreased maternal BW and delayed weight gain during pregnancy. As control values from exposures 1 and 2 were not different, data were pooled for statistical analyses. Daily comparisons were made between the two ...

Inhalation of CdO NPs at 230 μg/m3 altered placental weight (Fig. 4A). At 10.5 dpc, placental weight was 17.1% less in CdO-exposed dams than controls at the same gestational time point. In contrast, by 14.5 and 17.5 dpc, the placentas weighed more in CdO-exposed dams (by 5.7 and 7.4%, respectively) than their control counterparts. In addition, crown-to-rump length of fetuses from the CdO-exposed dams was significantly less than those from control mice at both 14.5 and 17.5 dpc (7.1 and 8.8%, respectively) (Fig. 4B). No statistical differences in fetal BW were seen between treatment groups for fetuses at either 14.5 or 17.5 dpc (p > 0.2).

FIG. 4.
Maternal inhalation of 230 μg CdO NP/m3 alters (A) placental weight and (B) fetal crown to rump length. Embryos at 10.5 dpc could not be reliably removed from their chorions and thus were not measured. Data represent means (n = 4–8 litters) ...

Effect of NP Exposure on Neonatal Growth

A subgroup of control- and NP-exposed dams were used for birth and postnatal observations. Mice from both groups gave birth on or about 19.5 dpc. The litters were weighed daily from birth for the first 3 weeks of life. Neonatal BW gain was evaluated using two different methods: percent change from initial birth weight and daily weight gain over time. BW gain from birth was significantly slower by those neonates born to the highest NP-treated dams compared with age-matched controls (Fig. 5A). Neonatal growth lagged significantly behind their control counterparts, falling even further with increasing pup age. Neonates from control dams reached a size six times their birth weight at PND 14, whereas an additional 3 days were needed for pups from CdO-exposed dams to reach the same growth milestone. Differences between the treatment groups were most pronounced between birth and PND 5, referred to in Figure 5B as the neonatal period. Between PNDs 5 and 15, offspring from both treatment groups gained weight at about the same rate; growth spiked at PND 17 and then leveled out for both treatment groups.

FIG. 5.
Effects of maternal inhalation of 230 μg CdO NP/m3 on (A) percent change in BW compared with birth weight and (B) percent change in daily BW. Data represent the means ± SE. (C) Neonatal whole-body Cd burden at PNDs 1, 5, and 10. Data represent ...

To determine if differences in neonatal BW gain were associated with Cd burden, levels were measured in whole neonates on PNDs 1, 5, and 10 (Fig. 5C). Neonates, from dams exposed to the higher CdO NP concentration, had significantly elevated Cd levels on PND 1 that remained elevated through PND 5 and then dropped to control levels by PND 10.

DISCUSSION

A large proportion of the workforce potentially exposed to nanomaterials are women of childbearing age. Despite this, few studies have determined the effects of such worker exposures on reproductive health and fetal/neonatal development and growth.

Studies herein were designed to model workplace exposure. As no industrial limits for CdO NP currently exist, particle concentrations were chosen (taking into account the respiratory tidal volume of mice and the duration of exposure) based upon Occupational Safety and Health Administration limits for inhalation exposure to bulk-size CdO in the workplace (50 μg/m3). Based on tidal volume, a human worker could (potentially) inhale ~14 μg CdO/day at the highest permissible level. In comparison, mice exposed daily to 230 μg CdO/m3 were expected to receive ~1 μg CdO/day. However, there is a possibility that nano-sized CdO may be more potent that bulk-sized particles, and therefore, more than one concentration was tested. At the lower inhaled NP concentration, no effects on the outcomes of interest were observed and thus could provide a possible no observable effect level; for the second experiment, the concentration and frequency of exposure were increased to determine the particle level for which an effect could be observed. The higher CdO concentration resulted in lower serum concentrations than have been reported (Haddam et al., 2011; Orisakwe et al., 2007) for men working in the Cd industry (0.15 vs. 1.3 ng Cd/μl, respectively).

