PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of mbcLink to Publisher's site
 
Mol Biol Cell. 2012 February 1; 23(3): 480–491.
PMCID: PMC3268726

Altered nuclear tRNA metabolism in La-deleted Schizosaccharomyces pombe is accompanied by a nutritional stress response involving Atf1p and Pcr1p that is suppressible by Xpo-t/Los1p

A. Gregory Matera, Monitoring Editor
University of North Carolina

Abstract

Deletion of the sla1+ gene, which encodes a homologue of the human RNA-binding protein La in Schizosaccharomyces pombe, causes irregularities in tRNA processing, with altered distribution of pre-tRNA intermediates. We show, using mRNA profiling, that cells lacking sla1+ have increased mRNAs from amino acid metabolism (AAM) genes and, furthermore, exhibit slow growth in Edinburgh minimal medium. A subset of these AAM genes is under control of the AP-1–like, stress-responsive transcription factors Atf1p and Pcr1p. Although S. pombe growth is resistant to rapamycin, sla1-Δ cells are sensitive, consistent with deficiency of leucine uptake, hypersensitivity to NH4, and genetic links to the target of rapamycin (TOR) pathway. Considering that perturbed intranuclear pre-tRNA metabolism and apparent deficiency in tRNA nuclear export in sla1-Δ cells may trigger the AAM response, we show that modest overexpression of S. pombe los1+ (also known as Xpo-t), encoding the nuclear exportin for tRNA, suppresses the reduction in pre-tRNA levels, AAM gene up-regulation, and slow growth of sla1-Δ cells. The conclusion that emerges is that sla1+ regulates AAM mRNA production in S. pombe through its effects on nuclear tRNA processing and probably nuclear export. Finally, the results are discussed in the context of stress response programs in Saccharomyces cerevisiae.

INTRODUCTION

The protein La is a multifunctional RNA-binding protein (Maraia, 2001 blue right-pointing triangle; Wolin and Cedervall, 2002 blue right-pointing triangle; Bayfield et al., 2010 blue right-pointing triangle) that serves as a chaperone for precursor-tRNAs (pre-tRNAs) during the intranuclear phase of their maturation, which includes folding, 5′ and 3′ RNA cleavages, multiple modifications, and CCA addition to the processed 3′ end (Maraia and Lamichhane, 2011 blue right-pointing triangle). La is ubiquitous in eukaryotes and essential in mammals (Park et al., 2006 blue right-pointing triangle) but nonessential in the yeasts Saccharomyces cerevisiae and Schizosaccharomyces pombe, although its deletion causes aberrancies relative to the normal pattern of pre-tRNA intermediates (reviewed in Maraia and Lamichhane, 2011 blue right-pointing triangle). Absence of S. cerevisiae La (Lhp1p) disrupts pre-tRNA 5′ processing by RNase P (Yoo and Wolin, 1997 blue right-pointing triangle). S. pombe La (sla1) mutants that are defective in nuclear retention and export their pre-tRNA ligands to the cytoplasm cause premature splicing (Intine et al., 2002 blue right-pointing triangle; Bayfield et al., 2007 blue right-pointing triangle), whereas other sla1 mutants distinguish 3′ end protection from RNA chaperone-like activity for structurally impaired pre-tRNAs (Huang et al., 2006 blue right-pointing triangle; Bayfield and Maraia, 2009 blue right-pointing triangle). Thus La directs multiple aspects of pre-tRNA metabolism, and its absence from S. pombe causes imbalances in the distribution of pre-tRNA intermediates that can be rescued by human La (Van Horn et al., 1997 blue right-pointing triangle; Intine et al., 2000 blue right-pointing triangle, 2002 blue right-pointing triangle; Huang et al., 2006 blue right-pointing triangle; Bayfield et al., 2007 blue right-pointing triangle; Bayfield and Maraia, 2009 blue right-pointing triangle).

In addition to function in translation, tRNAs also serve widely as metabolic sensors (Soll, 1993 blue right-pointing triangle; Banerjee et al., 2010 blue right-pointing triangle; Phizicky and Hopper, 2010 blue right-pointing triangle). Pathways for biogenesis and intracellular transport of tRNAs have been linked to growth, nutrition, and stress responses (Phizicky and Hopper, 2010 blue right-pointing triangle). In S. cerevisiae, accumulation of aberrant pre-tRNAs that cannot be processed or defects in their nuclear export stimulate Gcn4p (Qiu et al., 2000 blue right-pointing triangle), a master transcription activator of amino acid metabolism (AAM) and other genes (Natarajan et al., 2001 blue right-pointing triangle). However, whereas Gcn4p induction due to some stress pathways depends on the kinase Gcn2p (Hinnebusch, 2005 blue right-pointing triangle), the GCN4-mediated response to aberrant pre-tRNA metabolism, termed nuclear surveillance, is independent of GCN2 (Qiu et al., 2000 blue right-pointing triangle). S. cerevisiae and S. pombe La proteins can offset the nuclear surveillance response and 3′ end–mediated decay of aberrant pre-tRNAs (Anderson et al., 1998 blue right-pointing triangle; Huang et al., 2006 blue right-pointing triangle; Copela et al., 2008 blue right-pointing triangle; Ozanick et al., 2009 blue right-pointing triangle; reviewed in Maraia and Lamichhane, 2011 blue right-pointing triangle).

The DNA damage response program also links pre-tRNA metabolism to Gcn4p (Weinert and Hopper, 2007 blue right-pointing triangle). In this case, intron-containing pre-tRNAs accumulate in the nucleus due to altered shuttling of Los1p, the major nuclear exporter of tRNA (Ghavidel et al., 2007 blue right-pointing triangle). This pathway is distinguished by the fact that, in contrast to tRNA splicing in vertebrates, which is nuclear (Melton et al., 1980 blue right-pointing triangle; Lund and Dahlberg, 1998 blue right-pointing triangle; Paushkin et al., 2004 blue right-pointing triangle), tRNA splicing in S. cerevisiae occurs in the cytoplasm (Yoshihisa et al., 2003 blue right-pointing triangle, 2007 blue right-pointing triangle). Significantly, nuclear export of intron-containing pre-tRNAs appears to prevent their signaling activity (reviewed in Phizicky and Hopper, 2010 blue right-pointing triangle; Pierce et al., 2010 blue right-pointing triangle). Subcellular location of tRNA splicing has not been determined for S. pombe, in which potential relationships between Los1p/Xpo-t, nuclear accumulation of intron-containing pre-tRNAs, and links to stress are also unknown.

S. cerevisiae Gcn4p is related to c-jun, a component of mammalian AP-1 bZIP transcription factor (TF; Vogt et al., 1987 blue right-pointing triangle). Whereas Gcn4p is a single polypeptide and AP-1 is a heterodimer encoded by c-jun and c-fos (Curran and Franza, 1988 blue right-pointing triangle), they recognize similar DNA sequences and can functionally replace each other in vivo (Struhl, 1988 blue right-pointing triangle; Oliviero et al., 1992 blue right-pointing triangle). S. pombe has no Gcn4p, although it has AP-1–like activity (Jones et al., 1988 blue right-pointing triangle). The bZIP protein ATF resembles Gcn4p (Kim and Struhl, 1995 blue right-pointing triangle). S. pombe Atf1p (a.k.a., mts1/gad7) and Pcr1p form a heterodimer with AP-1/Gcn4p–like activity (Takeda et al., 1995 blue right-pointing triangle; Kanoh et al., 1996 blue right-pointing triangle). Although S. pombe lacking atf1+ or pcr1+ share stress phenotypes, they also show distinct deficiencies (Kanoh et al., 1996 blue right-pointing triangle) in meiosis, mating, and sporulation (Wahls and Smith, 1994 blue right-pointing triangle; Kon et al., 1997 blue right-pointing triangle; Yamada et al., 2004 blue right-pointing triangle), suggesting activity as a heterodimer or independent of each other.

There has been no reported mRNA profiling or growth phenotypes for La-deleted S. cerevisiae or S. pombe (for synthetic interactions see Yoo and Wolin, 1997 blue right-pointing triangle; Pannone et al., 1998 blue right-pointing triangle; Copela et al., 2006 blue right-pointing triangle). Here we report that sla1-Δ cells exhibit slow growth in Edinburgh minimal media (EMM), up-regulation of AAM genes, and other stress phenotypes mediated via atf1+ and pcr1+. A major component of growth inhibition in EMM is due to hypersensitivity to NH4Cl. Consistent with involvement of atf1+ and pcr1+ in nitrogen metabolism and mating, sla1-Δ cells also up-regulate nitrogen and mating genes. Leucine auxotrophic sla1-Δ cells are deficient in leucine uptake and hypersensitive to rapamycin, supported by genetic links to the TOR pathway (Weisman et al., 1997 blue right-pointing triangle; Valenzuela et al., 2001 blue right-pointing triangle; Cherkasova and Hinnebusch, 2003 blue right-pointing triangle; Fingar and Blenis, 2004 blue right-pointing triangle; Wullschleger et al., 2006 blue right-pointing triangle). We tested the idea that aberrant nuclear pre-tRNA metabolism in sla1-Δ cells may contribute to the stress responses. Ectopic expression of los1+, which encodes a major tRNA exporter, suppresses the decrease in pre-tRNAs in sla1-Δ cells, slow growth, and up-regulation of AAM mRNAs. Thus a genetic response to altered nuclear pre-tRNA metabolism in S. pombe cells lacking sla1+ leads to nutritional sensitivity, growth inhibition, and induction of AAM mRNAs that is offset by Los1p/Xpo-t.

