Ethics statement
All experimental protocols were approved by the Creighton University Institutional Animal Care and Use Committee Policies and Procedures. In this study strict measures were taken to minimize pain and suffering to animals in accordance with the recommendations in the Guide for Care and Use of Laboratory Animals of the National Institutes of Health. The IACUC protocols for these studies were 0893 and 0865.
Generation and genotyping of GluD1 knockout mice
GluD1 KO mice were obtained from Dr. Jian Zuo, St. Jude's Children's Hospital
[10]. These mice had been generated by creating a targeting construct that deleted exons 11 and 12 of the GluD1 gene (GRID1). The targeted disruption ensured removal of three of the four transmembrane domains of the GluD1 receptor and introduced a frameshift after exon 12. In the PCR analysis no 220 bp wildtype bands (in the deleted region) were detected in the homozygous GluD1 KO mice. All mice analyzed were from a mixed background of 129/SvEv and C57BL/6 in the F2 to F6 generations
[10].
Genotyping was done as previously described
[10]. The primers used for the reaction were as follows: a pair of primers from the deleted region of GluD1;
5′GCAAGCGCTACATGGACTAC 3′ and
5′GGCACTGTGCAGGGTGGCAG 3′ and a pair of primers from the targeting vector;
5′CCTGAATGAACTGCAGGACG 3′ and
5′CGCTATGTCCTGATAGCGATC 3′.
Mouse husbandry
Wildtype (WT), GluD1 heterozygous and GluD1 KO male mice, aged 8 weeks were either group housed (4–5 mice) or single housed (as per the requirements of the test) in the animal house facility at a constant temperature (22±1°C) and a 12-hr light-dark cycle with free access to food and water. Behavioral testing was performed between 9:00 a.m and 4:00 p.m. The study did not involve using female mice to avoid the confounding effects of the estrus cycle on behavioral and neurochemical measures. The WT, GluD1 heterozygous and GluD1 KO mice were obtained from previously genotyped parent cages.
Behavioral testing
Behavioral testing was performed between 9:00 a.m and 4:00 p.m. As per the requirements of the tests, mice were handled for 3 days to acclimatize them to the experimenter before subjecting them to the experimental procedures. Each day the experimenter picked up each animal and the animal was allowed to explore the experimenter's hand for 2 min. All experimental animals were placed in the experimental room at least 60 min before beginning any experimental protocol. Unless indicated otherwise, all experimental environments were thoroughly cleaned with 70% ethanol between trials which was given time to dry away. All behavioral procedures were video-recorded and scored by a scorer blind to the genotype of the animal via a random coding system of the video files.
Lithium treatment
Chronic lithium treatment was conducted as previously described
[27]. This protocol has been shown to maintain trunk blood level of lithium within the human therapeutic level (0.4–1.2 mM). We measured the blood lithium concentration at the end of the experiments and found that they were within this stipulated range (0.7–1.0 mM) (performed at Creighton University Medical laboratory, Omaha, NE, USA). Lithium concentration was measured using the Thermo Scientific Infinity Lithium reagent, Rockford, IL, USA. The assay is based on change in absorbance with binding of lithium to substituted porphyrin compound at alkaline pH. Absorbance was measured using Beckman Coulter DXC Synchron, Brea, CA, USA. WT and GluD1 KO mice were fed lithium carbonate chow (2.4 g/kg, Bioserve, Frenchtown, NJ, USA) or control chow identical to lithium carbonate chow with the exception of lithium salt for 4 weeks. Due to the side effects of polyuria and polydipsia the cage bedding and water bottles were changed twice a week. Mice were also supplied with 0.9% NaCl in addition to tap water to supplement for possible electrolyte imbalance. We measured the body weight and food consumption in a small group of animals during the lithium treatment. The body weight did not decrease over the course of lithium diet and the food consumption was also similar to the regular diet. Mice were then subjected to the open field, forced swim and the resident-intruder test, the procedures for which have been described later in the
methods section.