Dams exposed to the highest CdO concentration in this study experienced a decreased weight gain from the start of exposure until ~8.5 dpc compared with controls and mice receiving 100 μg CdO NP/m3. A similar response was observed in rats following oral and inhalational exposure to soluble and insoluble Cd compounds (Barański and Sitarek, 1987). Anorexia has also been reported in industrial workers exposed accidently to CdO fumes (Beton et al., 1966). A decrease in food consumption could explain (in part) the observed weight gain reduction. Future experiments that monitor food intake will determine the feasibility of this possibility.

Daily exposure of pregnant mice to 230 μg CdO NP/m3 decreased pregnancy incidence (no evidence of implantation) in exposed dams. The exact mechanism underlying this outcome is not clear. However, as CdO exposures began around the time of implantation (4.5 dpc), it is possible that Cd presents in the uterine lumen prevented implantation and/or resulted in death of the implanted blastocysts. Studies using in vitro–fertilized mouse embryos support this possibility and demonstrate that in the presence of CdCl2-cultured embryos displayed diminished implantation potential when transferred to synchronized females (Yu and Chan, 1987). Decreased pregnancy incidence observed in our study could also be related to the estrogen-mimetic effects of Cd (Höfer et al., 2009). In this case, uterine luminal Cd may be acting as an endocrine disruptor (ER agonist) causing inappropriate signaling that leads to asynchrony of the uterine lining, which could prevent implantation and continued pregnancy in the exposed dam. Another possible cause for reduced pregnancy rate could be that exposure to Cd decreased progesterone levels during early pregnancy as has also been shown in rats (Paksy et al., 1992).

Cadmium, associated with the inhalation of CdO NP, translocated in pregnant mice from the lungs to distant sites around the body, including the reproductive organs and fetoplacental unit. We suspect that Cd ions, rather than intact NP themselves, moved from the local site of deposition to extrapulmonary target organs based on studies demonstrating that water-insoluble CdO may be more soluble in the microenvironment of the lung and that once dissolved, Cd ions are slowly cleared via the blood and transported to other tissues (Oberdörster, 1992). However, preliminary in vitro dissolution experiments performed by our collaborators (Drs Elder and Gelein, unpublished observations) demonstrated that freshly generated CdO NP released only small amounts of Cd ions in either water- or pH-reduced simulated lung fluid for up to 5 h. These preliminary dissolution studies failed to rule out the possibility of translocation of the intact particle. Raman spectroscopy studies are currently planned to address the important question of Cd form at extrapulmonary sites.

Maternal inhalation of both CdO NP concentrations resulted in elevated levels of Cd in the uterus of exposed dams during late gestation. In addition, uterine weight, a marker of estrogenic activity, was also increased at the higher exposure concentration. Previous studies in ovariectomized rats have demonstrated that Cd can stimulate uterine growth through direct interaction with ERs (Höfer et al., 2009). Gene expression data in the present study show increased ERα expression in uteri of NP-exposed mice. The increase in uterine weight combined with the observed decrease in circulating E2 levels suggests that Cd associated with inhaled NP acts as a uterotrophic agent in pregnant mice. Moreover, the decrease in E2 in our study suggests that Cd may affect E2 synthesis.

Though placental weight was dramatically altered by maternal inhalation of CdO NP (i.e., weighing less early in gestation and then exceeding that of the control weight a few days prior to parturition), alterations did not appear to be associated with any obvious changes in placental histology (data not shown). In an epidemiological study examining post-World War II Dutch women, increased placental weight, in the absence of any birth weight changes, was correlated with reduced maternal nutrition, particularly during the first trimester (Lumey, 1998). Hyperglycemia during early pregnancy also resulted in increased placental weight in a pregnant rat model (Ericsson et al., 2007), which, in this case, was likely due to increased placental expression of glucose and amino acid transporters. Studies in knockout mice revealed a role for the insulin-like growth factor (IGF)-II gene in regulating placental size, as well. Thus, Cd-induced alterations in IGF-II might account (at least in part) for the observed increase in placental weight (reviewed by Fowden and Forhead, 2009), and this hypothesis will be tested in future studies.

