PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Cell Metab. Author manuscript; available in PMC 2013 February 8.
Published in final edited form as:
PMCID: PMC3280886
NIHMSID: NIHMS351597

Increased expression of NAD(P)H oxidase subunit p67phox in the renal medulla contributes to excess oxidative stress and salt-sensitive hypertension

SUMMARY

NAD(P)H oxidase has been shown to be important in the development of salt-sensitive hypertension. Here we show that the expression of a subunit of NAD(P)H oxidase, p67phox, was increased in response to a high salt diet in the outer renal medulla of the Dahl salt-sensitive (SS) rat, an animal model for human salt-sensitive hypertension. The higher expression of p67phox, not the other subunits observed, was associated with higher NAD(P)H oxidase activity and salt-sensitivity in SS rats compared with a salt-resistant strain. Genetic mutations of the SS allele of p67phox were found in the promoter region and contributed to higher promoter activity than that of the salt-resistant strain. To verify the importance of p67phox, we disrupted p67phox in SS rats using zinc finger nucleases technology. These rats exhibited a significant reduction of salt-sensitive hypertension and renal medullary oxidative stress and injury. p67phox could represent a target for salt-sensitive hypertension therapy.

INTRODUCTION

Essential hypertension is a multifactorial disease affecting nearly 27% of the world population (Kearney et al., 2005) and is a major risk factor for stroke, heart failure, and end-stage renal disease. Excess dietary salt intake is an important environmental factor in the etiology of hypertension, and the susceptibility of individuals to salt intake (salt-sensitivity) is, in part, genetically determined. Therefore, it is of great interest to identify genes contributing to salt-sensitivity.

The Dahl salt-sensitive (SS) rat, which shares many phenotypic traits seen in African American hypertensive patients (Cowley and Roman, 1996; Cowley et al., 2001; Jones et al., 2002; Rostand et al., 1982), has been used extensively to dissect the genetic complexity and related mechanisms contributing to salt-sensitive hypertension. Our interest in p67phox, one of the cytosolic subunits of NAD(P)H oxidase, resulted from characterizing a panel of congenic strains derived from the SS rat and the salt-resistant Brown Norway (BN) rat (Moreno et al., 2007). One of the congenic strains, SS.13BN26, containing a 12.2 megabase (Mb) genomic region from the BN rat substituted into Chromosome 13 of SS rats, was found to have a significant reduction of salt-sensitive hypertension and renal injury compared with the SS rat (Lu et al., 2010). p67phox was found to be located in the BN introgressed region of this congenic strain.

For many decades, the only pathological condition in which NAD(P)H oxidase was recognized to be of importance was chronic granulomatous disease (Kuhns et al., 2010). It is now recognized that this enzyme also plays an important role in the development and progression of cardiovascular disease (Brandes et al., 2010), including hypertension (Landmesser et al., 2002; Laursen et al., 1997; Rajagopalan et al., 1996). NAD(P)H oxidase is a multi-subunit enzyme comprised of the membrane subunits gp91phox and p22phox and the cytosolic subunits p47phox, p67phox, p40phox, and Rac 1 or 2 (Paravicini and Touyz, 2008). All of the cytosolic subunits assemble on the membrane upon activation, allowing the enzyme to generate superoxide (O2.−). Most functional studies concerning the role of this enzyme in hypertension have focused on the central nervous system (Huang et al., 2006) and peripheral vasculature (Drummond et al., 2011). However, there is evidence that NAD(P)H oxidase contributes to oxidative stress that occurs in the renal outer medulla (OM) with increased salt intake in SS rats (Taylor et al., 2006). Direct interstitial infusion of an NAD(P)H oxidase inhibitor apocynin into the OM of SS rats attenuated salt-sensitive hypertension by nearly 50%. Since p67phox is the only known NAD(P)H oxidase subunit located in the introgressed region of congenic SS.13BN26, we determined whether genetic variances in p67phox of the SS rat could increase expression of the gene and thereby upregulate the activity of the enzyme, contributing to increased salt-sensitivity in SS rats. We then generated a p67phox null mutant (p67phox−/−) rat and demonstrated that disruption of p67phox in SS rats reduced salt-sensitive hypertension and renal oxidative stress and injury.

RESULTS

Genetic variances in the promoter region of p67phox affect promoter activity and gene expression

We performed real time quantitative reverse transcription PCR (qRT-PCR) to analyze mRNA expression of p67phox. Rats were fed on a 0.4% NaCl diet (low salt: LS) since weaning. At 6 weeks of age, a subgroup of these rats was switched to an 8% NaCl diet (high salt: HS). Outer medullary tissue was collected from rats on the LS diet and from rats on the HS diet 7 days after their diets were switched. The average mRNA levels of p67phox were increased in both the SS rat and congenic SS.13BN26 after the diet was switched from LS to HS. The mRNA levels of p67phox were significantly higher in SS rats than in SS.13BN26 rats on both the LS diet and day 7 of the HS diet (Figure 1A).

Figure 1
Genetic variances in the promoter region of p67phox affect promoter activity and gene expression. (A) Quantitative real-time PCR of p67phox of rats (N=6 per strain at each time point) on both 0.4% low salt (LS), and day 7 of 8% high salt (D7-HS). * p< ...