D-Cycloserine (DCS) treatment
There were four groups of mice, WT saline, GluD1 KO saline, WT DCS and GluD1 KO DCS. DCS (Sigma-Aldrich (C6880); St Louis, MO, USA) was dissolved in 0.9% saline. Freshly dissolved DCS was used for experiments. We used a dose of DCS that has previously been shown to be efficacious in social behavior in mice
[28],
[29]. Mice were administered a single dose of 320 mg/kg DCS in 0.9% saline (80–100 µl) or 0.9% saline (90 µl) intraperitoneally, 20 min prior to beginning the sociability/social novelty test. The sociability test and the test for social novelty were performed after DCS treatment. The procedures for the sociability test and the test for social novelty are described later in the
methods section.
Test for vision
To test normal vision in GluD1 KO we performed a qualitative test. The mice were picked up by the tail and slowly lowered to a wire cage lid. Vision (score of 1) was reflected in an animal's extending its forepaws and attempting to grip the lid just before contact with the surface. If the mouse failed to exhibit this behavior it was scored as blind (score of 0). Since all animals in both genotypes WT and GluD1 KO received a score of 1 no statistical analysis was performed.
Test for olfaction
Hide the cookie test was performed to test olfaction
[30]. Two days before the test, mice were acclimatized to the food stimulus; a mini cookie from Teddy Grahams (Nabisco, Hanover, New Jersey). 18–24 hrs before the test, mice were fasted with free access to water. The mouse to be tested was then placed in a clean cage with 3 cm deep bedding and allowed to acclimate to the cage for 5 min. The mouse was then transferred to an empty cage. In the cage containing the bedding, the food stimulus was buried 1 cm beneath the bedding in a random corner of the cage. The bedding surface was made smooth. The mouse was reintroduced into the cage and the latency to find the food stimulus was recorded. In case a mouse failed to find the buried food stimulus, the mouse was allowed to explore the cage for 15 min and the latency was scored as 900 sec.
Open field test
The open field test was performed as previously described
[31]. Spontaneous locomotor activity was recorded in an open field 25×25 cm arena with grid marking (6.25×6.25 cm) on the bottom. White light of 300–330 lux intensity was used to evenly illuminate the entire open field arena. The number of times and total time the mouse entered the central four squares (central field penetration) as well as the total number of line crosses made by the mouse in the 15 min interval were tallied and expressed as cumulative line crosses during the 15 min interval. Scoring was done by an experimenter blind to the genotype of the mice.
Marble burying test
The marble burying test was performed as previously described
[32] with minor modifications. Anxiety-like behavior was assessed with the marble burying test using a square 25×25 cm arena with the home cage bedding to a height of 5 cm. White light of 300–330 lux intensity was used to evenly illuminate the entire arena of the marble burying test. 36 dark colored marbles 1.5 cm in diameter were placed 5 cm apart. The test mouse was placed in the same corner of the open field arena and left in the arena for 30 min. At the end of the 30 min the mouse was taken out and the number of marbles buried was counted. If two-thirds of a marble was buried inside the bedding it was counted as buried otherwise non-buried. The marble burying test is based on the observation that mice experiencing greater anxiety-like behavior would bury greater number of marbles
[32].
Elevated plus maze
The elevated plus maze was constructed and conducted as previously described
[33] with modifications for time similar to
[31]. The apparatus was made of plastic material and was elevated to a height of 40 cm above the ground. Each arm of the plus maze was 30 cm in length and 5 cm in width. Additionally, the closed arms had wall enclosures that were 15.25 cm high. The central platform was a square of 5×5 cm. Light intensity around the maze was set at 300–330 lux. Mice were placed on the elevated plus maze for 15 min. Mice were placed on the elevated plus maze facing the open arm opposite to the experimenter. Arm location was recorded with an elevated video camera. The animals were videotaped for 15 minutes. The number of entries and the time spent in the open and closed arms were recorded over the entire duration of the test.