RESULTS

Deletion of sla1+ causes stress-response phenotypes: up-regulation of AAM genes, slow growth in Edinburgh minimal media, and heat sensitivity

Microarray analysis was done on RNA from our wild-type (WT) strain (yAS99, leu1-32 ura4-Δ; Table 1) and its isogenic sla1-Δ strain (yAS113, sla1leu1-32 ura4-Δ) grown in the standard rich media used for S. pombe—yeast extract with supplements (YES) media (Supplemental Figure S1). This revealed that sla1-Δ cells have elevated levels of a set of mRNAs that significantly overlap (P = −3e−12) with genes in an AAM module previously defined (Tanay et al., 2005 blue right-pointing triangle). Additional microarray analysis showed that most of the same AAM and other mRNAs were found significantly elevated in the sla1-Δ cells when grown in EMM (Supplemental Figure S1). S. pombe AAM genes are enriched for an upstream DNA sequence, TGACT, which is similar to the binding sites for budding yeast Gcn4p (see supporting Figure 6 in Tanay et al., 2005 blue right-pointing triangle).

TABLE 1:
Yeast strains.

We examined some of the S. pombe AAM mRNAs by Northern analysis: C132.04 (glutamate dehydrogenase, gdh2; involved in aspartate, proline, nitrogen, and glutamate metabolism), ppr1+ (involved in oxidative stress response), C1105 (lysine biosynthesis), and C56E4.03 (amino acid aminotransferase). By comparing to rRNA, which provides a loading control, this confirmed the up-regulation in sla1-Δ detected by microarray and showed that ectopic expression of sla1+ from a plasmid reversed it (Figure 1A).

FIGURE 1:
Stress-response phenotypes of sla1-Δ cells, including AAM gene expression, involve genetic interactions with atf1+ and pcr1+. (A) Ectopic sla1+ suppresses up-regulation of AAM genes in the sla1 mutant. Northern blot of 10 μg of ...

Considering up-regulation of AAM genes, it might be expected that sla1-Δ cells may display a growth advantage in conditions that cause amino acid starvation, such as in 3-aminotriazol (3AT; Struhl and Davis, 1977 blue right-pointing triangle). However, the slow growth of sla1-Δ relative to wild type was unaffected by 3AT (data not shown). Moreover, although WT and sla1-Δ cells grew comparably in rich (YES) media, sla1-Δ exhibited slow growth in EMM, the standard minimal media for S. pombe, which was relieved by ectopic sla1+ on a plasmid (10-fold dilutions; Figure 1B). EMM is defined media that contains dextrose, amino acids, vitamins, and other supplements that does not cause starvation-induced stress responses such as mating or sporulation (Forsburg, 2003 blue right-pointing triangle). We also deleted sla1+ in other genetic backgrounds, and they revealed slow growth in EMM (but not YES) relative to their isogenic sla1+ parent strains (Figure 1, B vs. vs.D,D, Supplemental Data, and Supplemental Figure S2). Strain-specific growth variability in EMM in each strain was worsened by sla1+ deletion (Supplemental Figure S2).

Human La (hLa) also suppressed the growth deficiency of sla1-Δ in EMM (Figure 1B). hLaΔSBM, which lacks a short basic motif that inhibits pre-tRNA processing in S. pombe (Intine et al., 2000 blue right-pointing triangle), reproducibly suppressed sla1-Δ slow growth a bit more than hLa (data not shown). Because human La can suppress the pre-tRNA processing defects of sla1-Δ cells and functionally reverse pre-tRNA processing- and nuclear trafficking–related phenotypes (Intine et al., 2000 blue right-pointing triangle; 2002 blue right-pointing triangle; Huang et al., 2006 blue right-pointing triangle; Bayfield et al., 2007 blue right-pointing triangle; Bayfield and Maraia, 2009 blue right-pointing triangle), this suggested that the slow growth of sla1-Δ is due to defective pre-tRNA metabolism.

Sla1p acts in part via atf1+ and pcr1+ to down-regulate expression of AAM genes and promote growth in EMM and at elevated temperature

As noted, S. pombe and S. cerevisiae AAM genes share similar upstream DNA, and Atf1p and Pcr1p are candidate Gcn4p homologues in S. pombe. We deleted sla1+ in existing atf1-Δ, pcr1-Δ, and parent strains (Jia et al., 2004 blue right-pointing triangle) and examined AAM mRNA levels by Northern analysis (Figure 1C, each loaded at 1× and 2× amounts). Using rpl8+ mRNA as a loading control with sequential probings of the same blots, we found that atf1+ or pcr1+ deletion in sla1+-replete cells decreased C132.04 and ppr1+ mRNA expression comparably relative to the WT parental strain (SPJ83, lanes 1–6), whereas deletion of both atf1+ and pcr1+ did not further decrease these mRNAs (lanes 7 and 8). Thus Atf1p/Pcr1p appears to drive expression of these genes in rich (YES) media (Figure 1C). Similar results were found in EMM, consistent with our microarray and Northern analyses (data not shown).

Although atf1+ or pcr1+ deletion also decreased C132.04 and ppr1+ mRNAs in sla1-Δ cells, the negative effects on these mRNAs were greater for atf1 than pcr1 (Figure 1C, lanes 9–14). Quantification (data not shown) revealed that deletion of atf1+ or pcr1+ in sla1- decreased these mRNAs ~1.7-fold more than their deletion in the WT (SPJ83). Whereas C1105 mRNA is negatively affected by sla1+, it appears to be unaffected by atf1+ or pcr1+ deletion (Figure 1C). isp6+ (induced during sexual differentiation or nitrogen starvation) was elevated in sla1-Δ cells relative to WT (Figure 1C; compare lanes 1 and 2 with 9 and 10), confirming the microarray data, and sensitive to atf1+ deletion in sla1-Δ but less so to pcr1+ deletion (Figure 1C, lanes 9–14). We conclude that up-regulation of a subset of AAM genes in sla1 cells depends on Atf1p and Pcr1p, in some cases to different degrees, whereas others are up-regulated independent of Atf1p and Pcr1p, suggesting that other transcription factors are involved.

We next asked whether deletion of atf1+ or pcr1+ suppresses the slow growth of sla1-Δ (Figure 1D). Deletion of atf1+ or pcr1+ from sla1-Δ or its isogenic WT strain improves growth in EMM (Figure 1D), consistent with roles for atf1+ and pcr1+ in general growth inhibition on EMM. Deletion of sla1+ had little effect on atf1 or pcr1 growth, consistent with the idea that atf1+ and pcr1+ antagonize growth derepression by sla1+.

Whereas sla1-Δ cells grow normally in YES, they exhibit slow growth at 37°C, and this inhibition is suppressed by deletion of either atf1+ or pcr1+ (Figure 1D).

sla1 cells are defective in leucine uptake and hypersensitive to NH4Cl and rapamycin

We analyzed different ingredients of YES and EMM for effects on sla1 cell growth (data not shown) and found that the NH4Cl in EMM was inhibitory. Replacing NH4+ with proline alleviated growth inhibition of sla1 cells (Figure 2A), which is intriguing since proline is believed to constitute a relatively poor nitrogen source (Weisman et al., 2005 blue right-pointing triangle, 2007 blue right-pointing triangle). Addition of NH4+ to YES also resulted in very significant growth inhibition of sla1 (Figure 2A). Thus growth of sla1 cells is highly sensitive to NH4Cl.

FIGURE 2:
sla1 cells are sensitive to NH4+ and deficient in leucine uptake. (A–C) Cells were grown in liquid media as indicated, and then 10-fold serial dilutions were spotted on plates containing media indicated above and incubated at 32°C ...

Further analysis suggested impaired leucine uptake by our sla1 cells, which carry metabolic markers leu1 and ura4. Providing leu1+ (on pRep3X plasmid) suppressed sla1 slow growth in EMM (Figure 2B), whereas providing excess leucine in the media did not (data not shown). By contrast, providing ura4+ suppressed the growth phenotype to a far less extent than did leu1+ on the otherwise identical plasmid (Figure 2C).

The data suggested deficient leucine uptake by sla1 cells, worthy of more direct examination. Leucine uptake is regulated by the TOR pathway (Weisman et al., 2005 blue right-pointing triangle). Therefore, as a control, we created a tor1-Δ mutant in the same genetic background that was expected to be deficient in leucine uptake (Weisman et al., 2005 blue right-pointing triangle). We measured uptake in EMM containing either NH4+ or proline (Sychrova et al., 1989 blue right-pointing triangle; Karagiannis et al., 1999 blue right-pointing triangle; Matsumoto et al., 2002 blue right-pointing triangle; Weisman et al., 2005 blue right-pointing triangle). Figure 2D (top) shows that sla1 cells are quite defective in leucine uptake in EMM (containing NH4+), even relative to the tor1 mutant. The rate of leucine uptake by sla1 cells appeared to be less compromised in proline than in NH4+ (Figure 2D; compare top and bottom). Note that whereas decreased leucine uptake characterizes sla1 cells, other limitations and/or parameters may contribute to their slow growth.

Rapamycin-mediated inhibition of TOR is manifested by growth inhibition of S. cerevisiae and mammalian cells, including of tumors, although some develop resistance (Choo and Blenis, 2009 blue right-pointing triangle; Gibbons et al., 2009 blue right-pointing triangle; Zhou et al., 2010 blue right-pointing triangle). Whereas wild-type S. pombe is naturally resistant to rapamycin, regulation of leucine uptake is sensitive to rapamycin (Weisman et al., 2005 blue right-pointing triangle). We found that sla1 mutants are sensitive to rapamycin relative to their isogenic WT strains. Complementation of rapamycin sensitivity of sla1 by ectopic sla1+ was partial but significant (Figure 3A, compare 2 and 3) and appeared to depend on the activity of the nmt1 promoter driving Sla1p expression, which is partially repressible by thiamine (Figure 3A). The nmt1 promoter remains significantly active in the presence of thiamine (Forsburg, 1993 blue right-pointing triangle). It was previously found that pRep4X-sla1+ in sla1 cells produces fourfold higher Sla1p levels than produced from the chromosomal sla1+ locus (R. V. Intine and R. J. Maraia, unpublished results). When sla1 was grown in EMM lacking thiamine, minimal complementation of rapamycin sensitivity by ectopic sla1+ was observed relative to WT (Figure 3A, 3). Thiamin significantly improved complementation of rapamycin sensitivity by ectopic sla1+ (Figure 3A, 5). The data suggest that S. pombe growth inhibition by rapamycin is sensitive to Sla1p levels.