Since the p67phox sequence had not been determined in rats, we sequenced the coding region and 1700b base pairs (bp) upstream of the translation start site of SS and SS.13BN26 rats. Within the 15 exons of p67phox, only a single silent mutation was found in exon 14. The coding sequences of the SS and congenic SS.13BN26 alleles of p67phox were reported with the GenBank accession numbers JN864041 and JN864042, respectively. The analysis of the promoter sequence revealed that SS rats had a 204 bp deletion and four single nucleotide polymorphisms (SNPs) compared to SS.13BN26 rats (Supplementary Figure 1). To determine whether these variants would yield differences in the promoter activity, two constructs of the promoter containing all the genetic variances (Figure 1B) were cloned into luciferase constructs. The promoters were transfected into immortalized rat medullary thick ascending limb cells (raTAL). The promoter activity of p67phox as assessed by luciferase fluorescence was 1.7-fold higher in the SS construct than in the SS.13BN26 construct (p=0.009; Figure 1C). These results indicate that the genetic variances in the promoter region may contribute to higher mRNA expression of p67phox in the SS compared to SS.13BN26 rats on both LS and HS diet.

Enhanced p67phox expression in renal outer medulla is associated with increased NAD(P)H oxidase activity and enhanced salt-sensitivity in SS rats

In separate groups of SS and congenic SS.13BN26 rats, outer medullary tissue was collected from 6 week-old rats on the LS diet and day 7 of the HS diet to determine protein expression of p67phox and NAD(P)H oxidase activity. p67phox was undetectable by Western blot in both strains of rats fed the LS diet (Figure 2A; Supplementary Figure 3), but was significantly higher in the SS rats compared to SS.13BN26 rats on day 7 of the HS diet (p=0.008). Notably, none of the other membrane or cytosolic subunits of NAD(P)H oxidase, including p22phox, gp91phox, p47phox, and Rac 1, differed between the two strains on day 7 of the HS diet (Supplementary Figure 2).

Figure 2
Greater p67phox expression is associated with greater NAD(P)H oxidase activity and salt-sensitivity in the SS rat. (A) Western blot densitometric analyses of p67phox (β-actin normalized) of rats on both 0.4% LS and day 7 of HS diet with the associated ...

Renal medullary NAD(P)H oxidase activity was determined using a dihydroethidium (DHE) fluorescence assay (Taylor et al., 2006). NAD(P)H oxidase activity increased significantly in response to the HS diet in SS rats (p<0.01). Differences in enzyme activity between the two strains were not observed in rats fed the LS diet, whereas significantly higher levels of activity were found on day 7 of the HS diet in SS compared with SS.13BN26 rats (p<0.01) (Figure 2B).

Mean arterial pressure (MAP) was determined by telemetry. Congenic SS.13BN26 rats were shown to be protected against salt-sensitive hypertension compared with SS rats (Figure 2C). MAP between SS and congenic SS.13BN26 rats was statistically different on days 7, 10, and 14 of the HS diet (p<0.001). After 14 days, the MAP of SS.13BN26 rats was nearly 30 mmHg lower than that of the SS rats. Together, these results indicate that it is the greater expression of p67phox – not p22phox, gp91phox, p47phox, or Rac 1 – that is associated with greater levels of renal medullary NAD(P)H oxidase activity on the HS diet and greater salt-sensitivity in SS rats compared to SS. 13BN26.

p67phox null mutant SS rat is generated using zinc figure nucleases (ZFN) technology

To determine the functional relevance of p67phox in the development of salt-sensitive hypertension in SS rats, we generated a p67phox−/− model in the genomic background of SS rats using ZFN (Geurts et al., 2009; Geurts et al., 2010) (for details see Methods). Genomic DNA of p67phox null mutant (p67phox−/−) rats was sequenced. Sequencing results suggested there was a 5bp deletion (GAGAA) in the genomic sequence of p67phox−/− rats (Figure 3A). The p67phox−/− rats were also validated by Western blot experiments (Supplementary Figure 3). In order to further demonstrate that there was no functional p67phox in p67phox−/− rats, respiratory burst experiments were performed. p67phox is known to be critically involved in the respiratory burst of macrophages (Maehara et al., 2009; Noack et al., 1999). We obtained macrophages from the peritoneal space of 6–7 week-old p67phox−/− rats and wild type (WT) littermates fed the HS diet for 14 days (De Miguel et al., 2010). The respiratory burst response to phorbol 12-myristate 13-acetate (PMA) stimulus in the p67phox−/− rats was completely abolished compared to the WT littermates (Figure 3B). We concluded that we had successfully generated the p67phox−/− rats. p67phox−/− rats and their WT littermates were used for the following phenotypic studies.

Figure 3
(A) Sequencing of genomic DNA of wild type (WT; n=3) and p67phox−/− revealed a 5 bp deletion (GAGAA) in the genomic sequence of p67phox−/−. (B) Respiratory burst of macrophages isolated from p67phox−/− (n=6) ...

p67phox−/− rats show significantly reduced salt-sensitivity and renal oxidative stress

We first examined the effect of disrupting p67phox on blood pressure. Baseline MAP was not different between the WT and p67phox−/− rats at 6 weeks of age when fed the LS diet (Figure 4A). MAP between WT and p67phox−/− rats was statistically different on days 10 and 14 of the HS diet (p<0.001). By the end of day 14, the MAP of p67phox−/− rats was 30 mmHg lower than their WT littermates. These results suggest that p67phox had a profound effect on the development of salt-sensitive hypertension in SS rats.