Forced swim test
The forced swim test measures depression-like behavior in mice
[34] with modifications. Mice were placed in a glass cylinder 13 cm diameter X 24 cm high, filled with 10 cm high water (22±2°C), for a period of 5 min. Water was changed between subjects. All test sessions were recorded by a video camera positioned in front of the glass cylinder. Videotapes were subsequently scored by an observer blind to the genotype of the mice. Mice were judged immobile when they remained floating passively in the water, with minor movements to keep their heads above the water. The videos were scored for total duration of immobility and latency to immobility. Latency to immobility is defined as the duration of time from the beginning of the test session, to the appearance of the first 3 sec immobile event.
Sucrose preference test
The sucrose preference test was conducted as previously described
[35] with minor modifications. Mice were individually housed for this test. During the test, mice were given for 24 hr, a free choice between 1% sucrose in one bottle and tap water in another. To avoid the possible effects of side preference in drinking behavior, the position of the bottles was interchanged after 12 hr. The mice were not subjected to previous food or water deprivation prior to the test. Water and sucrose consumption was calculated in both groups by weighing the bottles. The preference for sucrose was calculated as a percentage of sucrose solution consumed of the total amount of liquid drunk.
Resident-intruder test
The resident-intruder test was performed as previously described
[36] with minor modifications. The resident animals were singly housed for three weeks and the last one week prior to conducting the test no cage change was done. A WT mouse (intruder) was introduced into the home cage of the singly housed resident animal. The grid wire holding the feed and the water bottle was removed; the cotton in the cage was also removed while conducting the test. All the resident animals weighed 4–5 g more than the intruder animals. The two mice were left to interact for 10 min. Each intruder mouse was only used once. The interaction between the two mice was videotaped and scored later for attack latency and frequency of attacks with the scorer being blind to the genotype of the mice. Attack latency is defined as the time taken for the resident mouse to initiate the first attack.
Sociability test/Preference for social novelty
The procedure for the social interaction and social novelty test were performed as previously described
[37],
[38] with minor modifications. The experiment was conducted in a room with a light intensity of 300–330 lux. The social interaction chamber is a three chambered apparatus made of clear Plexiglas. Doorways built into the two dividing walls controlled access to the side chambers. Each of the three chambers was 20 cm length ×40.5 cm width ×22 cm high. In the sociability test, the experimental mouse was subjected to a 5 min acclimation period in the middle chamber with doors to both side chambers closed. This was done in the presence of an unfamiliar adult male (Stranger 1) in one of the chambers and an inanimate object in the other chamber. A transparent plastic container with holes was used to enclose the Stranger 1 mouse. The other chamber contained an empty container of the same size (referred to as inanimate object). A weighted plastic cup was placed on top of each plastic container to prevent the subject from climbing to the top. Location of the stranger mouse and the inanimate object was alternated between the two-side chambers on consecutive sessions. During the sociability test doors to the chambers on either side were opened and the experimental mouse was allowed to explore the three chambers for 10 min. A circle with a 1 cm radius was marked around the periphery of the plastic container. The duration the experimental mouse spent within this circle interacting with the inanimate or Stranger 1 containing plastic container was recorded. The percent time interacting with Stranger 1 was reported as; time interacting with Stranger 1/[(time interacting with the inanimate object) + (time interacting with Stranger 1)]*100. Subsequently the same experimental mouse was subjected to the test for social novelty, beginning with the experimental mouse being acclimatized to the middle chamber for 10 min in the presence of the two stranger mice, one on either side, with the second unfamiliar mouse being a new stranger mouse (Stranger 2) placed in the opposite side, which was previously empty during the sociability test with the doors on either side of the middle chamber to the side chambers being closed. During the test for social novelty, the doors on either side were raised open and the experimental mouse was allowed to explore all the three chambers for 10 min. The duration the experimental mouse spent exploring the circle around plastic container containing Stranger 1 or Stranger 2 was recorded. The percent time interacting with Stranger 2 was reported as; time interacting with Stranger 2/[(time interacting with Stranger 1 + time interacting with Stranger 2)]*100. All the stranger mice used for the experiment were WT mice. The entire procedures were video-taped and scored later by a person blind to the genotype of the mice.