FIGURE 3:
sla1 cells are sensitive to rapamycin and exhibit decreased protein synthesis. (A, B) Cells were grown in liquid EMM medium with essential supplements, and 10-fold serial dilutions were spotted on the plates containing different media as indicated ...

Different laboratory strains of S. pombe vary in genetic polymorphisms (Iben et al., 2011 blue right-pointing triangle) and sensitivity to NH4+ versus proline (e.g., see Figure 1, B vs. vs.D,D, and Supplemental Figure S2). To examine rapamycin sensitivity in another genetic background, we deleted sla1+ from SPG17 (Table 1), a laboratory “wild-type” strain (Grewal and Klar, 1997 blue right-pointing triangle; Irvine et al., 2009 blue right-pointing triangle; Smith et al., 2010 blue right-pointing triangle). Figure 3B shows that the sla1-deleted SPG17, designated CY1604, is sensitive to rapamycin relative to its parent SPG17 and to CY1627, in which sla1+ was reintroduced to its chromosomal locus.

It is remarkable that, whereas leu1+ rescues the slow growth phenotype of sla1 mutants in EMM with NH4+ (Figure 2B), leu1+ does not rescue the rapamycin sensitivity (Figure 3C, 2 and 3). It is also notable that sla1 cells appear less sensitive to rapamycin in EMM with proline than with NH4+ (Figure 3C, 2–5), suggesting that NH4+ contributes to the sensitization of sla1 cells to rapamycin and that Sla1p promotes leucine uptake and rapamycin resistance via distinct mechanisms.

Because amino acid and tRNA metabolism are altered in sla1 cells we expected that slow growth may be accompanied by decreased protein synthesis. We therefore measured 35S-methionine (35S-met) incorporation into protein during log-phase growth in EMM with NH4+ or proline (Figure 3D). Quantitation revealed that 35S incorporation was lower in sla1 than in WT in EMM with NH4+ but not with proline (Figure 3D; see normalized values under lanes, left), consistent with sla1 growth in these media. We found no difference in 35S-met uptake between sla1 and WT measured under the same conditions as 35S-met incorporation (data not shown). Thus 35S-met incorporation in sla1 reflects decreased translation rather than limitation of methionine. Slow growth coupled with decreased translation in sla1 cells is consistent with involvement of TOR signaling.

Genetic interactions between sla1+ and TOR

S. pombe has two TOR kinases, Tor1p and Tor2p, and whereas tor2+ is essential for vegetative growth, tor1+ is nonessential but is required for normal responses to starvation and other stress (Kawai et al., 2001 blue right-pointing triangle; Weisman and Choder, 2001 blue right-pointing triangle). As noted earlier, leu1 mutants are sensitive to rapamycin, dependent on inhibition of tor1 dependent amino acid uptake (Weisman et al., 2005 blue right-pointing triangle). Our data that show loss of sla1+ causes leucine uptake deficiency, as well as NH4+ and rapamycin sensitivity, strongly suggest genetic interactions between sla1+ and tor1+. Whereas the tor1 mutant does not exhibit growth deficiency in NH4+, this deletion has an additive effect on growth in combination with sla1 mutation (Figure 4A). This suggests that tor1+ and sla1+ have overlapping yet distinct functions during vegetative growth.

FIGURE 4:
Genetic interactions between sla1+ and the TOR pathway. Cells were grown in liquid EMM with essential supplements, and 10-fold serial dilutions were spotted onto the indicated media and incubated at 32°C for 2–6 d. (A) Deletions of sla1 ...

S. pombe tsc1+ and tsc2+ are homologues of tuberous sclerosis genes, which have been linked to the TOR pathway, tumorigenesis, and nutrient availability (Serfontein et al., 2010 blue right-pointing triangle). tsc1+ and tsc2+ negatively regulate tor2+, and their disruption leads to amino acid uptake deficiency (van Slegtenhorst et al., 2004 blue right-pointing triangle; Weisman et al., 2005 blue right-pointing triangle). We therefore deleted tsc1+ in our WT and sla1 cells (Figure 4B). The tsc1 mutant exhibited slow growth in NH4+ but not proline, and this phenotype was exacerbated in the sla1 cells (Figure 4B). This suggests that sla1+ and tsc1+ act in parallel to promote growth in EMM. The cumulative data support the existence of genetic interactions between sla1+ and the TOR pathway.

Ectopic expression of los1+ suppresses slow growth and up-regulation of AAM genes in sla1 cells

Accumulation of aberrant pre-tRNA activates a process termed nuclear surveillance in S. cerevisiae via GCN4 derepression (Qiu et al., 2000 blue right-pointing triangle). This GCN4mediated response is reversed by ectopic expression of either RNase P, which processes pre-tRNAs at their 5′ ends, or LOS1, the major tRNA nuclear export factor, and further consistent with this, los1-Δ cells exhibit derepression of GCN4 (Qiu et al., 2000 blue right-pointing triangle). Moreover, this response can be offset by overexpression of the S. cerevisiae La-homologous protein Lhp1 (Anderson et al., 1998 blue right-pointing triangle; Calvo et al., 1999 blue right-pointing triangle). Because sla1 cells exhibit irregularities in pre-tRNA processing and our data suggest that los1+ activity is limiting in these cells (see later discussion), we asked whether overexpression of S. pombe los1+ would offset (suppress) their slow growth. Because LOS1 overexpression can be severely toxic (Hellmuth et al., 1998 blue right-pointing triangle; Sopko et al., 2006 blue right-pointing triangle), we titrated the activity of the nmt1 promoter driving its expression, with thiamine, including 0.05 μM thiamine, an intermediate level that partially represses nmt1 promoter activity (Javerzat et al., 1996 blue right-pointing triangle). Figure 5A shows that at 0.05 μM thiamine, los1+ suppresses the slow growth of sla1 cells. Because 15 μM thiamine is used widely in S. pombe with no reports of toxicity, the loss of suppression in Figure 5A, panel 4 versus panel 3, appears to be due to loss of los1+ expression as a result of more efficacious repression of the nmt1 promoter. No suppression is seen without thiamine (Figure 5A, 2), likely due to toxicity of high-level los1+ overexpression (Hellmuth et al., 1998 blue right-pointing triangle; Sopko et al., 2006 blue right-pointing triangle), since under these conditions, los1+ expression is indeed much higher (Figure 5B).

FIGURE 5:
Ectopic los1+ suppresses slow growth and up-regulation of AAM genes in the absence of sla1+. (A) Effect of thiamine-mediated titration of nmt1-los1+ expression on growth of sla1 cells. Growth assay was done as for Figure 4; strains are yAS99 ...

We used Northern analysis to confirm that 0.05 μM thiamine partially repressed expression of los1+ from the ectopic nmt1 promoter (Figure 5B). As expected in no thiamine, los1+ mRNA was expressed at high levels from nmt1-los1+ in the WT and sla1 cells (Figure 5B, lanes 5–8 vs. 1–4). Using rpl8+ mRNA as a loading control in Figure 5B, middle, we see that lanes 9–16 show that at 0.05 μM thiamine, los1+ mRNA levels were higher in nmt1-los1+ cells (lanes 13–16) than with empty vector (+V, lanes 9–12). Quantitation of the los1+:rpl8+ mRNA ratios in lanes 11/12 and 15/16 confirmed this (Figure 5B, numbers under lanes). The sla1 cells with nmt1-los1+ expressed los1+ mRNA at 1.9-fold higher levels than in the same cells with empty vector (1.3/0.7 = 1.9-fold; see lanes 15 and 16 vs. 11 and 12, quantitation under lanes). Thus a near-twofold increase in los1+ expression appears to be sufficient to suppress slow growth of sla1 cells in EMM.

We wanted to determine whether nmt1-los1+–mediated suppression of slow growth was accompanied by suppression of AAM mRNA levels. We examined AAM mRNAs from cells transformed with empty vector or ectopic nmt1-los1+ (Figure 5C), grown in 0.05 μM thiamine and under the same conditions as for Figure 5, A and B. Lanes 1–4 of Figure 5C, top, show that ectopic nmt1-los1+ in WT cells does not affect C132.04 mRNA expression. In striking contrast, the highly elevated C132.04 mRNA in sla1 cells (Figure 5C, lanes 5 and 6) was completely repressed by ectopic nmt1-los1+ (lanes 7 and 8). Ectopic nmt1-los1+ also suppressed the up-regulation of C1105 and ppr1+ mRNA in sla1 (Figure 5C). Therefore overexpression of los1+ suppresses both slow growth and up-regulation of AAM genes in the sla1 mutant. As data to be presented suggest, ectopic nmt1-los1+ also complements a tRNA export deficiency in these same sla1 cells in which it suppresses the AAM mRNA up-regulation. nmt1-los1+ also suppresses up-regulation of AAM genes in the sla1 los1 double mutant (Figure 5C, lanes 13–16). Figure 5 strengthens the idea that the stress-related growth inhibition and AAM gene up-regulation phenotypes of sla1 are caused by defects in nuclear pre-tRNA metabolism. Consistent with this, deletion of sla1+ and los1+ have additive effects on growth (Figure 6A), verifying genetic interaction.

FIGURE 6:
Ectopic los1+ stabilizes tRNA precursors in the absence of sla1+. (A) Growth in EMM with NH4+ (left) or proline (right) of various strains as indicated. (B) Northern analysis of small RNAs from foregoing strains transformed with empty pRep4X (V) or los1 ...