Figure 4
Salt-sensitive hypertension and renal oxidative stress are significantly attenuated in the p67phox−/− rats compared to wild type (WT) littermates. (A) Mean arterial pressure (MAP) of 5–6 week-old rats on 0.4% and 8% salt diet (n=6–9 ...

We then measured NAD(P)H oxidase activity and total superoxide levels using outer medullary tissue homogenate. OM was harvested at the end of blood pressure measurement on day 14 of the HS diet. The p67phox−/− rats demonstrated significantly lower renal medullary NAD(P)H oxidase activity (p=0.0049) (Figure 4B). We used the portion of O2.− that was inhibited by diphenylene iodonium (DPI) as an index of NAD(P)H oxidase activity as previously described (Taylor et al., 2006). Since DPI is recognized as a non-selective inhibitor of all FAD-containing enzymes, including xanthine oxidase, cytochrome p450 oxidoreductase, and NADH dehydrogenase (Drummond et al., 2011), the residual O2.− level in the p67phox−/− rats was likely derived from non-specific DPI inhibition of other O2.− generating enzymes. Total renal medullary O2.− levels was also significantly lower in the p67phox−/− rats (p=0.01) (Figure 4C).

To further validate that oxidative stress was reduced in p67phox−/− rats, outer medullary hydrogen peroxide (H2O2) levels were measured in anesthetized rats. In a separate group of p67phox−/− rats and WT littermates, microdialysis techniques were used to collect interstitial fluid from the outer medullary region, and H2O2 levels were measured using Amplex™ Red assay (Jin et al., 2009). As shown in (Figure 4D), H2O2 concentrations in the medullary interstitial fluid of p67phox−/− rats were significantly lower than WT littermates (p=0.019).

p67phox−/− rats show significantly reduced renal injury

To evaluate the degree of renal injury, proteinuria and microalbuminuria were measured. Urine was collected overnight (18h) on the LS diet and on days 7 and 14 of the HS diet. In rats fed the LS diet, no differences were observed between WT and p67phox−/− rats. Protein excretion of WT rats increased from 14.4±1.8 mg/day on the LS diet to 122.8±18.7 mg/day on day 7 and to 331.2± 50.5 mg/day on day 14 of the HS diet. In contrast, p67phox−/− rats exhibited only half of these levels in response to the HS diet (Figure 5A). Microalbumin excretion followed the same trend (Figure 5B).

Figure 5
Renal injury is significantly reduced in p67phox−/− rats compared to wild type (WT) littermates. (A) Proteinuria and (B) microalbuminuria of p67phox−/− and WT rats on LS, D7-HS, and D14-HS diet (n=6 rats/strain). † ...

Histological analyses of the kidneys collected on day 14 of the HS diet were also used to quantify the renal injures between WT and p67phox−/− rats. Trichrome staining was used to quantify protein casts (stained in red), an index of tubular necrosis. Protein casts were mostly observed in the OM region at levels that were 7-fold higher in WT compared with p67phox−/− rats (p<0.001) (Figure 5C). Interstitial fibrosis was quantified by α-SMA immunostaining (Figure 5D), and infiltrated macrophages were quantified by ED-1 immunostaining (Figure 5E). α-SMA and ED-1 were stained in brown. In the outer medullary area, the levels of interstitial fibrosis and infiltrated macrophages in p67phox−/− rats were half the levels found in WT rats (p=0.008 and 0.008, respectively). Glomerular injury was quantified by scoring 50 superficial cortical and 20–30 juxtamedullary glomeruli (0–4 scale) of p67phox−/− rats and their WT littermates (Mori and Cowley, 2004). As shown in Figure 5F, the glomerular injury was significantly reduced in the superficial cortical glomeruli of p67phox−/− rats (similar reduction in the juxtamedullary glomeruli; data not shown). Overall, p67phox−/− rats showed dramatic reductions of renal injury in both the OM and cortex. These results indicate that p67phox plays a causal role in the development of salt-sensitive hypertension and renal oxidative stress and injury.

DISCUSSION

p67phox is known to be a key activator of NOX2-containing NAD(P)H oxidase in phagocytes (Maehara et al., 2009; Noack et al., 1999). However, the direct role of p67phox in the development of salt-sensitive hypertension and renal injury has not been explored previously. The results of the present study using p67phox null mutant rats provide strong evidence of an important role for this gene in salt-sensitive hypertension. Even in the face of very large increases of salt intake, suppression of p67phox produced significant reductions of hypertension, oxidative stress, and renal injury.

p67phox was cloned and identified in the renal OM. Several genetic variances between SS and SS.13BN26 rats were found in the promoter region and contributed to higher promoter activity, perhaps explaining the higher p67phox mRNA expression in the OM of SS rats. It will now be important to identify the upstream transcription factors that differentially regulate p67phox expression through the genetic variances. The SS allele of the p67phox promoter contains a 204 bp deletion compared to the SS.13BN26 allele, yet the SS allele yielded higher promoter activity. This result suggests that there might be some transcriptional repressors binding to the deleted region. It will now be important to identify potential transcriptional factors that bind to this region and to validate the binding with Chromatin immunoprecipitation (ChIP) experiments.

