PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Virology. Author manuscript; available in PMC 2013 March 30.
Published in final edited form as:
PMCID: PMC3289550
NIHMSID: NIHMS349010

Human Papillomavirus type 16 E6 and E 7 proteins alter NF-kB in cultured cervical epithelial cells and inhibition of NF-kB promotes cell growth and immortalization

Abstract

The NF-kB family of transcription factors regulates important biological functions including cell growth, survival and the immune response. We found that Human Papillomavirus type 16 (HPV-16) E7 and E6/E7 proteins inhibited basal and TNF-alpha-inducible NF-kB activity in human epithelial cells cultured from the cervical transformation zone, the anatomic region where most cervical cancers develop. In contrast, HPV-16 E6 regulated NF-kB in a cell type- and cell growth-dependent manner. NF-kB influenced immortalization of cervical cells by HPV16. Inhibition of NF-kB by an IkB alpha repressor mutant increased colony formation and immortalization by HPV-16. In contrast, activation of NF-kB by constitutive expression of p65 inhibited proliferation and immortalization. Our results suggest that inhibition of NF-kB by HPV-16 E6/E7 contributes to immortalization of cells from the cervical transformation zone.

Keywords: NF-kB, papillomavirus, immortalization, cervical cancer, transformation zone, oral epithelium, foreskin, defensins

INTRODUCTION

The major risk factor for cervical cancer is infection with a subset of high risk human papillomaviruses (HPV) including HPV type 16 (HPV-16). The HPV-16 E6 and E7 genes are important as they are selectively retained and expressed in most cervical cancers and they are sufficient to immortalize human epithelial cells (Munger et al., 1989). The E7 protein inactivates the retinoblastoma tumor suppressor protein and promotes cell cycle progression (Jones, Thompson, and Munger, 1997). E6 stimulates degradation of the p53 tumor suppressor protein (Scheffner et al., 1990) and contributes to immortalization by activating hTERT, the catalytic subunit of telomerase (Klingelhutz, Foster, and McDougall, 1996). In addition to effects on cell proliferation, HPV E6 and E7 proteins interfere with specific components the innate immune response (Chang and Laimins, 2000; Georgopoulos, Proffitt, and Blair, 2000; Hasan et al., 2007; Nees et al., 2001; Ronco et al., 1998; Woodworth and Simpson, 1993) which may contribute to persistent HPV infection. These interactions are important because persistent infection with high risk HPVs and immortalization of epithelial cells are early events in the development of cervical cancer.

The NF-kB family of transcription factors regulates multiple biological functions. NF-kB serves a major role in the inflammatory and innate immune responses by stimulating expression of cytokines, cytokine receptors, and histocompatibility genes (Hayden, West, and Ghosh, 2006). Several viruses have evolved mechanisms to regulate NF-kB, and activation or inhibition contributes to virus persistence, replication, or transformation of infected cells (Hiscott et al., 2006). NF-kB is active in epithelial cells of the cervix (Nees et al., 2001), and epithelial cells are an important component of the innate immune system.

NF-kB can function as an oncogene through its ability to stimulate cell proliferation and survival. NF-kB is constitutively activated in several human cancers (Karin, 2006; Li, Withoff, and Verma, 2005), including cancer of the cervix (Branca et al., 2006; Nair et al., 2003; Prusty, Husain, and Das, 2005). Activation of NF-kB promotes malignant development and progression in several animal models (Erez et al., 2010; Greten et al., 2004; Pikarsky et al., 2004) and NF-kB has been proposed to be an important link between chronic inflammation and cancer (Karin, 2009). Inhibition of NF-kB is a potential target for cancer therapy and chemoprevention (Baud and Karin, 2009). However, NF-kB can also act as a tumor suppressor in epidermal squamous cell carcinoma (Dajee et al., 2003; van Hogerlinden et al., 1999) and liver cancer (Maeda et al., 2005). We are interested in whether HPV infection alters NF-kB activation in human cervical epithelial cells and whether alterations in NF-kB contribute to cervical carcinogenesis.

The HPV-16 E6 and E7 proteins regulate NF-kB, but conflicting evidence exists as to whether they stimulate (Hussain et al., 2011; James, Lee, and Klingelhutz, 2006; Nees et al., 2001; Xu et al., 2010) or suppress activation (Havard et al., 2002; Havard et al., 2005; Huang and McCance, 2002; Perea, Massimi, and Banks, 2000; Spitkovsky et al., 2002). In this regard, the NF-kB activation pathway is dependent of the type of cell and context of the signal. Our first goal was to clarify how HPV-16 E6 and E7 proteins regulate NF-kB in epithelial cells cultured from the cervical transformation zone. These cells are the natural target for HPV infection and the progenitors for most cervical cancers (Burghardt and Ostor, 1983). The importance of NF-kB in the regulation of growth and immortalization of HPV-16 infected cervical cells is unclear. Our second goal was to determine whether inhibition or activation of NF-kB regulates cell proliferation or immortalization of epithelial cells from the cervical transformation zone by HPV-16.