Ectopic expression of los1+ increases low pre-tRNA levels in sla1 cells and suppresses imbalance of pre-tRNA intermediates

Given the foregoing findings that reveal a relationship between los1+ and sla1+, it might be expected that ectopic los1+ would affect the pattern of pre-tRNAs in sla1 cells. We assessed this using the same RNA samples in Figure 6B as used for Figure 5C. We examined the intron-containing pre-tRNALysCUU, which is a standard to follow pre-tRNA metabolism in sla1 cells (Van Horn et al., 1997 blue right-pointing triangle; Intine et al., 2000 blue right-pointing triangle; 2002 blue right-pointing triangle; Huang et al., 2006 blue right-pointing triangle; Bayfield et al., 2007 blue right-pointing triangle). An intron probe detects pre-tRNALysCUU intermediates that differ by whether or not their 5′ leaders and/or 3′ trailers have been removed (Van Horn et al., 1997 blue right-pointing triangle; Huang et al., 2006 blue right-pointing triangle; Bayfield and Maraia, 2009 blue right-pointing triangle). The upper band represents nascent pre-tRNA that contains an intact 5′ leader and 3′ trailer. The lowest band has lost both the 5′ leader and the 3′ trailer. The middle band can be a mix of species that lack either an intact 5′ leader or the 3′ trailer, as indicated to the right of Figure 6B, including those that have been nibbled by 3′ exonucleases (Maraia and Lamichhane, 2011 blue right-pointing triangle). The uppermost band does not accumulate as an intact species in sla1 cells due to instability (Van Horn et al., 1997 blue right-pointing triangle; Intine et al., 2000 blue right-pointing triangle; 2002 blue right-pointing triangle; Huang et al., 2006 blue right-pointing triangle; Bayfield et al., 2007 blue right-pointing triangle; reviewed in Maraia and Lamichhane, 2011 blue right-pointing triangle). Subtle mobility differences of upper and middle bands can be best appreciated in the Figure 6B, top, by comparing lanes 4/5 and 8/9.

Los1p is a major nuclear exporter of tRNA in yeast; its vertebrate homologue is exportin-t (Xpo-t), and intron-containing pre-tRNAs are substrates for nuclear export by Los1p/Xpo-t (reviewed in Hopper, 2006 blue right-pointing triangle). Deficiencies in this export pathway are reflected by alteration of the pattern of pre-tRNA intermediates because Los1p/Xpo-t prefers to bind end-processed tRNA species, that is, the intron-containing lower band (L) in Figure 6B. Accumulation of the unspliced L band in los1 mutants (Hopper et al., 1980 blue right-pointing triangle; Hurt et al., 1987 blue right-pointing triangle) reflects that tRNA splicing occurs in the cytoplasm of S. cerevisiae (Yoshihisa et al., 2003 blue right-pointing triangle; Hopper, 2006 blue right-pointing triangle). Thus a distinctive pattern of intron-containing pre-tRNAs is observed in cells lacking Los1p because its favored ligand, pre-tRNA with matured 5′ and 3′ ends, specifically accumulates (Arts et al., 1998 blue right-pointing triangle; Lipowsky et al., 1999 blue right-pointing triangle; also see Sarkar and Hopper, 1998 blue right-pointing triangle; Grosshans et al., 2000 blue right-pointing triangle; Hopper and Shaheen, 2008 blue right-pointing triangle). We quantified the ratio of the bottom to top or middle bands in Figure 6B (top, ratios given under the lanes). Although this ratio is ~0.3 in wild-type cells, set as the control value of 1.0 and 0.93 in lanes 1 and 2 respectively, it increases 2.64-fold in our los1 cells (compare lanes 1 and 2 with 9 and 10). Moreover, the L band is depleted in lanes 11 and 12 relative to 9 and 10, and the ratio is more similar to WT, indicating that in 0.05 μM thiamine, nmt1-los1+ promotes tRNA export. The data provide evidence that our los1-Δ cells are indeed defective for tRNA export as expected and that tRNA splicing occurs in the cytoplasm of S. pombe, consistent with other data (Intine et al., 2002 blue right-pointing triangle; Bayfield et al., 2007 blue right-pointing triangle). It is remarkable that this ratio increases 2.6-fold in sla1-Δ (lanes 5 and 6), suggesting functional limitation of Los1p-mediated tRNA export activity in these cells. Of importance, this ratio normalizes in sla1-Δ cells to near WT levels upon expression of nmt1-los1+ in 0.05 μM thiamine (lanes 7 and 8).

The ratio and abundance of the pre-tRNALysCUU intermediates differ in sla1 and WT cells (Figure 6B, lanes 1/2 and 5/6). The top band is diminished due to lack of the stabilizing effects of La protein in sla1 cells. The L band is relatively prominent in sla1 cells (Figure 6B, compare lanes 6 and 2). The high ratio of the L/M bands in lanes 5 and 6 relative to lanes 7 and 8 provides evidence that nuclear export of the L species is limiting in sla1 cells. Furthermore, ectopic los1+ unexpectedly increased the amount of the M species pre-tRNA in sla1 cells to a level that more resembles that in the WT cells (Figure 6B, lanes 1/2 and 7/8). The unexpected increase of the M band by ectopic los1+ in lanes 7 and 8 relative to 5 and 6 suggests that Los1p has a stabilizing effect on 5′ leader–containing, 3′ end–processed pre-tRNALysCUU in sla1 cells. The cumulative data argue that ectopic los1+ helps alleviate response to aberrant nuclear pre-tRNA metabolism in sla1 cells.

We stripped the blot in Figure 6B, top (data not shown), and rehybridized with a probe specific for the 5′ leader of pre-tRNALysCUU (Figure 6B, middle). This revealed that the 5′ leader–containing species is at relatively low levels in sla1 cells (lanes 5 and 6) but more prominent in the sla1+los1+ cells (Figure 6B, middle, lanes 7 and 8; see quantitation normalized for loading by U5 small nuclear RNA [snRNA] levels under the bottom lanes). These data suggest that overexpression of los1+ stabilizes pre-tRNA in the absence of Sla1p, potentially compensating, at least in part, for the lack of Sla1p. Based on gel migration and binding properties of Los1p/Xpo-t (see Discussion), we suspect that the los1+-stabilized pre-tRNA in lanes 7 and 8 contains 3′ CCA, consistent with 3′ exonucleases mediating CCA turnover in S. cerevisiae nuclei (Copela et al., 2008 blue right-pointing triangle).

DISCUSSION

Here we report consequences of disrupting the gene encoding the S. pombe La protein on genome-wide mRNA expression and associated metabolic parameters. The S. pombe response to sla1+ deletion involves a network of genetic outputs that affects growth and metabolism. Altered pre-tRNA metabolism is a principal effect of sla1+ deletion, and this appears to be a signal for the response, similar to but distinct from the nuclear surveillance system previously described for S. cerevisiae (Qiu et al., 2000 blue right-pointing triangle). Thus the conclusion that emerges is that in S. pombe sla1+ regulates AAM mRNA production through its effects on nuclear tRNA processing and maybe nuclear export.

La proteins associate with, stabilize, and promote the nuclear retention, proper order of 5′ and 3′ processing, and folding of pre-tRNAs, affording opportunity for processing, nucleotide modifications, and proper folding in an orderly manner (Yoo and Wolin, 1997 blue right-pointing triangle; Intine et al., 2002 blue right-pointing triangle; Chakshusmathi et al., 2003 blue right-pointing triangle; Copela et al., 2006 blue right-pointing triangle; Huang et al., 2006 blue right-pointing triangle; Bayfield et al., 2007 blue right-pointing triangle; Bayfield and Maraia, 2009 blue right-pointing triangle; Maraia and Lamichhane, 2011 blue right-pointing triangle).

Despite involvement of La with specific mRNAs (Cardinali et al., 2003 blue right-pointing triangle; Intine et al., 2003 blue right-pointing triangle; Trotta et al., 2003 blue right-pointing triangle; Costa-Mattioli et al., 2004 blue right-pointing triangle; Brenet et al., 2009 blue right-pointing triangle), our results indicate loss of its nuclear function in pre-tRNA metabolism as the cause of the sla1-Δ phenotypes. Evidence for this is that the altered pattern of pre-tRNA intermediates in sla1-Δ cells was accompanied by apparent decrease in los1+-mediated tRNA nuclear export activity and that overexpression of los1+ reversed these effects, as well as AAM gene up-regulation and slow growth of sla1-Δ cells. Limitation of Los1 has also been observed in S. cerevisiae strains that exhibit stress (DNA damage) response (Ghavidel et al., 2007 blue right-pointing triangle) and perturbations of pre-tRNA biogenesis (Karkusiewicz et al., 2011 blue right-pointing triangle).

Aberrant tRNA processing in sla1 cells and a nuclear surveillance–like response

Defects in tRNA processing or nuclear export in S. cerevisiae lead to a stress response termed nuclear surveillance that induces AAM expression via GCN4 (Qiu et al., 2000 blue right-pointing triangle). S. pombe AAM genes with promoters similar to Gcn4p-binding sites (Tanay et al., 2005 blue right-pointing triangle) are activated by sla1+ deletion. Suppression by los1+ is consistent with the idea that a sensing component of the S. pombe response is via nuclear pre-tRNA. We note that some effects of sla1+ deletion may reflect low levels of mature tRNA or increases in uncharged tRNA, as initially considered and later dismissed for the GCN4 response (Vazquez de Aldana et al., 1994 blue right-pointing triangle; Qiu et al., 2000 blue right-pointing triangle), and we cannot exclude this possibility.