In our current study, we also observed that p67phox expression – not the expression of p22phox, gp91phox, p47phox or Rac1 – in the outer medullary region is associated with higher NAD(P)H oxidase activity and greater salt-sensitivity in SS rats. There is immunohistochemical evidence from kidneys of SHR rats suggesting that p67phox is expressed in the thick ascending limb, macula densa, distal convoluted tubule, cortical collecting duct, and perhaps the outer and inner medullary collecting ducts (Chabrashvili et al., 2002). We have confirmed these findings by immunostaining a single Sprague Dawley kidney. Additionally, we found no staining in the vasa recta of the outer medulla. Among different tubules in the outer medulla, the mTAL has been previously shown to produce greater amounts of O2.− than the thin descending limb and outer medullary collecting duct (Li et al., 2002). Moreover, increased luminal flow rate and/or [Na+] can stimulate the generation of O2.− in mTAL (Abe et al., 2006). Increased levels of O2.− can enhance Na+ entry via Na+K+2Cl co-transport and therefore increase Na+ reabsorption (Juncos and Garvin, 2005). It remains to be determined whether the mTAL of the SS rats exhibits higher levels of p67phox expression and NAD(P)H oxidase activity in response to a HS diet than the mTAL of congenic SS.13BN26.

A growing body of evidence suggests that T cells play an important role in the later phase of the development of hypertension (Harrison et al., 2011). In SS rats following three weeks of a HS diet, significant infiltration of T cells was observed in the kidney (De Miguel et al., 2011). These T cells were found to express NAD(P)H oxidase subunits – including p22phox, gp91phox, p47phox, and p67phox – indicating that T cells contain the molecular machinery needed for O2.− production. Administration of an immunosuppressive agent was found to reduce the number of infiltrated T cells in the kidney, reduce oxidative stress in the urine, and attenuate salt-sensitive hypertension and renal injuries in SS rats. Therefore, up-regulation of p67phox in T cells of SS rats could also contribute to differences in salt-sensitivity between the two strains. The relative contribution of the mTAL and infiltrated T cells to oxidative stress in the outer medulla remains to be determined.

Finally, despite the crucial role of renal p67phox in the development of salt-sensitive hypertension, the role of this gene should still be examined in vascular systems and the central nervous system. Although SNPs in human p67phox have not been found to be associated with hypertension in genome-wide association studies, the present study suggests that stratification of the populations based on salt-sensitivity may uncover an association. However, even if mutations in this gene do not serve as a marker or predictor of salt sensitivity in human populations, our studies suggest that inhibitors targeting p67phox for the treatment of salt-sensitive hypertension should be explored.

EXPERIMENTAL PROCEDURES

Animals

Male rats were obtained at weaning from colonies developed and maintained at the Medical College of Wisconsin under controlled environmental conditions. They were provided water ad libitum and maintained on a purified AIN-76A rodent food (Dyets, Bethlehem) containing 0.4% NaCl (low salt: LS) since weaning. Some groups were switched to an 8% NaCl diet (high salt: HS) at 6–7 weeks of age. All experimental protocols were approved by the MCW Institutional Animal Care and Use Committee. Inbred congenic SS.13BN26 was generated as previously described.(Cowley et al., 2001; Moreno et al., 2007)

Tissue collection

Rats were anesthetized with an intra-peritoneal injection of pentobarbital (50 mg/kg). Both kidneys were removed and hemisected. The outer medulla was quickly removed and snap-frozen in liquid N2 and stored at −80°C. Frozen tissues were used for either DNA or RNA extraction or for preparation of tissue homogenates to perform NAD(P)H oxidase activity assays or Western blots.

Real Time quantitative Reverse Transcription PCR (qRT-PCR)

Total RNA was extracted from OM with TRIzol (Invitrogen). The qRT-PCR reaction mixture contained 1X SYBR Green PCR master mix (Invitrogen), 0.25 U/µl MultiScribe reverse transcriptase (Applied Biosystems), 0.4 U/µl RNase inhibitor (Applied Biosystems), 400 nM forward and reverse primers, and 8 ng total RNA. qRT-PCR reactions were carried out using the ABI Prism 7900HT system (Applied Biosystems) (Morrison et al., 2004). 18S rRNA was used as an internal control. Primers to amplify cDNA of p67phox were designed by Primer Express version 2 (Applied Biosystems):

  • Forward (fw) primer: 5’-AGCAGAAGAGCAGTTAGCATTGG-3’;
  • Reverse (rv) primer 5’-TGCTTTCCATGGCCTTGTC-3’.

Western Blot

Outer medullary tissue was homogenized and processed as previously described (Taylor et al., 2006). Protein concentrations were determined using a Coomassie blue protein assay (Biorad) with bovine serum albumin as a standard. Lysates were mixed with laemmli sample buffer (BIO-RAD) and were heated to 100°C for 5 min, then loaded onto either a 7.5%, 4–20%, or 10–20% Tris SDS–PAGE gel (BIO-RAD) and transferred to a PVDF membrane (Biorad). Membranes were blocked for 1 h in 1xTBS-T [TBS (BIO-RAD) + 0.1% Tween20 (Sigma)] containing 5% non-fat dry milk at room temperature and then incubated at 4°C overnight (16–18h). Membranes were incubated in a primary antibody at room temperature for 2 h, and then washed 5 min each time for four times in 1xTBS-T. Membranes were incubated in a secondary antibody at room temperature for 1.5 h, and washed 5 min each time for four times in 1xTBS-T. The films were developed with Immun-StarTM HRP peroxide reagent (BIO-RAD). The films were scanned and the intensities of the target bands were quantified using Imagequant program (Amersham Biosciences). β-actin was used for loading control. Primary antibodies were: p67phox(Millipore), 1:125; p22phox(Sigma), 1:200; gp91phox(BD), 1:1000; p47phox(Santa Cruz), 1:1000; Rac1(Millipore), 1:1000; β-actin (Santa Cruz), 1:1000.