RESULTS

Immortalization decreases NF-kB activity

We examined activation of NF-kB in human epithelial cells isolated from three anatomic regions of the cervix including ectocervix, endocervix and the transformation zone (Figure 1A). Most cervical cancers arise within the transformation zone (Burghardt and Ostor, 1983) where the columnar endocervical epithelium is replaced by metaplastic squamous epithelium. Cells cultured from each region demonstrated different morphology (Figure 1B) and grew well in monolayer culture. We used a reporter gene assay to compare NF-kB activity in the normal cells and five HPV-16-immortalized cervical cell lines (three from transformation zone cells, two from endocervical cells) that were derived after transfection with the complete HPV-16 genome. NF-kB activity was significantly higher (p ≤ 0.05) in early passage, unimmortalized cells from endocervix or the transformation zone than in ectocervical cells (Figure 2A). NF-kB activity decreased significantly (p ≤ 0.05) in each of the five HPV-16-immortalized cell lines compared to their respective normal cell type. We also examined whether expression of several NF-kB-responsive genes was down regulated in a subset of the immortalized cervical cell lines that had reduced NF-kB. RNAs for beta-defensins 1, 2, 3, and 5 were significantly decreased (p ≤ 0.05) in immortal cells (two from transformation zone and two from endocervix) with respect to normal cervical cells (Figure 2B). Thus, immortalization of cervical cells decreased NF-kB activity and expression of specific NF-kB-responsive genes.

Figure 1
Origin and morphology of cervical cell cultures. A. Schematic illustration showing the histology of the ectocervix, transformation zone (T-zone), and endocervix. B. Phase contrast micrograph of cervical cells from each region growing in monolayer culture. ...
Figure 2
Immortalization by HPV-16 decreases NF-kB activity and expression of β-defensins in cervical cells. A. Relative NF-kB activity in confluent cultures of primary cells derived from: endocervix (endo), transformation zone (TZ), ectocervix (ecto), ...

The HPV-16 E7 protein decreases NF-kB activity

The HPV-16 E6 and E7 proteins are necessary and sufficient for immortalization of primary epithelial cells. We examined whether E6, E7 or both were required for down regulation of NF-kB in epithelial cells cultured from the cervical transformation zone. Cultures of normal human cervical cells were infected with retroviruses encoding HPV-16 E6, E7, E6/E7 or vector only (control) and examined for NF-kB activity using a reporter gene assay. The results from a typical experiment are shown in Figure 3. NF-kB activity was significantly higher (p ≤ 0.05) in slowly growing confluent cultures than in rapidly growing sub confluent cultures. Treatment with TNF-α for 24 hours induced NF-kB under both conditions (Figure 3). The E7 and E6/E7 proteins significantly inhibited baseline NF-kB as well as TNF-α-induced NF-kB activation. However, the effects of E6 were variable (see below).

Figure 3
HPV-16 E6 and E7 proteins regulate baseline and TNF-α-inducible NF-kB in cells from cervical transformation zone. Typical reporter gene experiment showing relative NF-kB activity in cells infected with HPV-16 retroviruses and maintained under ...

Because the activity of NF-kB varied in cells cultured from different individuals and in different experiments, we performed four independent experiments using cells from the cervical transformation zones of different donors. Although our work focused on transformation zone cells, other cell types (endocervical, ectocervical, foreskin and oral epithelial cells) were used for comparison and to examine cell-type specific affects on NF-kB activation. The results of each experiment were normalized with respect to the internal control (vector only = 1). In both foreskin and cervical cells, the E7 protein reduced baseline NF-kB as well as TNF-α-inducible activity compared to the control (Figure 4). To examine the mechanism for down regulation of NF-kB, we used an HPV-16 E7 mutant that is defective in the ability to bind the retinoblastoma (Rb) protein (Edmonds and Vousden, 1989). Infection of cervical transformation zone cells with retroviruses encoding this mutant did not decrease basal or TNF-α-inducible NF-kB (Figure 5), indicating that the integrity of the Rb binding site on E7 is necessary for its ability to inhibit NF-kB.

Figure 4
HPV-16 E6 and E7 genes regulate NF-kB differently in cervical transformation zone cells (TZ) and foreskin cells maintained as growing or confluent cultures. NF-kB activation is shown relative to control (vector = 1) in cultures of cervical cells (top) ...
Figure 5
Down regulation of NF-kB by HPV-16 E7 depends upon inactivation of the Rb tumor suppressor protein. NF-kB activity relative to control (vector = 1) in confluent cervical cells from the transformation zone after infection with HPV-16 retroviruses that ...

The HPV-16 E6 protein regulates NF-kB in a cell-type and cell-growth dependent manner

In contrast to HPV-16 E7, the E6 protein did not significantly alter NF-kB activity in confluent cultures of cells from the cervical transformation zone or foreskin (Figure 4, left). However, E6 increased baseline and TNF-α-inducible NF-kB by two- to three-fold in rapidly growing foreskin cells (Figure 4, bottom right). The effect of E6 in proliferating foreskin cells was dominant over E7 because E6/E7 together also increased NF-kB (Figure 4, bottom right). In addition, the effect of E6 was dependent on cell type because E6 or E6/E7 did not significantly induce NF-kB in cells from the cervical transformation zone (Figure 4, top).

The HPV-16 E6/E7 proteins decrease NF-kB in different types of epithelial cells

HPV-16 infects epithelia from different anatomic sites. Therefore, we compared effects of HPV-16 E6/E7 proteins on cells derived from different types of epithelia including ectocervical, foreskin, oral, and transformation zone epithelium. Infection with E6/E7 reduced NF-kB activity consistently in confluent cultures of oral epithelial cells, foreskin cells and transformation zone cells (Figure 6) but not in cultures derived from ectocervical epithelium. In contrast, E6/E7 stimulated NF-kB in growing cultures of foreskin and ectocervical cells. Cells from the transformation zone were unique in that E6/E7 inhibited NF-kB under both confluent and growing conditions (Figure 6). Cells cultured from ectocervix or the transformation zone grew at approximately the same rate with a doubling time of 36 to 42 hours.

Figure 6
HPV-16 E6/E7 expression alters NF-kB activity relative to control (vector = 1) in cultures of growing or confluent cells from ectocervical epithelium (ecto), foreskin epithelium (HKC), oral epithelium, or the transformation zone (TZ). Bars indicate the ...