Results here also showed that maternal exposure to inhaled CdO NP caused a significant decrease in fetal crown to rump length, a commonly used measurement to predict developmental toxicity, in the absence of effects on fetal weight. These results were consistent with findings in human studies inasmuch as neonatal height was negatively correlated with maternal blood Cd level but not with either neonatal weight or head/chest circumferences (Nishijo et al., 2004). An elevated level of circulating testosterone in women has also been associated with shorter babies (Carlsen et al., 2006), but the lack of change in maternal testosterone here seems to rule out this mechanism. Another potential mechanism that could explain (at least in part) the observed CdO NP–induced decrease in fetal length could be alterations in the fetal and/or maternal IGF system (Mushtaq et al., 2004; Nagaya et al., 2009). This hypothesis is currently being tested.

Although effects on fetal crown to rump length might suggest Cd transfer through the placenta to reach the fetus, Cd was not measurable in the later-stage fetus. The apparent lack of placental transfer of Cd to the fetal mouse is supported by epidemiological evidence. Lin et al. (2011) demonstrated that women exposed to environmental Cd during pregnancy failed to pass it to their children. Another recent epidemiological study supports the hypothesis that Cd-induced fetotoxicity is due to indirect effects on the placenta (Kippler et al., 2010). In that study, Cd accumulation in the placenta impacted the developing fetus by altering the transport of zinc, vitamin B12, and other micronutrients in nonsmoking Bangladeshi women (Danielsson and Dencker, 1984).

Maternal exposure to the highest CdO NP concentration reduced neonatal growth rate in the early days following birth. Concurrently, neonatal mice (with no detectable level of Cd in utero) had measurable Cd burdens at 1 and 5 days after birth. Changes in neonatal growth rate, particularly during the first 4 days of postnatal growth, could be explained (at least partly) by lactational Cd exposure. Other studies in rodents have demonstrated the presence of Cd in the milk of lactating mice shortly following maternal exposure (Grawé and Oskarsson, 2000). Though not measured directly in our study, milk-borne Cd could act by a variety of mechanisms to reduce neonatal growth early after birth including mammary gland production of nutritionally inferior milk, altered neonatal response to milk-derived growth factors, and/or altered growth factor synthesis or response to IGFs by the neonatal liver. Decreased Cd burdens observed in our study at PND 10 could be due to Cd excretion or diminishing levels of Cd in the milk as the mammary glands became depleted. Decreased Cd burdens at the later postnatal time point are supported by a study in Wistar rats (Roelfzema et al., 1987) that demonstrated that Cd levels in the livers of maternally exposed offspring tended to decrease as the pups got older (through PND 35).

The studies here provide compelling evidence that inhalation of CdO NP can impact reproductive success and perinatal development and growth. Results of these studies send a strong public health message to pregnant women and those of child-bearing age exposed in the workplace to CdO NP. Our findings also provide a strong basis for pursuing more mechanistic studies to explain how inhalation of such particles acts to alter reproductive and fetal health.

SUPPLEMENTARY DATA

Supplementary data are available online at http://toxsci.oxfordjournals.org/.

FUNDING

Studies were supported by National Institute of Environmental Health Sciences (NIEHS) ES017427, NIEHS postdoctoral training fellowship T32 ES007324, and in part by NYU NIEHS Center grant ES000260.

Supplementary Material

Supplementary Data:

Acknowledgments

Thanks to Lori Horton and Lauren K. Rosenblum for their assistance with animal exposures and tissue collections, Drs Allison Elder and Bob Gelein (University of Rochester Instrumentation Core Facility, ES01247) for the CdO NP dissolution studies, Dr Michael Goedkin for histological examination of the placentas, and Dr Brian Buckley for ICP-MS on the 17.5 dpc fetuses.