Chronic measurement of arterial blood pressure

Mean arterial pressure (MAP) was measured by radiotelemetry (De Miguel et al., 2011). 5–6-week-old male rats were anesthetized and surgically prepared with an implanted gel-filled catheter in the right carotid artery. This catheter was attached to a transmitter (DSI) that was anchored subcutaneously between the scapulae. Baseline MAP was obtained daily from 9am to 12 pm over a 3–4 day period following a 5–7 day surgical recovery after catheter implantation. The diet was then switched from 0.4% LS to 8% HS. MAP was measured on days 1–3, 7, 10, and 14 of the HS diet

Sequencing the coding region of rat p67phox

Total RNA was extracted from outer medullary tissue and reverse transcribed to cDNA using an oligo-dT primer (Invitrogen). PCR primers were designed by DNASTAR program. PCR products were cloned into the pCR4-TOPO vector (Invitrogen) and are sequenced. Primers used to amplify the coding region were listed below:

  • fw primer: 5’- caccatcctgtcttctagtaagca -3’
  • rv primer: 5’- ctatacttctctgggagtgccttc -3’.

Sequencing promoter region of rat p67phox

Genomic DNA was extracted from outer medullary tissue. PCR primers amplifying the 3000 base pairs (bp) prior to the translation start site were design by DNASTAR. PCR products were sequenced directly. A 1700 bp sequence prior to the translation start site was assembled and analyzed. Primers are listed below:

  • fw primer: 5’-tgtttgaggtaggttttagaaa- 3’
  • rv primer: 5’- ggttaggtgcttactagaagacag-3’.

Building p67phox promoter constructs

PCR products from genomic sequencing were used as the template to build promoter constructs. Primers to amplify the promoter region containing all of the genetic variances were listed below:

  • fw1 primer (for SS.13BN26): 5’-aactcgagcttcttaaattttttttttttatttattca-3’
  • fw2 primer (for SS): 5’-aactcgagcttcttaaatggccagagtggc-3’
  • rv primer: 5’- aaaaaagatctaggatggtagttcaaggtgtctc-3’.

The underlined sequences indicate restriction enzyme target sites. PCR products were cloned into the XhoI – BglII site of pGL4.81 [hRlucCP/Neo] vector (Promega) (Liu et al., 2009). Renilla luciferase reporter constructs containing either the SS or SS.13BN26 p67phox promoter segment were verified by sequencing. Promoter vectors were prepared using a E.Z.N.A.® Endo-Free Midi Plasmid Kit (Omega).

Transfection and luciferase activity assay

Immortalized rat medullary thick ascending limb cells (raTAL) were cultured in REGM™ Renal Epithelial Cell Growth Medium (BulletKit, Lonza) and passaged (Eng et al., 2007). Once 90% confluency was reached, the cells were seeded onto 96 well plates. When raTAL cells reached 40–50% confluency, reporter constructs were transfected using Lipofectamine 2000 (Invitrogen). During transfection, REGM™ media was replaced by Opti-MEM® I Reduced Serum Media (Invitrogen). A control plasmid pGL2 (Promega) was also co-transfected to adjust for transfection efficiency. 4 h after transfection, Opti-MEM® I Reduced Serum Media was switched back to culture media REGM™. Cells were incubated overnight, and the promoter luciferase activity was measured by a dual luciferase-reporter assay system (Promega). Luminescence was measured using a high-throughput Analyst HT 96.384 microplate reader (Molecular Devices) (Liu et al., 2009).

Production of the p67phox null mutant colony

Zinc Finger Nucleases (ZFNs) targeting rat p67phox exon 2 was designed by Sigma. The target sequence contains CTCTACTACAGCATGgagaagTAAGTGGTGTCGGAGTGT, where each ZFN binds to each underlined sequence on complementary strands. mRNA encoding the p67phox ZFNs were injected into embryos from SS rats and transferred to pseudopregnant SS females. The SURVEYOR Nuclease Assay was used to detect ZFN mediated genome editing (Geurts et al., 2009; Geurts et al., 2010). The PCR primers used to amplify the target site were:

  • fw primer: 5’-tgtaaaacgacggccagttcaccttgcattgctgaatc-3’
  • rv primer: 5’-aactgcccagaaagagcaag-3’

Sequencing results suggested one of the pups contained one allele with a 5 bp deletion and the other allele with an 11 bp deletion. This rat was backcrossed with an SS female. The offspring of the backcross were either heterozygous (5bp deletion/+) or heterozygous (11bp deletion/+). Female and male heterozygous rats (5bp deletion/+) were chosen for intercross. Fluorescent genotyping was used to distinguish homozygous p67phox null mutant (p67phox−/−) rats from the WT littermates. PCR products amplifying the ZFNs target site were mixed with Liz-600 size standard (Applied Biosystems) and were loaded on an ABI3730 sequencer. The results were analyzed by GeneMapper 4.0 software (Applied Biosystems). WT animals amplified at 325 bp while homozygous mutant animals amplified at 320 bp.