Regulation of clonal growth by NF-kB

NF-kB regulates a variety of pathways that control cell growth, survival, and gene expression. Because NF-kB is known to promote development and progression of cancer (Karin, 2006; Li, Withoff, and Verma, 2005), we hypothesized that reduced NF-kB would inhibit cell growth and immortalization of cervical transformation zone epithelial cells by HPV-16. To examine this hypothesis, we used a dominant negative mutant of IkBα (IkBαm) to inhibit activation (Van Antwerp et al., 1996). IkBαm lacks sites for phosphorylation by IkB kinase so it is not ubiquitinated and degraded. Therefore, active NF-kB subunits do not accumulate in the nucleus. We also used an expression vector for p65 to increase NF-kB activation. Primary cultures from the cervical transformation zone were cotransfected with the complete HPV-16 genome plus an expression vector for either IkBαm, p65 or the empty vector (pLZRS) as a negative control. Cells were selected for resistance to the antibiotic G418 (the HPV-16 plasmid contains the neomycin resistance gene) and then plated at clonal density to measure colony formation. We used a reporter gene assay to confirm that p65 stimulated NF-kB activity and that IkBαm inhibited NF-kB relative to the control pLZRS (Figure 7A).

Figure 7
Genetic manipulation of NF-kB influences growth of HPV-16 expressing cervical transformation zone cells. A. Transfection of cervical cells with a p65 expression construct or the IkBαm super repressor mutant activates or inhibits relative NF-kB ...

Unexpectedly, cells that were cotransfected with IkBαm plus HPV-16 formed larger and more numerous colonies than cells transfected with HPV-16 plus the pLZRS vector (Figure 7B). In contrast, cells cotransfected with HPV-16 plus the p65 expression vector formed fewer and smaller colonies, and cells grew slowly. In six independent experiments, IkBαm stimulated colony formation by two-fold and p65 inhibited colony formation by 70% (Figure 7C, HPV-16). To check our results, we used two additional assays involving (1) infection of normal cervical transformation zone cells with retroviruses encoding the HPV-16 E6/E7 genes and subsequent transfection with p65 or IkBαm and (2) transfection of seven different HPV-16 immortalized cell lines with p65 or IkBαm. In each assay, p65 expression significantly inhibited colony formation (p ≤ 0.05) and IkBαm significantly stimulated colony formation (Figure 7C).

HPV-16 induced immortalization is regulated by NF-kB

We examined whether immortalization of cells by the complete HPV-16 genome or the E6/E7 genes was influenced by NF-kB. Cells from the cervical transformation zone were (1) cotransfected with the complete HPV-16 genome plus either p65, IkBαm or the vector, or (2) infected with HPV-16 E6/E7 retroviruses then cotransfected with the puromycin resistance gene plus either IkBαm, p65 or vector. The negative control for immortalization consisted of cells that did not receive HPV-16 or E6/E7. Transfected or infected/transfected cultures were maintained in medium containing G418 / puromycin to select for stably transduced cells. The resulting colonies were pooled and subcultured repeatedly (usually two to three times) before the negative controls without HPV-16 became senescent.

In three independent experiments using cells from different individuals, IkBαm increased the percentage of cultures that contained immortal cells (Table 1). This was true for immortalization by the complete HPV16 genome or retrovirus infection with E6/E7. In contrast, p65 inhibited immortalization by HPV-16 or the E6/E7 genes. To examine whether the effects of NF-kB on immortalization were specific for HPV-16, we also performed immortalization assays after transfection with Simian Virus 40 (SV40) DNA (Woodworth, Secott, and Isom, 1986). SV40 is a DNA tumor virus that resembles HPV-16 because both inactivate the retinoblastoma and p53 tumor suppressor proteins. In three independent experiments, expression of IkBαm significantly increased immortalization of cervical transformation zone cells by SV40 and the p65 expression vector decreased immortalization (Table 1). When data for HPV-16, E6/E7 retrovirus infection, and SV40 were combined, p65 inhibited immortalization strongly (p ≤ 0.001) and IkBαm stimulated immortalization strongly (p ≤ 0.001) relative to the vector-only control. These results indicate that activation of NF-kB inhibits immortalization, but that inhibition is not specific for HPV-16.

Table 1
Effect of p65 or IkBαm on the frequency of immortalization of human cervical cells by the complete HPV-16 genome, HPV16 E6/E7 genes, or SV40

P65 inhibits expression from the HPV-16 long control region (LCR)

Continuous expression of the HPV-16 E6 and E7 genes is required for immortalization (von Knebel Doeberitz et al., 1992), and expression of E6/E7 is regulated by promoters and enhancers located within the LCR, a short sequence of DNA that is upstream of E6. We used a reporter gene assay to examine whether cotransfection with p65 or IkBαm regulated expression of a luciferase reporter gene driven by the HPV-16 LCR. Transfection of normal cervical transformation zone cells with p65 stimulated NF-kB strongly and inhibited expression from the HPV-16 LCR by 60% (Figure 8). Transfection with IkBαm decreased NF-kB but it did not alter HPV-16 LCR activity. These results suggest that p65 inhibits immortalization in part by decreasing HPV gene expression, but they do not provide evidence that IkBαm stimulates immortalization by increasing HPV expression.

Figure 8
Stimulation of NF-kB activity by transfection with p65 causes decreased expression from the HPV-16 LCR. Normal cervical transformation zone cells were cotransfected with p65, IkBαm or vector (control) plus a reporter gene for either NF-kB (left) ...