mRNA expression analysis
For mRNA expression analysis 15 day old naive WT and GluD1 KO mice were anesthetized using isoflurane anesthesia. Mice were then decapitated and thereafter all experimental procedures were conducted on ice. The brain was dissected out, the amygdala, prefrontal cortex and hippocampi were crudely dissected out and the freshly dissected amygdala, prefrontal cortex and hippocampi were put into TRIzol reagent (1 ml TRIzol reagent per 50–100 mg of tissue) and homogenized. Phase separation was achieved by addition of 0.2 ml of chloroform and centrifugation at 12,000× g for 15 min at 2–8°C. For RNA precipitation, the aqueous phase was transferred into a fresh tube and 0.5 ml isopropyl alcohol was added. The samples were incubated for 10 min and centrifuged at 12,000× g for 10 min at 2–8°C. RNA pellet was washed once with 75% ethanol, briefly dried and dissolved in DEPC water.
The primers used for the reaction were as follows: GluD1 forward 5′ ACCTCCTGGAATGGGATGAT, GluD1 reverse 5′ CCTCAGGCTTCTTGATGAGG, β-actin forward 5′AATTTCTGAATGGCCCAGGT, β-actin reverse 5′ TGTGCACTTTTATTGGTCTCAA. For RT-PCR, 3 µg RNA was purified from the amygdala, hippocampus and the prefrontal cortex of postnatal day 15 WT and GluD1 KO mice and subjected to DNAse treatment and was thereafter reverse transcribed into cDNA in a 10 µl reaction and the cDNA thus obtained was subjected to a conventional RT-PCR . In each case, RNA samples were verified as free of DNA contamination by running RT-PCR negative control lacking reverse transcriptase. From the 10 µl cDNA, 5 µl was used for PCR reaction with GluD1 primers and 5 µl was used for PCR reaction with β-actin primers. For the PCR, total of 32 cycles were employed with annealing at 55°C and extension at 72°C. 12 µl of each sample's PCR product was separated by 2% agarose gel electrophoresis and the gels were imaged using a UV image analyzer.
Synaptoneurosome preparation and western blot analysis
For synaptoneurosomal preparation 45–50 day old naive WT and GluD1 KO mice were anesthetized using isoflurane anesthesia, mice were then decapitated and thereafter all experimental procedures were conducted on ice. The amygdala and prefrontal cortex were crudely dissected out and put into synaptoneurosomal buffer at 4°C. Thereafter, the fresh tissue, amygdala and prefrontal cortex were used for synaptoneurosome preparation and western blotting.
The freshly isolated amygdala and prefrontal cortex from WT and GluD1 KO mice were homogenized in synaptoneurosome buffer (10 mM HEPES, 1 mM EDTA, 2 mM EGTA, 0.5 mM DTT, 10 µg/ml leupeptin, and 50 µg/ml soybean trypsin inhibitor, pH 7.0) as previously described
[39], additionally containing 5 mg/ml pepstatin, 50 mg/ml Aprotonin and 0.5 mM phenylmethanesulfonylfluoride (PMSF). From this step forward the homogenate was kept ice-cold at all times to minimize proteolysis throughout the isolation procedure. The homogenate was diluted further with the same volume of synaptoneurosome buffer and briefly and gently sonicated delivering 3 pulses using an output power of 1 Sonic dismembrator Model 100 (Fischer Scientific, NJ, USA). The sample was loaded into a 1.0 ml Luer-lock syringe (BD syringes) and filtered twice through three layers of a pre-wetted 100 µm pore nylon filter CMN-0105-D (Small Parts Inc., Logansport, IN, USA) held in a 13 mm diameter filter holder XX3001200 (Milipore, MA). The resulting filtrate was loaded into a 1 ml Luer-lock syringe and filtered through a pre-wetted 5 µm pore hydrophilic filter CMN-0005-D (Small Parts Inc., Logansport, IN, USA) held in a 13 mm diameter filter holder. The resulting filtrate was centrifuged at 1000× g for 10 min. The pellet obtained corresponded to the synaptoneurosome fraction. Isolated synaptoneurosomes were resuspended in 75 µl of buffer solution containing 0.32 M sucrose, and 1 mM NaHCO
3 (pH 7.0).