Respiratory burst assay

6–7 week-old WT and p67phox−/− rats fed the HS diet for 14 days were used. Rats were anesthetized with an intra-peritoneal injection of pentobarbital (0.1ml/100g body weight). 80 ml saline was injected in to the abdominal cavity followed by a small midline incision. The excess fluid was drained in a beaker. The collected fluids were centrifuged at 400g for 10 mins. Histopaque ®-1083 (Sigma) was used to isolate mononuclear cells (De Miguel et al., 2010). 90% collected cells were viable confirmed by trypan blue (BI) staining. Using flow cytometry, 70–75% of the collected cells were identified as CD11b+ macrophages, the major cells that generate the respiratory burst. 10% of the collected cells were CD3+ T cells, and 10% were CD45Ra+ B cells. Collected cell pellets were re-suspended in 1ml of Dulbecco’s Modified Eagle Medium (Invitrogen) and were aliquot into three wells on a clear-bottom 96-well plate (Bioexpress). The plate was incubated at 37°C for 2 h. Each well contained around 1×106 cells. Media was then removed and replaced with 0.3 ml of 1 mM luminol derivative L-012 (Wako Pharmaceuticals) dissolved in Hank’s balanced salt solution (Invitrogen). Luminescence of L-012 was used as an index of superoxide production. Luminescence was measured at 37°C on FLUOstar Omega machine (BMG Labtech) for baseline recording. Phorbol 12-myristate 13-acetate (PMA), a PKC activator, was added to each well to yield a final concentration of 135µM. Luminescence was then measured every 5 min for 30 min.

Detection of total O2.− and NAD(P)H oxidase activity by 2-Hydroxyethidium fluorescence

Outer medullary homogenate protein (20 µg) was incubated with dihydroethidium (10 µmol/L), with salmon testes DNA (0.5 mg/mL), and with or without 100 µmol/L diphenylene iodonium (DPI; Sigma), an inhibitor of NAD(P)H oxidase. Oxy-Ethidium fluorescence was measured at an excitation of 485 nm and an emission of 570 nm on a SpectraFluor microplate reader (TECAN) every 5 min for 35 min (37°C) (Taylor et al., 2006). The maximal increase of fluorescence within 35 min was used as an index of total O2.− level. The portion of oxy-Eth fluorescence after DPI inhibition was used as an index of NAD(P)H oxidase activity.

Acute microdialysis

WT and p67phox−/− rats were anesthetized with ketamine (20 mg/kg, IM) and inactin (50 mg/kg, IP) and placed on a temperature-controlled surgical table maintained at 37°C. The femoral artery was catheterized to record arterial pressure. The femoral vein was catheterized to infuse saline containing 2% BSA in saline (0.1ml/h/100g) to maintain constant blood volume. The left kidney was isolated and prepared for in vivo microdialysis (Jin et al., 2009). After a 1 h equilibration period, dialysate effluent was collected over two 30-min intervals. Renal medullary interstitial H2O2 concentrations were determined by fluorescence spectrometry using the Amplex™ Red Hydrogen Peroxide Assay Kit (Molecular Probes).

Histological staining analysis

Rats were anesthetized and the left kidney was perfused with 10 ml 0.9% saline to flush the blood out, and the kidney was then removed and placed in phosphate buffer containing 10% formaldehyde. Kidneys were paraffin embedded in an automatic tissue processor (Microm). 3-µm cut sections were mounted on siliconized/charged slides. A robotic DAKO autostainer (Dako Cytomation) was used for all staining procedures. All images were captured with a Nikon E600 (Fryer Co) microscope equipped with a Spot Insight color CCD camera (Diagnostic Instruments). Gomori’s trichrome, α-SMA (Dako Cytomation) and ED1 (Serotec) staining and quantification were performed as previously described (Mori et al., 2008). Glomerular injury was quantified as previously described (Mori and Cowley, 2004).

Measurement of albumin and protein in urine

Rats were placed in metabolic cages for overnight urine collection (18 h). Microalbuminuria was quantified using an Albumin Blue 580 (Molecular Probes) fluorescence assay. Proteinuria was quantified using Weichselbaum’s biuret reagent on an ACE auto-analyzer (Alfa Wassermann).

Statistical Analysis

Data are presented as mean values ± one standard error. To assess the differences between two groups, t-tests were performed. Empirical p-values were obtained through 100,000 permutation tests. Two-way analysis of variance (ANOVA) for repeated measures was used to analyze blood pressure, microalbuminuria and proteinuria data. To compare the difference between the strains on a specific day, a t-test was used followed by 100,000 permutation tests. Multiple comparisons were adjusted using a Bonferroni correction. For other multiple group comparisons, a two way ANOVA was performed. Multiple comparisons were adjusted using a Bonferroni correction. All of these data analyses were implemented using the R statistical package.