DISCUSSION

Persistent infection with high-risk HPVs and immortalization of epithelial cells are important early events in the development of cervical cancer. We found that HPV-16 E6 and E7 proteins inhibited NF-kB activity in cells cultured from the cervical transformation zone, the region where most cervical carcinomas develop. NF-kB serves an important role in the host immune response. Down regulation of NF-kB might represent a unique mechanism by which HPV interferes with innate immunity and promotes persistent infection. We also found that inhibition of NF-kB stimulated HPV-16-induced cell proliferation and immortalization of cells from the transformation zone. Thus, NF-kB has the potential to act as a tumor suppressor in cervical cells.

The HPV-16 E7 and E6/E7 proteins inhibited basal and TNF-α-inducible NF-kB activity in cells from the transformation zone. Furthermore, immortalization by HPV-16 decreased expression of several β-defensins that are NF-kB-inducible cationic peptides that contribute to innate immunity (Diamond, Beckloff, and Ryan, 2008). HPV-16 is known to interfere with specific NF-kB-responsive pathways that are important for immunity including expression of major histocompatibility genes (Georgopoulos, Proffitt, and Blair, 2000), Toll-like receptor-9 (Hasan et al., 2007), and interferons (Nees et al., 2001; Ronco et al., 1998). The ability of HPV-16 E6/E7 to decrease NF-kB activation is a common denominator that might contribute to each of these responses. Our observation that inhibition NF-kB was dependent on the Rb binding domain of E7 is consistent with the fact that Rb is important for NF-kB activation and that adenovirus E1A inhibits NF-kB in an Rb-dependent manner (Cook et al., 2002; Takebayashi et al., 2003).

In contrast, we observed that HPV-16 E6 altered NF-kB in a cell type- and cell growth-dependent manner. E6 and E6/E7 stimulated activation in foreskin and ectocervical cells that were rapidly growing. However, E6 and E6/E7 were less effective in cells from the transformation zone or in slowly growing cultures. Our results are consistent with the fact that NF-kB regulation is often dependent on cell-type and context (Hinata et al., 2003). Conflicting evidence exists about whether HPV-16 stimulates (Hussain et al., 2011; James, Lee, and Klingelhutz, 2006; Nees et al., 2001; Xu et al., 2010) or suppresses activation of NF-kB (Huang and McCance, 2002; Perea, Massimi, and Banks, 2000; Spitkovsky et al., 2002). Our observations help to clarify these results by showing that growth rate and cell type are important determinants of whether HPV-16 E6 or E6/E7 stimulate or inhibit NF-kB. The mechanism by which E6 activates NF-kB is incompletely understood. The E6 protein reduces levels of the p53 tumor suppressor protein (Scheffner et al., 1990), and p53 decreases NF-kB activation (Webster and Perkins, 1999). In addition, the ability of the E6 protein to activate the transcriptional regulator NFX1-91 or to target PDZ domains may also be important (James, Lee, and Klingelhutz, 2006; Xu et al., 2010).

Chronic inflammation and activation of NF-kB contribute to several types of human cancer (Karin, 2009). NF-kB is constitutively activated in high grade squamous intraepithelial neoplasia and cervical cancer (Branca et al., 2006; Nair et al., 2003; Prusty, Husain, and Das, 2005). However, we observed that expression of HPV-16 E6/E7 and cell immortalization inhibited NF-kB in cells from the cervical transformation zone. This suggests that activation of NF-kB during cervical carcinogenesis may not be autonomous for epithelial cells. Instead, activation may result from changes in the tumor microenvironment such as the presence of chronic inflammatory cells and activated fibroblasts (Greten et al., 2004; Pikarsky et al., 2004). The latter are known to promote inflammation and tumor formation in an NF-kB-dependent manner in an HPV-16 transgenic mouse model (Erez et al., 2010).

NF-kB stimulates cell growth and survival and can function as an oncogene. Inhibitors of NF-kB sensitize cervical cancer cells to apoptosis (Venkatraman et al., 2005). Therefore, we originally hypothesized that activation of NF-kB would stimulate cell growth and immortalization. However, we observed the opposite. We found that activation of NF-kB in normal cervical cells inhibited clonal growth and immortalization by HPV-16. Similarly, inhibition of NF-kB by dominant negative IkBαm stimulated clonal growth and the frequency of immortalization. Stimulation was observed using the complete HPV-16 genome, the E6/E7 genes, or the tumor virus SV40. This indicates that effects of IkBαm and p65 are not specific for cells expressing HPV-16. Our results are consistent with the observation that p65 inhibits growth of normal human keratinocytes (Seitz et al., 1998) and that inhibition of NF-kB promotes epidermal carcinogenesis in mice (Dajee et al., 2003; van Hogerlinden et al., 1999). The apparent difference in NF-kB responsiveness between normal and cancerous cervical cells is potentially important, although our experiments did not address this question.

The mechanism(s) by which NF-kB inhibits cell growth and immortalization of normal cervical cells is incompletely understood. Expression of the HPV-16 E6 and E7 genes is required for continued growth of cervical carcinoma cells and HPV-immortal cell lines (von Knebel Doeberitz et al., 1992). The HPV-16 LCR contains a binding site for NF-kB (Fontaine et al., 2000) and we found that p65 inhibited expression from the HPV-16 LCR in a reporter gene assay. This suggests that one mechanism by which NF-kB activation might inhibit growth and immortalization is by decreasing HPV gene expression. However, we also found that the IkBαm did not stimulate HPV-16 LCR activity. Thus, decreased NF-kB does not appear to promote growth and immortalization by stimulating HPV-16 gene expression. Additional mechanisms might contribute to the ability of NF-kB to inhibit cell growth and immortalization. Activation of NF-kB signaling promotes cell senescence (Rovillain et al., 2011) and NF-kB RelA opposes epidermal proliferation driven by TNFR1 and JNK (Zhang et al., 2004).