For western blotting synaptoneurosomes prepared from 45–50 day old naive WT and GluD1 KO mice were loaded on 10% Sodium dodecyl sulfate gel in equal amount (15 µg/well). The samples were run at 114 volts for a duration of 1 hr. Gels were transferred to nitrocellulose membrane (GE Healthcare, Piscataway, NJ, USA), a wet transfer was carried out. The voltage for transfer was kept at 114 volts and duration for which transfer was carried out was 1 hr 15 min. Electrophoresis and transfer apparatuses used were the Biorad mini protean tetra cell, from Bio-Rad Laboratories, Inc., Hercules, California, USA. Transfer was followed by blocking with 5% milk in Tris-buffered Saline with 1% Tween 20 (TBST) for 1 hr at room temperature. The primary antibodies GluA1 (Millipore, Billerica, MA, USA), 1
![[ratio]](/corehtml/pmc/pmcents/x2236.gif)
1500; GluA2 (Millipore), 1
2000; GluN2B (Millipore), 1
1000; GluK2 (Abcam, Cambridge, MA, USA), 1
1000; vesicular glutamate transporter 2 (vGluT2) (Millipore), 1
1000; glutamic acid decarboxylase 67 (GAD67) (Millipore), 1
1000; postsynaptic protein density 95 (PSD95) (Affinity Bioreagents, CO, USA), 1
2500 and Synaptophysin (Zymed, Carlsbad, CA, USA), 1
2500 were used and kept overnight for incubation at 4°C followed by washing and were incubated with horse-radish peroxidase conjugated anti-rabbit secondary antibody 1
5000; (Cell Signaling Technology, Danvers, MA, USA) for 1 hr at room temperature followed by washing with TBST. Blots were developed using enhanced chemiluminescent (ECL) Plus Western Blotting Detection System kit RPN2132 (GE Healthcare, Piscataway, NJ, USA) and images were taken using Precision Illuminator Model B95 (Imaging Research Inc., Germany) with a MTI CCD 72S camera and analyzed using MCID Basic software version 7.0 (Imaging Research, St. Catharines, ON, Canada). The X-ray film processor used was model- BMI No 122106 (Brown's Medical imaging, Omaha, NE, USA). For analysis of protein expression, first, the optical density of each sample was normalized to β-actin. Thereafter, the optical density was normalized to the mean of the WT samples. The average ± SEM of optical densities of GluD1 KO samples, that were normalized to WT mean, are represented as Ratio (KO/WT) ± SEM. The P values were calculated from optical densities of WT and GluD1 KO samples normalized to the WT mean.
Statistics
Data were analyzed using Student's unpaired t-test with Welch's correction (open field test, marble burying test, elevated plus maze test, forced swim test, sucrose preference test, resident-intruder test, sociability test, social novelty test, molecular changes in the amygdala and prefrontal cortex) or two-way ANOVA (analysis of variance) with Bonferroni's post-hoc test (lithium effect on open field test, forced swim test and resident-intruder test and DCS effect on sociability and social novelty test and protein expression in amygdala and prefrontal cortex). Differences were considered significant if P≤0.05. Prism 4 (GraphPad Software Inc., San Diego, CA, USA) was used for analysis and representation.
This article has been 
=