Stress response analogy may extend further. LOS1 and GCN4 are involved in DNA damage response that leads to a decrease in the G1 cyclin,Cln2p (Ghavidel et al., 2007 blue right-pointing triangle). sla1 cells are hypersensitive to the DNA-damaging agent ethyl methanesulfonate (data not shown) and have approximately twofold less cyc17+/cig2+ mRNA relative to WT cells in EMM but not YES (Supplemental Figure S1). Indeed, unexpected sensitivity to alterations of Los1p levels was evident in some of our experiments. For example, whereas pre-tRNA distribution was distorted in los1-Δ cells relative to wild type, ectopic nmt1+-los1+ in 0.05 μM thiamine did not fully complement this (Figure 6B), presumably because Los1p levels produced by nmt1+-los1+ do not match that in wild-type los1+ cells. Consistent with this assumption, los1+ mRNA levels were significantly lower in the los1-Δ +nmt1+-los1+ cells than in the wild-type los1+ cells (data not shown). These findings support the idea that regulation of Los1p homeostasis is critical to normal S. pombe metabolism.

Although our data reflect likeness to S. cerevisiae nuclear surveillance, there are distinctions. The GCN4 response is triggered by excess unprocessed pre-tRNA, whereas sla1 cells have a deficiency, suggesting that imbalance of pre-tRNA levels or processing is a commonality. Second, no genome-wide mRNA profiling of S. cerevisiae lhp1-Δ or analysis of sensitivity to NH4+ has been reported. Third, the two yeasts would appear to differ in response to La deletion since no growth deficiency was observed for S. cerevisiae lhp1-Δ. In addition, whereas AAM induction in S. cerevisiae occurs with amino acid starvation, our sla1-Δ cells exhibit AAM induction in EMM, a standard growth medium that normally does not induce starvation-related responses. Finally, we tested the S. cerevisiae lhp1-Δ mutant, and it did not show growth deficiency under amino acid starvation or in minimal medium (data not shown).

Gcn4p-like function in S. pombe is likely performed by multiple AP-1–related TFs

Our data show that up-regulation of only a subset of the AAM genes tested in sla1 cells is dependent, at least in part, on Atf1p and/or Pcr1p. Deletions of sla1+ and atf1+ or pcr1+ show additive effects on some mRNAs for which atf1+ and pcr1+ would appear to act independently of each other. Because Pcr1p and Atf1p perform overlapping and distinct functions (Sanso et al., 2008 blue right-pointing triangle), Sla1p may antagonize AAM gene transcription either independently or as a Atf1/Pcr1p heterodimer. Further, since some mRNAs up-regulated in sla1 are not affected by atf1+ or pcr1+, these may be controlled by other TFs. In either case this appears to be different from the situation in S. cerevisiae, in which a single TF, Gcn4p, induces all of the target genes (Natarajan et al., 2001 blue right-pointing triangle).

Another distinction is with regard to Atf1/Pcr1 TF activity, controlled by MAP kinase Spc1/Sty1 under conditions of extreme stress, such as oxidative stress during starvation (Nemoto et al., 2010 blue right-pointing triangle). There is no apparent involvement of Spc1/Sty1 in our system, based on Sty1p phosphorylation (data not shown). In addition, deleting spc1+/sty1+ did not restore growth of sla1 cells in EMM (data not shown). Therefore a Sty1p-independent function of Atf1/Pcr1 (Lawrence et al., 2007 blue right-pointing triangle) is likely involved in AAM gene induction, as well as other TFs.

S. pombe mating program is partially derepressed in sla1 cells

Microarray and Northern analysis of sla1 cells in EMM revealed partial derepression of mRNAs that are up-regulated during mating (Supplemental Data), including pcr1+ mRNA, pas1+ (mating-specific cyclin), isp6+ (transcribed during sexual differentiation and induced by nitrogen starvation; Figure 1C), and fbp1+ (data not shown). Atf1p and Pcr1p up-regulate fbp1+ and ste11+, induced in meiosis along with cgs1+ involved in sexual differentiation (Takeda et al., 1995 blue right-pointing triangle). With regard to links to TOR, Tor2p has been found associated with Ste11p and Mei2p, inhibiting sexual differentiation (Alvarez and Moreno, 2006 blue right-pointing triangle). This suggests that the stress- and mating-related phenotypes of sla1 cells may be linked.

Overlap between Sla1p and TOR

Growth of wild-type S. pombe is not inhibited by rapamycin, but that of leu1deficient cells is, due to inhibition of tor1+-mediated amino acid uptake (Weisman et al., 2005 blue right-pointing triangle). Ectopic leu1+ suppressed slow growth of sla1-Δ , whereas excess leucine in the media did not, consistent with a defect in leucine uptake. Indeed, the sla1 mutant is hypersensitive to rapamycin. When sla1 cells were grown in EMM with NH4+, the translation rate was only ~30% relative to isogenic WT cells, consistent with TOR involvement. Genetic analysis further suggested that Sla1p acts in parallel with Tsc1p and Tor1p to promote growth in EMM.

We examined mRNA levels for the putative permeases 7G5.06 and isp5+, orthologous to S. cerevisiae GAP1, and C869.10, orthologous to proline transporter PUT4. Although these were at similar levels in sla1 and WT cells, EMM resulted in ~2.5-fold decrease of ptr2+ mRNA (nitrogen-repressible peptide transporter). However, ectopic ptr2+ did not restore growth of sla1, whereas ectopic isp5+ expression did, albeit partially (Supplemental Figure S3A). In summary, decreased leucine uptake and NH4+ sensitivity appear to contribute to slow growth of sla1 cells.

We observed that sla1 cells formed fewer colonies and colonies of smaller size than sla1+ (Figure 1B), suggesting deficiencies in two different growth parameters—plating efficiency and proliferation. Plating on proline was similar for sla1+ and sla1, with ~50% cell recovery relative to YES (Supplemental Table S1). By contrast, plating efficiency of sla1 was reproducibly <0.01% on NH4+ but much higher for sla1+ (Supplemental Table S1). Thus sla1 cells suffer from severe plating deficiency in the presence of NH4+.

Sensitivity of leu1 mutants to NH4+ is due to impaired amino acid import imposed by pub1+ (Karagiannis et al., 1999 blue right-pointing triangle). Deletion of pub1+ suppressed the slow growth (colony size) of sla1 much more so than the low plating efficiency (Supplemental Figure S3B). Therefore slow growth of sla1 in NH4+ depends on pub1+, and this appears to be genetically separable from low plating efficiency.

Finally, we note the potential importance of C132.04 induction in sla1 cells and suppression by ectopic los1+ (Figure 5C). This mRNA encodes glutamate dehydrogenase (gdh2+), a central enzyme at the boundary of carbon and NH4+ metabolism in the TOR pathway (Tate and Cooper, 2003 blue right-pointing triangle; Tate et al., 2006 blue right-pointing triangle; Choo et al., 2010 blue right-pointing triangle).

los1+ contributes to pre-tRNA metabolism in the absence of Sla1p

That the lower band, L, in the top of Figure 6B accumulates in los1-Δ cells and is decreased by ectopic los1+ reflects that this intermediate is a substrate for Los1p-mediated export. That ectopic los1+ leads to a reduction in the ratio of the L:U bands is consistent with the idea that Los1p nuclear export activity is quite limiting in sla1-Δ cells. Although tRNA export limitation was noted previously (Arts et al., 1998 blue right-pointing triangle; Qiu et al., 2000 blue right-pointing triangle; Kuersten et al., 2002 blue right-pointing triangle; Pierce et al., 2010 blue right-pointing triangle), our data are distinguishable since overexpression of los1+ in sla1-Δ not only affects the level of the 5′ and 3′ processed, intron-containing pre-tRNA (L band), but also increases the levels of the more premature, intron-containing pre-tRNA intermediates (Figure 6B). We believe that overcoming the Los1p limitation is quite significant in sla1-Δ cells, which lack pre-tRNA 3′ end protection and in which nuclear surveillance pre-tRNA 3′ end decay is active (Maraia and Lamichhane, 2011 blue right-pointing triangle).

We propose that Los1p binding to pre-tRNA provides an important activity offsetting pre-tRNA 3′ end–mediated decay in sla1-Δ cells. The 3′ exonucleases that act on pre-tRNAs can also digest the CCA ends of nuclear pre-tRNAs (Copela et al., 2008 blue right-pointing triangle). A 3′ protective activity of Los1p/Xpo-t should not be unexpected since it is a tRNA CCA-OH 3′ end–binding protein (Cook et al., 2009 blue right-pointing triangle), as reflected by a requirement of CCA on its cargo (Arts et al., 1998 blue right-pointing triangle; Lipowsky et al., 1999 blue right-pointing triangle). A structure of S. pombe Xpo-t/Los1p and tRNA shows a binding pocket for a 3′ overhang, CCA-3′ OH (Cook et al., 2009 blue right-pointing triangle). Most of the binding to the tRNA 3′ region is sequence independent and includes an Asp side chain (D178) contact to the 3′ OH group, somewhat similar to the invariant Asp side chain of La (hLa D33) that binds, sequesters, and protects the 3′ OH terminus of pre-tRNA from 3′ exonucleases (Huang et al., 2006 blue right-pointing triangle; Teplova et al., 2006 blue right-pointing triangle).

Pre-tRNAs are susceptible to 3′-mediated decay in sla1-Δ cells (Maraia and Lamichhane, 2011 blue right-pointing triangle), which, as reported here, are limited for los1+-mediated tRNA export. On the basis of this limitation, the binding properties of Xpo-t/Los1p, and the presence of intron-containing nuclear pre-tRNAs with CCA3′ OH (Wolfe et al., 1996 blue right-pointing triangle), we propose that ectopic Xpo-t/Los1p in sla1 cells binds those pre-tRNAs that would otherwise be susceptible and stabilizes them from 3′ decay, affording the opportunity for modifications and/or proper folding and export rather than degradation. Increased levels of pre-tRNAs in sla1+los1+ cells observed on Northern blots is consistent with this.