Conclusions

We show that HPV-16 E6 and E7 proteins inhibit basal and TNF-α-inducible NF-kB activity in cells of the cervical transformation zone where most cervical cancers develop. Decreased NF-kB activation might represent a unique mechanism for the virus to interfere with the host immune response and promote persistent infection. We also show that down regulation of NF-kB stimulates clonal growth and immortalization of cervical epithelial cells. NF-kB is a potential target for cancer chemoprevention and therapy. Our observations raise concerns about chronic suppression of NF-kB in patients who have an increased risk for cervical cancer.

MATERIALS AND METHODS

Cell culture

Samples of cervical and oral epithelial tissue were obtained from patients with non malignant disease by the Cooperative Human Tissue Network. Cell cultures from endocervix, ectocervix or the transformation zone were isolated and identified as described (Woodworth and Simpson, 1993). Foreskins were obtained from the nursery of the local hospital. All tissues were collected in RPMI medium with 10% fetal bovine serum plus antibiotics and used within 24 hours. Epithelial cells were isolated using a two step enzymatic digestion (Woodworth and Simpson, 1993). Briefly, each tissue was digested for 16 hours at 4°C in dispase (BD Biosciences) and the epithelium was removed from the underlying connective tissue by scraping. The epithelial sheet was cut into 1mm2 pieces and digested in 0.25% trypsin at 37°C for 10 minutes. Trypsin was neutralized by addition of fetal bovine serum and cells were collected by centrifugation at 2000×g. Normal epithelial cells, HPV-16 immortalized cells (Woodworth et al., 1990) and cervical carcinoma cell lines (Woodworth et al., 1995) were cultured in Keratinocyte Serum-Free Medium (KSFM, Invitrogen).

Retrovirus infection with HPV-16 genes

HPV genes were introduced into cultured cervical cells by infection with recombinant HPV-16 retroviruses (Halbert, Demers, and Galloway, 1991). Secondary cultures were infected with high-titer retroviruses as described (Woodworth et al., 1992) encoding HPV-16 E6, E7, or E6/E7 genes inserted into the vector pLXSN, which contains the neomycin resistance gene. Retroviruses containing the p24gly mutant (Edmonds and Vousden, 1989) have been described (Nees et al., 2001). Infection was performed for 3 hours in medium with 10 ng/ml polybrene with rocking every 15 minutes. Subsequently, medium was changed and cells grew for 24 hours before cultures were split 1:3. After 24 hours, infected cells were selected by growth for 2 days in KSFM containing 200μg/ml G418 and used immediately.

Dual luciferase reporter gene assay

Cells were grown in 12 well plates and cotransfected with lipofectamine (Invitrogen) for 3 hours using either 0.5 μg of the NF-kB responsive firefly luciferase reporter gene (Clontech) or the HPV-16 LCR firefly luciferase reporter gene (Khan et al., 1997), and 0.25 μg of a renilla luciferase reporter gene (Clontech). The latter promoter has weak activity and served as an internal control for transfection efficiency. Transfected cultures were maintained in KSFM for 24 hours prior to measuring NF-kB activity using a dual luciferase assay (Promega). Each transfection was performed in triplicate, and transfection experiments were repeated at least 3 times using cells from different donors. Positive and negative controls for NF-kB activation included cotransfection with a p65 expression vector (Seitz et al., 1998) or a vector containing the IKBαm dominant negative mutant (Van Antwerp et al., 1996), respectively.

Immortalization assay

Immortalization assays were performed after transfection with plasmid pMHPV16d containing the complete HPV-16 genome (Woodworth et al., 1988), the complete SV40 genome (Woodworth, Secott, and Isom, 1986), or infection with HPV-16 E6/E7 retroviruses (Woodworth et al., 1992). For retrovirus-based assays, E6/E7-infected cells were subsequently cotransfected with the puromycin resistance gene (Clontech) plus either p65, IkBαm, or the empty vector pLZRS. After 24 hours, cells were subcultured (6 × 60mm dishes experimental group) in KSFM containing 10 ng/ml puromycin for 2 days. Cells infected with retroviruses containing only the pLXSN vector (lacking HPV-16 genes) served as the negative control for immortalization. For transfection-based immortalization assays, cultures were cotransfected with pMHPV16d plus the neomycin resistance gene, and either p65, IkBαm, or pLZRS (vector). After selection for stably transfected cells using G418, cultures were fed with fresh KSFM every two days. Immortalization was measured by pooling the colonies in each dish and subculturing cells continually. Cells transfected with the neomycin resistance gene alone served as a negative control for immortalization. These cells became senescent after 2 or 3 additional passages. Cells transfected with a plasmid encoding the SV40 genome served as a control for determining specificity of effects for HPV-16.

Clonal growth assay

Cells were stably transduced with HPV-16 DNA or E6/E7 retroviruses plus p65, IkBαm or pLZRS expression plasmids as described for immortalization assays. Cultures were maintained in KSFM for 14 days (retrovirus-infected) or 21 days (transfected). After colonies became visible, dishes were fixed with formalin and stained with Giemsa to identify colonies. A colony was defined as 50 or more cells.