References

  • Barański B. Effect of exposure of pregnant rats to cadmium on prenatal and postnatal development of the young. J. Hyg. Epidemiol. Microbiol. Immunol. 1984;29:253–262. [PubMed]
  • Barański B, Sitarek K. Effect of oral and inhalation exposure to cadmium on the oestrous cycle in rats. Toxicol. Lett. 1987;36:267–273. [PubMed]
  • Bentolila LA, Michalet X, Pinaud FF, Tsay JM, Doose S, Li JJ, Sundaresan G, Wu AM, Gambhir SS, Weiss S. Quantum dots for molecular imaging and cancer medicine. Discov. Med. 2005;5:213–218. [PMC free article] [PubMed]
  • Beton DC, Andrews GS, Davies HJ, Howells L, Smith GF. Acute cadmium fume poisoning. Five cases with one death from renal necrosis. Br. J. Ind. Med. 1966;23:292–301. [PMC free article] [PubMed]
  • Bush PG, Mayhew TM, Abramovich DR, Aggett PJ, Burke MD, Page KR. A quantitative study on the effects of maternal smoking on placental morphology and cadmium concentration. Placenta. 2000;21:247–256. [PubMed]
  • Carlsen SM, Jacobsen G, Romundstad P. Maternal testosterone levels during pregnancy are associated with offspring size at birth. Eur. J. Endocrinol. 2006;155:365–370. [PubMed]
  • Cohen MD, Sisco M, Baker K, Bowser D, Chen LC, Schlesinger RB. Impact of coexposure to ozone on the carcinogenic potential of inhaled chromium. 1. Effects on retention and on extra- and intracellular distribution. J. Toxicol. Environ. Health A. 2003;66:39–55. [PubMed]
  • Cuevas AK, Liberda EN, Gillespie PA, Allina J, Chen LC. Inhaled nickel nanoparticles alter vascular reactivity in C57BL/6 mice. Inhal. Toxicol. 2010;22:100–106. [PubMed]
  • Danielsson BR, Dencker L. Effects of cadmium on the placental uptake and transport to the fetus of nutrients. Biol. Res. Pregnancy Perinatol. 1984;5:93–101. [PubMed]
  • Elder A, Gelein R, Silva V, Feikert T, Opanashuk L, Carter J, Potter R, Maynard A, Ito Y, Finkelstein J, et al. Translocation of inhaled ultrafine manganese oxide particles to the central nervous system. Environ. Health Perspect. 2006;114:1172–1178. [PMC free article] [PubMed]
  • Ericsson A, Säljö K, Sjöstrand E, Jansson N, Prasad PD, Powell TL, Jansson T. Brief hyperglycaemia in the early pregnant rat increases fetal weight at term by stimulating placental growth and affecting placental nutrient transport. J. Physiol. 2007;581:1323–1332. [PubMed]
  • Fowden AL, Forhead AJ. Endocrine regulation of feto-placental growth. Horm. Res. 2009;72:257–265. [PubMed]
  • Gillespie PA, Kang GS, Elder A, Gelein R, Chen L, Moreira AL, Koberstein J, Tchou-Wong K, Gordon T, Chen LC. Pulmonary response after exposure to inhaled nickel hydroxide nanoparticles: Short and long-term studies in mice. Nanotoxicology. 2010;4:106–119. [PMC free article] [PubMed]
  • Götz R. [Cadmium is a metalloestrogen] Pharm. Unserer Zeit. 2004;33:83. [PubMed]
  • Grawé KP, Oskarsson A. Cadmium in milk and mammary gland in rats and mice. Arch. Toxicol. 2000;73:519–527. [PubMed]
  • Haddam N, Samira S, Dumont X, Taleb A, Lison D, Haufroid V, Bernard A. Confounders in the assessment of the renal effects associated with low-level urinary cadmium: An analysis in industrial workers. Environ. Health. 2011;10:37–46. [PMC free article] [PubMed]
  • Höfer N, Diel P, Wittsiepe J, Wilhelm M, Degen GH. Dose- and route-dependent hormonal activity of the metalloestrogen cadmium in the rat uterus. Toxicol. Lett. 2009;191:123–131. [PubMed]