MATERIALS AND METHODS

cDNA microarray analysis

Total RNA for microarray analysis was obtained from early-log-phase (OD600 = 0.2–0.4) cells grown either in YES or EMM media with NH4Cl or proline as the nitrogen source and prepared as described (Lyne et al., 2003 blue right-pointing triangle). RNA labeling, microarray hybridization, data processing, and normalization were carried out as previously described (Lyne et al., 2003 blue right-pointing triangle).

Yeast strains and growth media

Yeast strains are listed in Table 1. CY1391, CY1392, and CY1393 were constructed by replacing sla1+ with sla1::NAT (Sato et al., 2005 blue right-pointing triangle) in SPJ83, SPJ193, and SPJ266 respectively. CY1404 was made by replacing pcr1+ with pcr1::NAT in SPJ266. CY1407 and CY1408 were generated from yAS99 and yAS113, respectively, by replacing pub1+ with pub1::kan MX6. Similarly, CY1472 and CY1473 were generated by replacing tor1+ with tor1::kan MX6, and CY1474 and CY1475 by replacing tsc1+ with tsc1::kan MX6 in yAS99 and yAS113, respectively. CY1569 and CY1570 were made by replacing los1+ with los1::ura4+ (Bahler et al., 1998 blue right-pointing triangle) in yAS99 and yAS113, respectively. The obtained strains were selected on 5-fluoroorotic acid medium to counterselect for ura4+. All gene disruptions were confirmed by PCR.

Media were prepared according to standard recipes. For some applications, the NH4Cl in EMM was replaced with 10 mM proline. Recipe for EMM: potassium phthalate (3 g/l), Na2SO4 (0.04 g/l), ZnSO4 (0.4 mg/l), Na2HPO4 (2.2 g/l), pantothenic acid (1 mg/l), FeCl2 (0.2 mg/l), NH4Cl (5 g/l), nicotinic acid (10 mg/l), molybdic acid (40 μg/l), dextrose (20 g/l), inositol (10 mg/l), potassium iodide (0.1 mg/l), MgCl2 (anhydrous) (0.492 g/l), D-biotin (0.01 mg/l), CuSO4 (40 μg/l), CaCl2 (14.7 mg/l), boric acid (0.5 mg/l), citric acid (1 mg/l), KCl (1 g/l), and MnSO4 (0.4 mg/l). When supplemented, EMM also contained leucine, adenine, and uracil, each at 225 mg/l. Rapamycin was used at 100 ng/ml. Thiamine was used at 0.05 μM (intermediate repression) or 15 μM (full repression).

Plasmids

pRep4X hLa and pRep hLaΔ328-344 in Rep4X were described previously (Intine et al., 2000 blue right-pointing triangle; Fairley et al., 2005 blue right-pointing triangle). The isp5+ open reading frame was PCR amplified using genomic DNA as template with the primers GTCGACATGAATAATTAC-GGGGTCTCTTCC (forward) and GGATCCTTAAACGCAGAAAGATAGGACG (reverse), digested with SalI and BamHI, and cloned into Rep4X. los1+ open reading frame was PCR amplified with the primers GTCGACATGTCGGCCCAGGATGTC (forward) and GGATCCTCATACATTACCACTTTTTAATGCTTG (reverse), digested with SalI and BamHI, and cloned into Rep4X.

RNA purification and Northern blotting

Total RNA was purified as described (Lyne et al., 2003 blue right-pointing triangle). For mRNA Northern analysis 5 and 10 μg of total RNA were separated in 1% denaturing agarose gel, transferred to a nylon membrane (GeneScreen Plus; PerkinElmer, Waltham, MA), UV cross-linked, baked, and subjected to hybridization at 42°C overnight with random primed 32P-DNA fragments of genes of interest. Hybridization solution was 5× Denhardt's, 5× saline–sodium citrate, 50% formamide, 0.2% SDS, 5 mM EDTA, and 100 μg/ml total yeast RNA. Northern blotting of small RNAs was done essentially as described (Intine et al., 2000 blue right-pointing triangle). Quantitation was done using a PhosphorImager FLA-3000 (Fujifilm, Tokyo, Japan).

35S-methionine incorporation

Ten milliliters of cells was grown exponentially to an OD600 = 0.2 and transferred to medium containing 1 mCi of 35S-methionine (PerkinElmer) and grown for 3.5 h at 32°C. Washed cells were harvested, and 25 and 50 μg of the whole-cell extract were separated on 10% PAGE. Gels were stained with SimplyBlue (Invitrogen, Carlsbad, CA), fixed, and dried, and 35S was quantified with a PhosphorImager FLA3000.

3H-leucine uptake

This was performed as described, in EMM containing 225 mg/l leucine (~1.6 mM) and trace amounts of 3H-leucine (Weisman et al., 2005 blue right-pointing triangle).

Supplementary Material

Supplemental Materials:

Acknowledgments

We thank Shiv Grewal, Vincent Geli, and Henry Levin for strains and/or plasmids, Mike Cashel for advice on analysis of media components, Bob Intine for RNA preparation for one of the microarray experiments, Shelly Sazer for a los1-mutant allele used during an early phase of this work, Marty Blum for media preparation, Nate Blewett for discussion, and Alan Hinnebusch and anonymous reviewers for critical reading of an earlier version of the manuscript. This work was supported by the Intramural Research Program of the Eunice Kennedy Shriver National Institute of Child Health and Human Development.

Abbreviations used:

AAM
amino acid metabolism
EMM
Edinburgh minimal medium
pre-tRNA
precursor tRNA
TOR
target of rapamycin

Footnotes

This article was published online ahead of print in MBoC in Press (http://www.molbiolcell.org/cgi/doi/10.1091/mbc.E11-08-0732) on December 7, 2011.