Real time RT-PCR

RNA was extracted from five different primary cervical cultures and four HPV-immortalized cell lines using Trizol (Invitrogen). Cellular DNA was removed using Turbo RNA-Free DNAse (Ambion) and RNA was reverse transcribed using Superscript First Strand kit (Invitrogen). No RT controls were included to confirm absence of cell DNA. Real-time PCR was performed using an iCycler IQ (Bio-Rad) using triplicate reactions (50μl) containing 25μl of 2× SYBR-Green Supermix, 0.4μM of each forward and reverse primer, and 1 μl cDNA. Primers were: human β-defensin-1 forward GGGAGTGACCAGAAGAAATGA and reverse TTGGCCCAAAGGAGGTAT, human β-defensin-2 forward CTGGAACAAAATGCTGCAAA and reverse TGGTTTACATGTCGCACGTC, human β-defensin-3 forward TCCAAAGGAGGAACAGATCG and reverse GGCATTTCCACACTTTACAACA, human β-defensin-5 forward TGTCTGTGAGTCGTGCAAGC and reverse CTGCAGCAGAGAAAGTTCAGC, human β-defensin-7 forward AGGTCACTGTGAAGCCGAAT and reverse GCAGCCAGAGAATCTTCACC, β-actin forward GGACTTCGAGCAAGAGATGG and reverse AGCACTGTGTTGGCGTACCAG, and RPL38 forward CGAAAGGATGCCGGGTCTGT and reverse TCAGTTCCTTCACTGCCAA. Reactions were performed for 40 cycles and melting temperature analysis was conducted on each sample to check specificity of product. Relative expression was calculated using the Pfaffl method (Pfaffl, 2001). Housekeeping genes (β-actin, and RPL38) were examined for normalization and β-actin was chosen because immortalization did not alter expression.

Statistical analysis

One way analysis of variance (ANOVA) was used to compare the means of multiple experimental groups when data was distributed normally, and the Kruskal-Wallis test was used for comparisons when the distribution was not normal. Tukey's multiple comparison test was used to compare differences between each pair of means.

HIGHLIGHTS

We examined the effect on HPV-16 E6 and E7 on NF-kB activity. > E7 inhibited NF-kB. > E6 altered NF-kB in a cell type and cell growth dependent manner > Inhibition of NF-kB increased immortalization by HPV-16 E6/E7 > Activation of NF-kB decreased immortalization.

ACKNOWLEDGEMENTS

We thank Dr. Lucia Pirisi for providing the HPV-16 LCR reporter gene, Dr. Harriet Isom for the SV40 expression vector, and Dr. Paul Khavari for the vectors containing p65 and the IkBα dominant negative mutant. Samples of human cervical and oral epithelial tissue were obtained from the Cooperative Human Tissue Network. This work was supported by National Cancer Institute awards 1R15CA101873-01 and 1R15CA126855-01.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