  • Kippler M, Hoque AM, Raqib R, Ohrvik H, Ekström EC, Vahter M. Accumulation of cadmium in human placenta interacts with the transport of micronutrients to the fetus. Toxicol. Lett. 2010;192:162–168. [PubMed]
  • Lin CM, Doyle P, Wang D, Hwang YH, Chen PC. Does prenatal cadmium exposure affect fetal and child growth? Occup. Environ. Med. 2011;68:641–646. [PubMed]
  • Lumey LH. Compensatory placental growth after restricted maternal nutrition in early pregnancy. Placenta. 1998;19:105–111. [PubMed]
  • Maynard A. Spoonful of caution with nano hype. Interview by Naomi Lubick. Environ. Sci. Technol. 2007;41:2661–2665. [PubMed]
  • Mushtaq T, Bijman P, Ahmed SF, Farquharson C. Insulin-like growth factor-I augments chondrocyte hypertrophy and reverses glucocorticoid-mediated growth retardation in fetal mice metatarsal cultures. Endocrinology. 2004;145:2478–2486. [PubMed]
  • Nagaya K, Makita Y, Taketazu G, Okamoto T, Nakamura E, Hayashi T, Fujieda K. Paternal allele of IGF2 gene haplotype CTG is associated with fetal and placental growth in Japanese. Pediatr. Res. 2009;66:135–139. [PubMed]
  • Nishijo M, Tawara K, Honda R, Nakagawa H, Tanebe K, Saito S. Relationship between newborn size and mother's blood cadmium levels, Toyama, Japan. Arch. Environ. Health. 2004;59:22–25. [PubMed]
  • Oberdörster G. Pulmonary deposition, clearance and effects of inhaled soluble and insoluble cadmium compounds. IARC Sci. Publ. 1992;118:189–204. [PubMed]
  • Orisakwe OE, Nwachukwu E, Osadolor HB, Afonne OJ, Okocha CE. Liver and kidney function tests amongst paint factory workers in Nkpor, Nigeria. Toxicol. Ind. Health. 2007;23:161–165. [PubMed]
  • Padmanabhan R. The effect of cadmium on placental structure and its relation to fetal malformations in the mouse. Z. Mikrosk. Anat. Forsch. 1986;100:419–427. [PubMed]
  • Paksy K, Varga B, Náray M, Olajos F, Folly G. Altered ovarian progesterone secretion induced by cadmium fails to interfere with embryo transport in the oviduct of the rat. Reprod. Toxicol. 1992;6:77–83. [PubMed]
  • Parker RM. Testing for reproductive toxicity. In: Hood RD, editor. Developmental and Reproductive Toxicology: A Practical Approach. 2nd ed. Boca Raton, FL: CRC Taylor and Francis Group; 2006. pp. 425–487.
  • Roco MC. Environmentally responsible development of nanotechnology. Environ. Sci. Technol. 2005;39:106A–112A. [PubMed]
  • Roelfzema WH, Roelofsen AM, Herber RFM, Leene W, Peereboom-Stegeman JHJC. Effects of chronic cadmium administration on placental and fetal development. J. Trace Elem. Electrolytes Health Dis. 1987;1:49–53. [PubMed]
  • Takenaka S, Karg E, Kreyling WG, Lentner B, Schulz H, Ziesenis A, Schramel P, Heyder J. Fate and toxic effects of inhaled ultrafine cadmium oxide particles in the rat lung. Inhal. Toxicol. 2004;16(Suppl. 1):83–92. [PubMed]
  • Truett GE, Heeger P, Mynatt RL, Truett AA, Walker JA, Warman ML. Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris (HotSHOT) Biotechniques. 2000;29:52–54. [PubMed]
  • Yu HS, Chan ST. Effects of cadmium on preimplantation and early postimplantation mouse embryos in vitro with special reference to their trophoblastic invasiveness. Pharmacol. Toxicol. 1987;60:129–134. [PubMed]

Articles from Toxicological Sciences are provided here courtesy of Oxford University Press