REFERENCES

  • Alvarez B, Moreno S. Fission yeast Tor2 promotes cell growth and represses cell differentiation. J Cell Sci. 2006;119:4475–4485. [PubMed]
  • Anderson J, Phan L, Cuesta R, Pak M, Asano K, Bjork GR, Tamame M, Hinnebusch AG. The essential Gcd10p-Gcd14p nuclear complex is required for 1-methyladenosine modification and maturation of initiator methionyl-tRNA. Genes Dev. 1998;12:3650–3662. [PubMed]
  • Arts G, Kuersten S, Romby P, Ehresmann B, Mattaj IW. The role of exportin-t in selective nuclear export of mature tRNAs. EMBO J. 1998;17:7430–7441. [PubMed]
  • Bahler J, Wu JQ, Longtine MS, Shah NG, McKenzie A 3rd, Steever AB, Wach A, Philippsen P, Pringle JR. Heterologous modules for efficient and versatile PCR-based gene targeting in Schizosaccharomyces pombe. Yeast. 1998;14:943–951. [PubMed]
  • Banerjee R, et al. tRNAs: cellular barcodes for amino acids. FEBS Lett. 2010;584:387–395. [PMC free article] [PubMed]
  • Bayfield MA, Kaiser TE, Intine RV, Maraia RJ. Conservation of a masked nuclear export activity of La proteins and its effects on tRNA maturation. Mol Cell Biol. 2007;27:3303–3312. [PMC free article] [PubMed]
  • Bayfield MA, Maraia RJ. Precursor-product discrimination by La protein during tRNA metabolism. Nat Struct Mol Biol. 2009;16:430–437. [PMC free article] [PubMed]
  • Bayfield MA, Yang R, Maraia R. Conserved and divergent features of the structure and function of La and related proteins (LARPs) Biochim Biophys Acta. 2010;1799:365–378. [PMC free article] [PubMed]
  • Brenet F, Socci N, Sonenberg N, Holland E. Akt phosphorylation of La regulates specific mRNA translation in glial progenitors. Oncogene. 2009;28:128–139. [PubMed]
  • Calvo O, Cuesta R, Anderson J, Gutierrez N, Garcia-Barrio MT, Hinnebusch AG, Tamame M. GCD14p, a repressor of GCN4 translation, cooperates with Gcd10p and Lhp1p in the maturation of initiator methionyl-tRNA in Saccharomyces cerevisiae. Mol Cell Biol. 1999;19:4167–4181. [PMC free article] [PubMed]
  • Cardinali B, Carissimi C, Gravina P, Pierandrei-Amaldi P. La protein is associated with terminal oligopyrimidine mRNAs in actively translating polysomes. J Biol Chem. 2003;278:35145–35151. [PubMed]
  • Chakshusmathi G, Kim SD, Rubinson DA, Wolin SL. A La protein requirement for efficient pre-tRNA folding. EMBO J. 2003;22:6562–6572. [PubMed]
  • Cherkasova VA, Hinnebusch AG. Translational control by TOR and TAP42 through dephosphorylation of eIF2alpha kinase GCN2. Genes Dev. 2003;17:859–872. [PubMed]
  • Choo A, Blenis J. Not all substrates are treated equally: implications for mTOR, rapamycin-resistance and cancer therapy. Cell Cycle. 2009;8:567–572. [PubMed]
  • Choo AY, Kim SG, Vander Heiden MG, Mahoney SJ, Vu H, Yoon SO, Cantley LC, Blenis J. Glucose addiction of TSC null cells is caused by failed mTORC1-dependent balancing of metabolic demand with supply. Mol Cell. 2010;38:487–499. [PMC free article] [PubMed]
  • Cook AG, Fukuhara N, Jinek M, Conti E. Structures of the tRNA export factor in the nuclear and cytosolic states. Nature. 2009;461:60–65. [PubMed]
  • Copela LA, Chakshusmathi G, Sherrer RL, Wolin SL. The La protein functions with tRNA modification enzymes to ensure tRNA structural stability. RNA. 2006;12:644–654. [PubMed]
  • Copela LA, Fernandez CF, Sherrer RL, Wolin SL. Competition between the Rex1 exonuclease and the La protein affects both Trf4p-mediated RNA quality control and pre-tRNA maturation. RNA. 2008;14:1214–1227. [PubMed]
  • Costa-Mattioli M, Svitkin Y, Sonenberg N. La autoantigen is necessary for optimal function of the poliovirus and hepatitis C virus internal ribosome entry site in vivo and in vitro. Mol Cell Biol. 2004;24:6861–6870. [PMC free article] [PubMed]
  • Curran T, Franza BR., Jr Fos and Jun: the AP-1 connection. Cell. 1988;55:395–397. [PubMed]
  • Fairley JA, Kantidakis T, Intine RV, Maraia RJ, White RJ. Human La is found at RNA polymerase III-transcribed genes in vivo. Proc Natl Acad Sci USA. 2005;102:18350–18355. [PubMed]
  • Fingar DC, Blenis J. Target of rapamycin (TOR): an integrator of nutrient and growth factor signals and coordinator of cell growth and cell cycle progression. Oncogene. 2004;23:3151–3171. [PubMed]
  • Forsburg SL. Comparison of Schizosaccharomyces pombe expression systems. Nucleic Acids Res. 1993;21:2955–2956. [PMC free article] [PubMed]
  • Forsburg SL. S. pombe strain maintenance and media. Curr Protoc Mol Biol. 2003 Chapter 13, Unit 13.15. [PubMed]
  • Ghavidel A, Kislinger T, Pogoutse O, Sopko R, Jurisica I, Emili A. Impaired tRNA nuclear export links DNA damage and cell-cycle checkpoint. Cell. 2007;131:915–926. [PubMed]
  • Gibbons JJ, Abraham RT, Yu K. Mammalian target of rapamycin: discovery of rapamycin reveals a signaling pathway important for normal and cancer cell growth. Semin Oncol. 2009;36((Suppl 3)):, S3–S17. [PubMed]
  • Grewal SI, Klar AJ. A recombinationally repressed region between mat2 and mat3 shares homology to centromeric repeats and regulates directionality of mating-type switching in fission yeast. Genetics. 1997;146:1221–1238. [PubMed]
  • Grosshans H, Simos G, Hurt E. Review: transport of tRNA out of the nucleus-direct channeling to the ribosome? J Struct Biol. 2000;129:288–294. [PubMed]
  • Hellmuth K, Lau DM, Bischoff FR, Kunzler M, Hurt E, Simos G. Yeast Los1p has properties of an exportin-like nucleocytoplasmic transport factor for tRNA. Mol Cell Biol. 1998;18:6374–6386. [PMC free article] [PubMed]
  • Hinnebusch AG. Translational regulation of GCN4 and the general amino acid control of yeast. Annu Rev Microbiol. 2005;59:407–450. [PubMed]
  • Hopper AK. Cellular dynamics of small RNAs. Crit Rev Biochem Mol Biol. 2006;41:3–19. [PubMed]
  • Hopper AK, Schultz L, Shapiro RA. Processing of intervening sequences: a new yeast mutant which fails to excise intervening sequences from precursor tRNAs. Cell. 1980;19:741–751. [PubMed]
  • Hopper AK, Shaheen HH. A decade of surprises for tRNA nuclear-cytoplasmic dynamics. Trends Cell Biol. 2008;18:98–104. [PubMed]
  • Huang Y, Bayfield MA, Intine RV, Maraia RJ. Separate RNA-binding surfaces on the multifunctional La protein mediate distinguishable activities in tRNA maturation. Nat Struct Mol Biol. 2006;13:611–618. [PubMed]
  • Hurt DJ, Wang SS, Lin YH, Hopper AK. Cloning and characterization of LOS1, a Saccharomyces cerevisiae gene that affects tRNA splicing. Mol Cell Biol. 1987;7:1208–1216. [PMC free article] [PubMed]
  • Iben JR, et al. Comparative whole genome sequencing reveals phenotypic tRNA gene duplication in spontaneous Schizosaccharomyces pombe La mutants. Nucleic Acids Res. 2011;39:4228–4242. [PMC free article] [PubMed]
  • Intine RV, Dundr M, Misteli T, Maraia RJ. Aberrant nuclear trafficking of La protein leads to disordered processing of associated precursor tRNAs. Mol Cell. 2002;9:1113–1123. [PubMed]
  • Intine RV, Sakulich AL, Koduru SB, Huang Y, Pierstorrf E, Goodier JL, Phan L, Maraia RJ. Control of transfer RNA maturation by phosphorylation of the human La antigen on serine 366. Mol Cell. 2000;6:339–348. [PubMed]
  • Intine RV, Tenenbaum SA, Sakulich AS, Keene JD, Maraia RJ. Differential phosphorylation and subcellular localization of La RNPs associated with precursor tRNAs and translation-related mRNAs. Mol Cell. 2003;12:1301–1307. [PubMed]
  • Irvine DV, Goto DB, Vaughn MW, Nakaseko Y, McCombie WR, Yanagida M, Martienssen R. Mapping epigenetic mutations in fission yeast using whole-genome next-generation sequencing. Genome Res. 2009;19:1077–1083. [PubMed]
  • Javerzat JP, Cranston G, Allshire RC. Fission yeast genes which disrupt mitotic chromosome segregation when overexpressed. Nucleic Acids Res. 1996;24:4676–4683. [PMC free article] [PubMed]
  • Jia S, Noma K, Grewal SI. RNAi-independent heterochromatin nucleation by the stress-activated ATF/CREB family proteins. Science. 2004;304:1971–1976. [PubMed]
  • Jones RH, Moreno S, Nurse P, Jones NC. Expression of the SV40 promoter in fission yeast: identification and characterization of an AP-1-like factor. Cell. 1988;53:659–667. [PubMed]
  • Kanoh J, Watanabe Y, Ohsugi M, Iino Y, Yamamoto M. Schizosaccharomyces pombe gad7+ encodes a phosphoprotein with a bZIP domain, which is required for proper G1 arrest and gene expression under nitrogen starvation. Genes Cells. 1996;1:391–408. [PubMed]
  • Karagiannis J, Saleki R, Young PG. The pub1 E3 ubiquitin ligase negatively regulates leucine uptake in response to NH(4)(+) in fission yeast. Curr Genet. 1999;35:593–601. [PubMed]
  • Karkusiewicz I, Turowski TW, Graczyk D, Dhungel N, Hopper AK, Boguta M. Maf1, repressor of RNA polymerase III, indirectly affects tRNA processing. J Biol Chem. 2011;286:39478–39488. [PubMed]
  • Kawai M, Nakashima A, Ueno M, Ushimaru T, Aiba K, Doi H, Uritani M. Fission yeast tor1 functions in response to various stresses including nitrogen starvation, high osmolarity, and high temperature. Curr Genet. 2001;39:166–174. [PubMed]
  • Kim J, Struhl K. Determinants of half-site spacing preferences that distinguish AP-1 and ATF/CREB bZIP domains. Nucleic Acids Res. 1995;23:2531–2537. [PMC free article] [PubMed]
  • Kon N, Krawchuk MD, Warren BG, Smith GR, Wahls WP. Transcription factor Mts1/Mts2 (Atf1/Pcr1, Gad7/Pcr1) activates the M26 meiotic recombination hotspot in Schizosaccharomyces pombe. Proc Natl Acad Sci USA. 1997;94:13765–13770. [PubMed]
  • Kuersten S, Arts GJ, Walther TC, Englmeier L, Mattaj IW. Steady-state nuclear localization of exportin-t involves RanGTP binding and two distinct nuclear pore complex interaction domains. Mol Cell Biol. 2002;22:5708–5720. [PMC free article] [PubMed]
  • Lawrence CL, Maekawa H, Worthington JL, Reiter W, Wilkinson CR, Jones N. Regulation of Schizosaccharomyces pombe Atf1 protein levels by Sty1-mediated phosphorylation and heterodimerization with Pcr1. J Biol Chem. 2007;282:5160–5170. [PubMed]