REFERENCES

  • Baud V, Karin M. Is NF-kappaB a good target for cancer therapy? Hopes and pitfalls. Nat Rev Drug Discov. 2009;8(1):33–40. [PMC free article] [PubMed]
  • Branca M, Giorgi C, Ciotti M, Santini D, Di Bonito L, Costa S, Benedetto A, Bonifacio D, Di Bonito P, Paba P, Accardi L, Mariani L, Ruutu M, Syrjanen S, Favalli C, Syrjanen K. Upregulation of nuclear factor-kappaB (NF-kappaB) is related to the grade of cervical intraepithelial neoplasia, but is not an independent predictor of high-risk human papillomavirus or disease outcome in cervical cancer. Diagn Cytopathol. 2006;34(8):555–63. [PubMed]
  • Burghardt E, Ostor AG. Site and origin of squamous cervical cancer: a histomorphologic study. Obstet Gynecol. 1983;62(1):117–27. [PubMed]
  • Chang YE, Laimins LA. Microarray analysis identifies interferon-inducible genes and Stat-1 as major transcriptional targets of human papillomavirus type 31. J Virol. 2000;74(9):4174–82. [PMC free article] [PubMed]
  • Cook JL, Walker TA, Worthen GS, Radke JR. Role of the E1A Rb-binding domain in repression of the NF-kappa B-dependent defense against tumor necrosis factor-alpha. Proc Natl Acad Sci U S A. 2002;99(15):9966–71. [PubMed]
  • Dajee M, Lazarov M, Zhang JY, Cai T, Green CL, Russell AJ, Marinkovich MP, Tao S, Lin Q, Kubo Y, Khavari PA. NF-kappaB blockade and oncogenic Ras trigger invasive human epidermal neoplasia. Nature. 2003;421(6923):639–43. [PubMed]
  • Diamond G, Beckloff N, Ryan LK. Host defense peptides in the oral cavity and the lung: similarities and differences. J Dent Res. 2008;87(10):915–27. [PMC free article] [PubMed]
  • Edmonds C, Vousden KH. A point mutational analysis of human papillomavirus type 16 E7 protein. J Virol. 1989;63(6):2650–6. [PMC free article] [PubMed]
  • Erez N, Truitt M, Olson P, Arron ST, Hanahan D. Cancer-Associated Fibroblasts Are Activated in Incipient Neoplasia to Orchestrate Tumor-Promoting Inflammation in an NF-kappaB-Dependent Manner. Cancer Cell. 2010;17(2):135–47. [PubMed]
  • Fontaine V, van der Meijden E, de Graaf J, ter Schegget J, Struyk L. A functional NF-kappaB binding site in the human papillomavirus type 16 long control region. Virology. 2000;272(1):40–9. [PubMed]
  • Georgopoulos NT, Proffitt JL, Blair GE. Transcriptional regulation of the major histocompatibility complex (MHC) class I heavy chain, TAP1 and LMP2 genes by the human papillomavirus (HPV) type 6b, 16 and 18 E7 oncoproteins. Oncogene. 2000;19(42):4930–5. [PubMed]
  • Greten FR, Eckmann L, Greten TF, Park JM, Li ZW, Egan LJ, Kagnoff MF, and Karin M. IKKbeta links inflammation and tumorigenesis in a mouse model of colitis-associated cancer. Cell. 2004;118(3):285–96. [PubMed]
  • Halbert CL, Demers GW, Galloway DA. The E7 gene of human papillomavirus type 16 is sufficient for immortalization of human epithelial cells. J Virol. 1991;65(1):473–8. [PMC free article] [PubMed]
  • Hasan UA, Bates E, Takeshita F, Biliato A, Accardi R, Bouvard V, Mansour M, Vincent I, Gissmann L, Iftner T, Sideri M, Stubenrauch F, Tommasino M. TLR9 expression and function is abolished by the cervical cancer-associated human papillomavirus type 16. J Immunol. 2007;178(5):3186–97. [PubMed]
  • Havard L, Delvenne P, Frare P, Boniver J, Giannini SL. Differential production of cytokines and activation of NF-kappaB in HPV-transformed keratinocytes. Virology. 2002;298(2):271–85. [PubMed]
  • Havard L, Rahmouni S, Boniver J, Delvenne P. High levels of p105 (NFKB1) and p100 (NFKB2) proteins in HPV16-transformed keratinocytes: role of E6 and E7 oncoproteins. Virology. 2005;331(2):357–66. [PubMed]
  • Hayden MS, West AP, Ghosh S. NF-kappaB and the immune response. Oncogene. 2006;25(51):6758–80. [PubMed]
  • Hinata K, Gervin AM, Jennifer Zhang Y, Khavari PA. Divergent gene regulation and growth effects by NF-kappa B in epithelial and mesenchymal cells of human skin. Oncogene. 2003;22(13):1955–64. [PubMed]
  • Hiscott J, Nguyen TL, Arguello M, Nakhaei P, Paz S. Manipulation of the nuclear factor-kappaB pathway and the innate immune response by viruses. Oncogene. 2006;25(51):6844–67. [PubMed]
  • Huang SM, McCance DJ. Down regulation of the interleukin-8 promoter by human papillomavirus type 16 E6 and E7 through effects on CREB binding protein/p300 and P/CAF. J Virol. 2002;76(17):8710–21. [PMC free article] [PubMed]
  • Hussain I, Fathallah I, Accardi R, Yue J, Saidj D, Shukla R, Hasan U, Gheit T, Niu Y, Tommasino M, Sylla BS. NF-{kappa}B protects HPV38E6/E7-immortalized human keratinocyte against TNF-{alpha} and UV-mediated apoptosis. J Virol. 2011
  • James MA, Lee JH, Klingelhutz AJ. Human papillomavirus type 16 E6 activates NF-kappaB, induces cIAP-2 expression, and protects against apoptosis in a PDZ binding motif-dependent manner. J Virol. 2006;80(11):5301–7. [PMC free article] [PubMed]
  • Jones DL, Thompson DA, Munger K. Destabilization of the RB tumor suppressor protein and stabilization of p53 contribute to HPV type 16 E7-induced apoptosis. Virology. 1997;239(1):97–107. [PubMed]
  • Karin M. Nuclear factor-kappaB in cancer development and progression. Nature. 2006;441(7092):431–6. [PubMed]
  • Karin M. NF-kappaB as a critical link between inflammation and cancer. Cold Spring Harb Perspect Biol. 2009;1(5):a000141. [PMC free article] [PubMed]
  • Khan MA, Canhoto AJ, Housley PR, Creek KE, Pirisi L. Glucocorticoids stimulate growth of human papillomavirus type 16 (HPV16)-immortalized human keratinocytes and support HPV16-mediated immortalization without affecting the levels of HPV16 E6/E7 mRNA. Exp Cell Res. 1997;236(1):304–10. [PubMed]
  • Klingelhutz AJ, Foster SA, McDougall JK. Telomerase activation by the E6 gene product of human papillomavirus type 16. Nature. 1996;380(6569):79–82. [PubMed]
  • Li Q, Withoff S, Verma IM. Inflammation-associated cancer: NF-kappaB is the lynchpin. Trends Immunol. 2005;26(6):318–25. [PubMed]