Research Highlights

  1. p67phox is differentially expressed between salt-sensitive and salt-resistant rats
  2. Genetic mutations in the promoter of p67phox differentially regulate the gene
  3. p67phox null mutant rats show reduced salt-sensitivity
  4. p67phox null mutant rats show reduced renal oxidative stress and injury

Supplementary Material

01

Acknowledgements

The studies included in this manuscript are Di Feng’s Ph.D. dissertation project. Di Feng, Mingyu Liang and Allen W. Cowley, Jr designed the studies. Aron Geurts used zinc finger nucleases to generate the p67phox −/− rat. Di Feng and Terry Kurth performed the phenotypic studies. Di Feng and Yang Chun carried out the molecular and cellular experiments. Jozef Lazar assisted with the sequencing studies. Dave Mattson designed the respiratory burst experiment and Paul O’Connor performed this technique. Di Feng analyzed all of the data. Di Feng and Allen W. Cowley, Jr wrote the manuscript.

This work was supported by grants HL-82798 and HL-29587. We thank Meredith Skelton and Clark DuMontier for editing the manuscript. We thank Howard Jacob and Jaime Wendt Andrae for sequencing support. We thank Carol Moreno Quinn, Becky Schilling, Colin Hansen, Michael Grzybowski, and Jason Klotz for maintaining and genotyping the rat colonies. We thank Mike Flister and Chuanling Guo for technical assistance with respiratory burst experiments. We thank Yan Lu and Tao Wang (supported, in part, by grant 1UL1RR031973) for assistance with statistical analysis. We thank Lisa Henderson, Camille Torres, and Jenifer Phillips for assistance with protein and microalbumin measurements. We thank Glenn Slocum and Carol Bobrowitz for assistance with microscopic and histological analysis.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

ACCESSION NUMBERS

Gene sequences have been deposited in NCBI GenBank and are accessible through accession number JN864041, JN864042, JN864043, JN864044, JN864045 and JN864046.