  • Lipowsky G, Bischoff F, Izaurralde E, Kutay U, Schafer S, Gross HJ, Beier H, Gorlich D. Coordination of tRNA nuclear export with processing of tRNA. RNA. 1999;5:539–549. [PubMed]
  • Lund E, Dahlberg JE. Proofreading and aminoacylation of tRNAs before export from the nucleus. Science. 1998;282:2082–2085. [PubMed]
  • Lyne R, Burns G, Mata J, Penkett CJ, Rustici G, Chen D, Langford C, Vetrie D, Bahler J. Whole-genome microarrays of fission yeast: characteristics, accuracy, reproducibility, and processing of array data. BMC Genomics. 2003;4:27. [PMC free article] [PubMed]
  • Maraia RJ. La protein and the trafficking of nascent RNA polymerase III transcripts. J Cell Biol. 2001;153:F13–F17. [PMC free article] [PubMed]
  • Maraia RJ, Lamichhane TN. 3′ Processing of eukaryotic precursor tRNAs. WIREs RNA. 2011;2:362–375. [PMC free article] [PubMed]
  • Matsumoto S, Bandyopadhyay A, Kwiatkowski D, Maitra U, Matsumoto T. Role of the Tsc1-Tsc2 complex in signaling and transport across the cell membrane in the fission yeast Schizosaccharomyces pombe. Genetics. 2002;161:1053–1063. [PubMed]
  • Melton DA, De Robertis EM, Cortese R. Order and intracellular location of the events involved in the maturation of a spliced tRNA. Nature. 1980;284:143–148. [PubMed]
  • Natarajan K, Meyer MR, Jackson BM, Slade D, Roberts C, Hinnebusch AG, Marton MJ. Transcriptional profiling shows that Gcn4p is a master regulator of gene expression during amino acid starvation in yeast. Mol Cell Biol. 2001;21:4347–4368. [PMC free article] [PubMed]
  • Nemoto N, et al. The roles of stress-activated Sty1 and Gcn2 kinases and of the protooncoprotein homologue Int6/eIF3e in responses to endogenous oxidative stress during histidine starvation. J Mol Biol. 2010;404:183–201. [PubMed]
  • Oliviero S, Robinson GS, Struhl K, Spiegelman BM. Yeast GCN4 as a probe for oncogenesis by AP-1 transcription factors: transcriptional activation through AP-1 sites is not sufficient for cellular transformation. Genes Dev. 1992;6:1799–1809. [PubMed]
  • Ozanick SG, Wang X, Costanzo M, Brost RL, Boone C, Anderson JT. Rex1p deficiency leads to accumulation of precursor initiator tRNAMet and polyadenylation of substrate RNAs in Saccharomyces cerevisiae. Nucleic Acids Res. 2009;37:298–308. [PMC free article] [PubMed]
  • Pannone B, Xue D, Wolin SL. A role for the yeast La protein in U6 snRNP assembly: evidence that the La protein is a molecular chaperone for RNA polymerase III transcripts. EMBO J. 1998;17:7442–7453. [PubMed]
  • Park JM, et al. The multifunctional RNA-binding protein La is required for mouse development and for the establishment of embryonic stem cells. Mol Cell Biol. 2006;26:1445–1451. [PMC free article] [PubMed]
  • Paushkin S, Patel M, Peltz SW, Trotta CR. Identification of a human endonuclease complex reveals link between tRNA splicing and pre-mRNA 3′ end formation. Cell. 2004;117:311–321. [PubMed]
  • Phizicky E, Hopper A. tRNA biology charges to the front. Genes Dev. 2010;24:1832–1860. [PubMed]
  • Pierce JB, Eswara MB, Mangroo D. The ins and outs of nuclear re-export of retrogradely transported tRNAs in Saccharomyces cerevisiae. Nucleus. 2010;1:224–230. [PMC free article] [PubMed]
  • Qiu H, Hu C, Anderson J, Björk G, Sarkar S, Hopper A, Hinnebusch AG. Defects in tRNA processing and nuclear export induce GCN4 translation independently of phosphorylation of the alpha subunit of eIF2. Mol Cell Biol. 2000;20:2505–2516. [PMC free article] [PubMed]
  • Sanso M, Gogol M, Ayte J, Seidel C, Hidalgo E. Transcription factors Pcr1 and Atf1 have distinct roles in stress- and Sty1-dependent gene regulation. Eukaryot Cell. 2008;7:826–835. [PMC free article] [PubMed]
  • Sarkar S, Hopper AK. tRNA nuclear export in Saccharomyces cerevisiae: in situ hybridization analysis. Mol Biol Cell. 1998;9:3041–3055. [PMC free article] [PubMed]
  • Sato M, Dhut S, Toda T. New drug-resistant cassettes for gene disruption and epitope tagging in Schizosaccharomyces pombe. Yeast. 2005;22:583–591. [PubMed]
  • Serfontein J, Nisbet RE, Howe CJ, de Vries PJ. Evolution of the TSC1/TSC2-TOR signaling pathway. Sci Signal. 2010;3:ra49. [PubMed]
  • Smith KM, Dobosy J, Reifsnyder J, Anderson D, Selker EU. H2B- and H3-specific histone deacetylases required for DNA methylation in N. crassa. Genetics. 2010;186:1207–1216. [PubMed]
  • Soll D. Transfer RNA: An RNA for all seasons. In: Gesteland RF, Atkins JF, editors. The RNA World. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1993. pp. 157–184.
  • Sopko R, et al. Mapping pathways and phenotypes by systematic gene overexpression. Mol Cell. 2006;21:319–330. [PubMed]
  • Struhl K. The JUN oncoprotein, a vertebrate transcription factor, activates transcription in yeast. Nature. 1988;332:649–650. [PubMed]
  • Struhl K, Davis RW. Production of a functional eukaryotic enzyme in Escherichia coli: cloning and expression of the yeast structural gene for imidazole-glycerolphosphate dehydratase (his3) Proc Natl Acad Sci USA. 1977;74:5255–5259. [PubMed]
  • Sychrova H, Horak J, Kotyk A. Transport of L-lysine in the fission yeast Schizosaccharomyces pombe. Biochim Biophys Acta. 1989;978:203–208. [PubMed]
  • Takeda T, Toda T, Kominami K, Kohnosu A, Yanagida M, Jones N. Schizosaccharomyces pombe atf1 +encodes a transcription factor required for sexual development and entry into stationary phase. EMBO J. 1995;14:6193–6208. [PubMed]
  • Tanay A, Regev A, Shamir R. Conservation and evolvability in regulatory networks: the evolution of ribosomal regulation in yeast. Proc Natl Acad Sci USA. 2005;102:7203–7208. [PubMed]
  • Tate JJ, Cooper TG. Tor1/2 regulation of retrograde gene expression in Saccharomyces cerevisiae derives indirectly as a consequence of alterations in ammonia metabolism. J Biol Chem. 2003;278:36924–36933. [PubMed]
  • Tate JJ, Rai R, Cooper TG. Ammonia-specific regulation of Gln3 localization in Saccharomyces cerevisiae by protein kinase Npr1. J Biol Chem. 2006;281:28460–28469. [PMC free article] [PubMed]
  • Teplova M, Yuan Y-R, Ilin S, Malinina L, Phan AT, Teplov A, Patel DJ. Structural basis for recognition and sequestration of UUU-OH 3′-termini of nascent RNA pol III transcripts by La, a rheumatic disease autoantigen. Mol Cell. 2006;21:75–85. [PubMed]
  • Trotta R, et al. BCR/ABL activates mdm2 mRNA via the La antigen. Cancer Cell. 2003;13:145–160. [PubMed]
  • Valenzuela L, Aranda C, Gonzalez A. TOR modulates GCN4-dependent expression of genes turned on by nitrogen limitation. J Bacteriol. 2001;183:2331–2334. [PMC free article] [PubMed]
  • Van Horn DJ, Yoo CJ, Xue D, Shi H, Wolin SL. The La protein in Schizosaccharomyces pombe: a conserved yet dispensable phosphoprotein that functions in tRNA maturation. RNA. 1997;3:1434–1443. [PubMed]
  • van Slegtenhorst M, Stoyanova R, Kruger WD, Henske EP. Tsc1+ and tsc2+ regulate arginine uptake and metabolism in Schizosaccharomyces pombe. J Biol Chem. 2004;279:12706–12713. [PubMed]
  • Vazquez de Aldana CR, Wek RC, Segundo P, Truesdell A, Hinnebusch AG. Multicopy tRNA genes functionally suppress mutations in yeast eIF-2 alpha kinase GCN2: evidence for separate pathways coupling GCN4 to unchanged tRNA. Mol Cell Biol. 1994;14:7920–7932. [PMC free article] [PubMed]
  • Vogt P, Bos T, Doolittle R. Homology between the DNA-binding domain of the GCN4 regulatory protein of yeast and the carboxyl-terminal region of a protein coded for by the oncogene jun. Proc Natl Acad Sci USA. 1987;84:3316–3319. [PubMed]
  • Wahls WP, Smith GR. A heteromeric protein that binds to a meiotic homologous recombination hot spot: correlation of binding and hot spot activity. Genes Dev. 1994;8:1693–1702. [PubMed]
  • Weinert T, Hopper A. tRNA traffic meets cell-cycle checkpoint. Cell. 2007;131:838–840. [PubMed]
  • Weisman R, Choder M. The fission yeast TOR homolog, tor1+, is required for the response to starvation and other stresses via a conserved serine. J Biol Chem. 2001;276:7027–7032. [PubMed]
  • Weisman R, Choder M, Koltin Y. Rapamycin specifically interferes with the developmental response of fission yeast to starvation. J Bacteriol. 1997;179:6325–6334. [PMC free article] [PubMed]
  • Weisman R, Roitburg I, Nahari T, Kupiec M. Regulation of leucine uptake by tor1+ in Schizosaccharomyces pombe is sensitive to rapamycin. Genetics. 2005;169:539–550. [PubMed]
  • Weisman R, Roitburg I, Schonbrun M, Harari R, Kupiec M. Opposite effects of tor1 and tor2 on nitrogen starvation responses in fission yeast. Genetics. 2007;175:1153–1162. [PubMed]
  • Wolfe CL, Hopper AK, Martin NC. Mechanisms leading to and the consequences of altering the normal distribution of ATP(CTP):tRNA nucleotidyltransferase in yeast. J Biol Chem. 1996;271:4679–4686. [PubMed]
  • Wolin SL, Cedervall T. The La protein. Annu Rev Biochem. 2002;71:375–403. [PubMed]
  • Wullschleger S, Loewith R, Hall MN. TOR signaling in growth and metabolism. Cell. 2006;124:471–484. [PubMed]
  • Yamada T, Mizuno K, Hirota K, Kon N, Wahls WP, Hartsuiker E, Murofushi H, Shibata T, Ohta K. Roles of histone acetylation and chromatin remodeling factor in a meiotic recombination hotspot. EMBO J. 2004;23:1792–1803. [PubMed]
  • Yoo CJ, Wolin SL. The yeast La protein is required for the 3′ endonucleolytic cleavage that matures tRNA precursors. Cell. 1997;89:393–402. [PubMed]
  • Yoshihisa T, Ohshima C, Yunoki-Esaki K, Endo T. Cytoplasmic splicing of tRNA in Saccharomyces cerevisiae. Genes Cells. 2007;12:285–297. [PubMed]
  • Yoshihisa T, Yunoki-Esaki K, Ohshima C, Tanaka N, Endo T. Possibility of cytoplasmic pre-tRNA splicing: the yeast tRNA splicing endonuclease mainly localizes on the mitochondria. Mol Biol Cell. 2003;14:3266–3279. [PMC free article] [PubMed]
  • Zhou H, Luo Y, Huang S. Updates of mTOR inhibitors. Anticancer Agents Med Chem. 2010;10:571–581. [PMC free article] [PubMed]

Articles from Molecular Biology of the Cell are provided here courtesy of American Society for Cell Biology