  • Maeda S, Kamata H, Luo JL, Leffert H, Karin M. IKKbeta couples hepatocyte death to cytokine-driven compensatory proliferation that promotes chemical hepatocarcinogenesis. Cell. 2005;121(7):977–90. [PubMed]
  • Munger K, Phelps WC, Bubb V, Howley PM, Schlegel R. The E6 and E7 genes of the human papillomavirus type 16 together are necessary and sufficient for transformation of primary human keratinocytes. J Virol. 1989;63(10):4417–21. [PMC free article] [PubMed]
  • Nair A, Venkatraman M, Maliekal TT, Nair B, Karunagaran D. NF-kappaB is constitutively activated in high-grade squamous intraepithelial lesions and squamous cell carcinomas of the human uterine cervix. Oncogene. 2003;22(1):50–8. [PubMed]
  • Nees M, Geoghegan JM, Hyman T, Frank S, Miller L, Woodworth CD. Papillomavirus type 16 oncogenes downregulate expression of interferon-responsive genes and upregulate proliferation-associated and NF-kappaB-responsive genes in cervical keratinocytes. J Virol. 2001;75(9):4283–96. [PMC free article] [PubMed]
  • Perea SE, Massimi P, Banks L. Human papillomavirus type 16 E7 impairs the activation of the interferon regulatory factor-1. Int J Mol Med. 2000;5(6):661–6. [PubMed]
  • Pfaffl MW. A new mathematical model for relative quantification in real-time RTPCR. Nucleic Acids Res. 2001;29(9):e45. [PMC free article] [PubMed]
  • Pikarsky E, Porat RM, Stein I, Abramovitch R, Amit S, Kasem S, Gutkovich-Pyest E, Urieli-Shoval S, Galun E, Ben-Neriah Y. NF-kappaB functions as a tumour promoter in inflammation-associated cancer. Nature. 2004;431(7007):461–6. [PubMed]
  • Prusty BK, Husain SA, Das BC. Constitutive activation of nuclear factor -kB: preferntial homodimerization of p50 subunits in cervical carcinoma. Front Biosci. 2005;10:1510–9. [PubMed]
  • Ronco LV, Karpova AY, Vidal M, Howley PM. Human papillomavirus 16 E6 oncoprotein binds to interferon regulatory factor-3 and inhibits its transcriptional activity. Genes Dev. 1998;12(13):2061–72. [PubMed]
  • Rovillain E, Mansfield L, Caetano C, Alvarez-Fernandez M, Caballero OL, Medema RH, Hummerich H, Jat PS. Activation of nuclear factor-kappa B signalling promotes cellular senescence. Oncogene. 2011;30(20):2356–66. [PMC free article] [PubMed]
  • Scheffner M, Werness BA, Huibregtse JM, Levine AJ, Howley PM. The E6 oncoprotein encoded by human papillomavirus types 16 and 18 promotes the degradation of p53. Cell. 1990;63(6):1129–36. [PubMed]
  • Seitz CS, Lin Q, Deng H, Khavari PA. Alterations in NF-kappaB function in transgenic epithelial tissue demonstrate a growth inhibitory role for NF-kappaB. Proc Natl Acad Sci U S A. 1998;95(5):2307–12. [PubMed]
  • Spitkovsky D, Hehner SP, Hofmann TG, Moller A, Schmitz ML. The human papillomavirus oncoprotein E7 attenuates NF-kappa B activation by targeting the Ikappa B kinase complex. J Biol Chem. 2002;277(28):25576–82. [PubMed]
  • Takebayashi T, Higashi H, Sudo H, Ozawa H, Suzuki E, Shirado O, Katoh H, Hatakeyama M. NF-kappa B-dependent induction of cyclin D1 by retinoblastoma protein (pRB) family proteins and tumor-derived pRB mutants. J Biol Chem. 2003;278(17):14897–905. [PubMed]
  • Van Antwerp DJ, Martin SJ, Kafri T, Green DR, Verma IM. Suppression of TNF-alpha-induced apoptosis by NF-kappaB. Science. 1996;274(5288):787–9. [PubMed]
  • van Hogerlinden M, Rozell BL, Ahrlund-Richter L, Toftgard R. Squamous cell carcinomas and increased apoptosis in skin with inhibited Rel/nuclear factor-kappaB signaling. Cancer Res. 1999;59(14):3299–303. [PubMed]
  • Venkatraman M, Anto RJ, Nair A, Varghese M, Karunagaran D. Biological and chemical inhibitors of NF-kappaB sensitize SiHa cells to cisplatin-induced apoptosis. Mol Carcinog. 2005;44(1):51–9. [PubMed]
  • von Knebel Doeberitz M, Rittmuller C, zur Hausen H, Durst M. Inhibition of tumorigenicity of cervical cancer cells in nude mice by HPV E6-E7 anti-sense RNA. Int J Cancer. 1992;51(5):831–4. [PubMed]
  • Webster GA, Perkins ND. Transcriptional cross talk between NF-kappaB and p53. Mol Cell Biol. 1999;19(5):3485–95. [PMC free article] [PubMed]
  • Woodworth C, Secott T, Isom HC. Transformation of rat hepatocytes by transfection with simian virus 40 DNA to yield proliferating differentiated cells. Cancer Res. 1986;46(8):4018–26. [PubMed]
  • Woodworth CD, Bowden PE, Doniger J, Pirisi L, Barnes W, Lancaster WD, DiPaolo JA. Characterization of normal human exocervical epithelial cells immortalized in vitro by papillomavirus types 16 and 18 DNA. Cancer Res. 1988;48(16):4620–8. [PubMed]
  • Woodworth CD, Cheng S, Simpson S, Hamacher L, Chow LT, Broker TR, DiPaolo JA. Recombinant retroviruses encoding human papillomavirus type 18 E6 and E7 genes stimulate proliferation and delay differentiation of human keratinocytes early after infection. Oncogene. 1992;7(4):619–26. [PubMed]
  • Woodworth CD, McMullin E, Iglesias M, Plowman GD. Interleukin 1 alpha and tumor necrosis factor alpha stimulate autocrine amphiregulin expression and proliferation of human papillomavirus-immortalized and carcinoma-derived cervical epithelial cells. Proc Natl Acad Sci U S A. 1995;92(7):2840–4. [PubMed]
  • Woodworth CD, Simpson S. Comparative lymphokine secretion by cultured normal human cervical keratinocytes, papillomavirus-immortalized, and carcinoma cell lines. Am J Pathol. 1993;142(5):1544–55. [PubMed]
  • Woodworth CD, Waggoner S, Barnes W, Stoler MH, DiPaolo JA. Human cervical and foreskin epithelial cells immortalized by human papillomavirus DNAs exhibit dysplastic differentiation in vivo. Cancer Res. 1990;50(12):3709–15. [PubMed]
  • Xu M, Katzenellenbogen RA, Grandori C, Galloway DA. NFX1 plays a role in human papillomavirus type 16 E6 activation of NFkappaB activity. J Virol. 2010;84(21):11461–9. [PMC free article] [PubMed]
  • Zhang JY, Green CL, Tao S, Khavari PA. NF-kappaB RelA opposes epidermal proliferation driven by TNFR1 and JNK. Genes Dev. 2004;18(1):17–22. [PubMed]