References

  • Abe M, O'Connor P, Kaldunski M, Liang M, Roman RJ, Cowley AW., Jr Effect of sodium delivery on superoxide and nitric oxide in the medullary thick ascending limb. American journal of physiology. Renal physiology. 2006;291:F350–F357. [PubMed]
  • Brandes RP, Weissmann N, Schroder K. NADPH oxidases in cardiovascular disease. Free Radic. Biol. Med. 2010;49:687–706. [PubMed]
  • Chabrashvili T, Tojo A, Onozato ML, Kitiyakara C, Quinn MT, Fujita T, Welch WJ, Wilcox CS. Expression and cellular localization of classic NADPH oxidase subunits in the spontaneously hypertensive rat kidney. Hypertension. 2002;39:269–274. [PubMed]
  • Cowley AW, Jr, Roman RJ. The role of the kidney in hypertension. JAMA. 1996;275:1581–1589. [PubMed]
  • Cowley AW, Jr, Roman RJ, Kaldunski ML, Dumas P, Dickhout JG, Greene AS, Jacob HJ. Brown Norway chromosome 13 confers protection from high salt to consomic Dahl S rat. Hypertension. 2001;37:456–461. [PubMed]
  • De Miguel C, Das S, Lund H, Mattson DL. T lymphocytes mediate hypertension and kidney damage in Dahl salt-sensitive rats. American journal of physiology. Regulatory, integrative and comparative physiology. 2010;298:R1136–R1142. [PubMed]
  • De Miguel C, Guo C, Lund H, Feng D, Mattson DL. Infiltrating T lymphocytes in the kidney increase oxidative stress and participate in the development of hypertension and renal disease. American journal of physiology. Renal physiology. 2011;300:F734–F742. [PubMed]
  • Drummond GR, Selemidis S, Griendling KK, Sobey CG. Combating oxidative stress in vascular disease: NADPH oxidases as therapeutic targets. Nat Rev Drug Discov. 2011;10:453–471. [PMC free article] [PubMed]
  • Eng B, Mukhopadhyay S, Vio CP, Pedraza PL, Hao S, Battula S, Sehgal PB, McGiff JC, Ferreri NR. Characterization of a long-term rat mTAL cell line. American journal of physiology. Renal physiology. 2007;293:F1413–F1422. [PubMed]
  • Geurts AM, Cost GJ, Freyvert Y, Zeitler B, Miller JC, Choi VM, Jenkins SS, Wood A, Cui X, Meng X, et al. Knockout rats via embryo microinjection of zinc-finger nucleases. Science. 2009;325:433. [PMC free article] [PubMed]
  • Geurts AM, Cost GJ, Remy S, Cui X, Tesson L, Usal C, Menoret S, Jacob HJ, Anegon I, Buelow R. Generation of gene-specific mutated rats using zinc-finger nucleases. Methods Mol. Biol. 2010;597:211–225. [PubMed]
  • Harrison DG, Guzik TJ, Lob HE, Madhur MS, Marvar PJ, Thabet SR, Vinh A, Weyand CM. Inflammation, immunity, and hypertension. Hypertension. 2011;57:132–140. [PMC free article] [PubMed]
  • Huang BS, Amin MS, Leenen FH. The central role of the brain in salt-sensitive hypertension. Curr. Opin. Cardiol. 2006;21:295–304. [PubMed]
  • Jin C, Hu C, Polichnowski A, Mori T, Skelton M, Ito S, Cowley AW., Jr Effects of renal perfusion pressure on renal medullary hydrogen peroxide and nitric oxide production. Hypertension. 2009;53:1048–1053. [PMC free article] [PubMed]
  • Jones CA, Francis ME, Eberhardt MS, Chavers B, Coresh J, Engelgau M, Kusek JW, Byrd-Holt D, Narayan KM, Herman WH, et al. Microalbuminuria in the US population: third National Health and Nutrition Examination Survey. Am. J. Kidney Dis. 2002;39:445–459. [PubMed]
  • Juncos R, Garvin JL. Superoxide enhances Na-K-2Cl cotransporter activity in the thick ascending limb. American journal of physiology. Renal physiology. 2005;288:F982–F987. [PubMed]
  • Kearney PM, Whelton M, Reynolds K, Muntner P, Whelton PK, He J. Global burden of hypertension: analysis of worldwide data. Lancet. 2005;365:217–223. [PubMed]
  • Kuhns DB, Alvord WG, Heller T, Feld JJ, Pike KM, Marciano BE, Uzel G, DeRavin SS, Priel DA, Soule BP, et al. Residual NADPH oxidase and survival in chronic granulomatous disease. N. Engl. J. Med. 2010;363:2600–2610. [PMC free article] [PubMed]
  • Landmesser U, Cai H, Dikalov S, McCann L, Hwang J, Jo H, Holland SM, Harrison DG. Role of p47(phox) in vascular oxidative stress and hypertension caused by angiotensin II. Hypertension. 2002;40:511–515. [PMC free article] [PubMed]
  • Laursen JB, Rajagopalan S, Galis Z, Tarpey M, Freeman BA, Harrison DG. Role of superoxide in angiotensin II-induced but not catecholamine-induced hypertension. Circulation. 1997;95:588–593. [PubMed]
  • Li N, Yi FX, Spurrier JL, Bobrowitz CA, Zou AP. Production of superoxide through NADH oxidase in thick ascending limb of Henle's loop in rat kidney. American journal of physiology. Renal physiology. 2002;282:F1111–F1119. [PubMed]
  • Liu Y, Mladinov D, Pietrusz JL, Usa K, Liang M. Glucocorticoid response elements and 11 beta-hydroxysteroid dehydrogenases in the regulation of endothelial nitric oxide synthase expression. Cardiovasc. Res. 2009;81:140–147. [PMC free article] [PubMed]
  • Lu L, Li P, Yang C, Kurth T, Misale M, Skelton M, Moreno C, Roman RJ, Greene AS, Jacob HJ, et al. Dynamic convergence and divergence of renal genomic and biological pathways in protection from Dahl salt-sensitive hypertension. Physiol Genomics. 2010;41:63–70. [PubMed]
  • Maehara Y, Miyano K, Sumimoto H. Role for the first SH3 domain of p67phox in activation of superoxide-producing NADPH oxidases. Biochem. Biophys. Res. Commun. 2009;379:589–593. [PubMed]
  • Moreno C, Kaldunski ML, Wang T, Roman RJ, Greene AS, Lazar J, Jacob HJ, Cowley AW., Jr Multiple blood pressure loci on rat chromosome 13 attenuate development of hypertension in the Dahl S hypertensive rat. Physiol Genomics. 2007;31:228–235. [PubMed]
  • Mori T, Cowley AW., Jr Role of pressure in angiotensin II-induced renal injury: chronic servo-control of renal perfusion pressure in rats. Hypertension. 2004;43:752–759. [PubMed]
  • Mori T, Polichnowski A, Glocka P, Kaldunski M, Ohsaki Y, Liang M, Cowley AW., Jr High perfusion pressure accelerates renal injury in salt-sensitive hypertension. J. Am. Soc. Nephrol. 2008;19:1472–1482. [PubMed]
  • Morrison J, Knoll K, Hessner MJ, Liang M. Effect of high glucose on gene expression in mesangial cells: upregulation of the thiol pathway is an adaptational response. Physiol Genomics. 2004;17:271–282. [PubMed]
  • Noack D, Rae J, Cross AR, Munoz J, Salmen S, Mendoza JA, Rossi N, Curnutte JT, Heyworth PG. Autosomal recessive chronic granulomatous disease caused by novel mutations in NCF-2, the gene encoding the p67-phox component of phagocyte NADPH oxidase. Hum. Genet. 1999;105:460–467. [PubMed]
  • Paravicini TM, Touyz RM. NADPH oxidases, reactive oxygen species, and hypertension: clinical implications and therapeutic possibilities. Diabetes Care. 2008;31(Suppl 2):S170–S180. [PubMed]
  • Rajagopalan S, Kurz S, Munzel T, Tarpey M, Freeman BA, Griendling KK, Harrison DG. Angiotensin II-mediated hypertension in the rat increases vascular superoxide production via membrane NADH/NADPH oxidase activation. Contribution to alterations of vasomotor tone. J. Clin. Invest. 1996;97:1916–1923. [PMC free article] [PubMed]
  • Rostand SG, Kirk KA, Rutsky EA, Pate BA. Racial differences in the incidence of treatment for end-stage renal disease. N. Engl. J. Med. 1982;306:1276–1279. [PubMed]
  • Taylor NE, Glocka P, Liang M, Cowley AW., Jr NADPH oxidase in the renal medulla causes oxidative stress and contributes to salt-sensitive hypertension in Dahl S rats. Hypertension. 2006;47:692–698. [PubMed]