PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of jbcThe Journal of Biological Chemistry
 
J Biol Chem. 2012 January 20; 287(4): 2388–2397.
Published online 2011 November 30. doi:  10.1074/jbc.M111.305698
PMCID: PMC3268400

Molecular Cloning and Functional Characterization of Xenopus tropicalis Frog Transient Receptor Potential Vanilloid 1 Reveal Its Functional Evolution for Heat, Acid, and Capsaicin Sensitivities in Terrestrial Vertebrates*

Abstract

The functional difference of thermosensitive transient receptor potential (TRP) channels in the evolutionary context has attracted attention, but thus far little information is available on the TRP vanilloid 1 (TRPV1) function of amphibians, which diverged earliest from terrestrial vertebrate lineages. In this study we cloned Xenopus tropicalis frog TRPV1 (xtTRPV1), and functional characterization was performed using HeLa cells heterologously expressing xtTRPV1 (xtTRPV1-HeLa) and dorsal root ganglion neurons isolated from X. tropicalis (xtDRG neurons) by measuring changes in the intracellular calcium concentration ([Ca2+]i). The channel activity was also observed in xtTRPV1-expressing Xenopus oocytes. Furthermore, we tested capsaicin- and heat-induced nocifensive behaviors of the frog X. tropicalis in vivo. At the amino acid level, xtTRPV1 displays ~60% sequence identity to other terrestrial vertebrate TRPV1 orthologues. Capsaicin induced [Ca2+]i increases in xtTRPV1-HeLa and xtDRG neurons and evoked nocifensive behavior in X. tropicalis. However, its sensitivity was extremely low compared with mammalian orthologues. Low extracellular pH and heat activated xtTRPV1-HeLa and xtDRG neurons. Heat also evoked nocifensive behavior. In oocytes expressing xtTRPV1, inward currents were elicited by heat and low extracellular pH. Mutagenesis analysis revealed that two amino acids (tyrosine 523 and alanine 561) were responsible for the low sensitivity to capsaicin. Taken together, our results indicate that xtTRPV1 functions as a polymodal receptor similar to its mammalian orthologues. The present study demonstrates that TRPV1 functions as a heat- and acid-sensitive channel in the ancestor of terrestrial vertebrates. Because it is possible to examine vanilloid and heat sensitivities in vitro and in vivo, X. tropicalis could be the ideal experimental lower vertebrate animal for the study of TRPV1 function.

Keywords: Calcium, Cloning, Ion Channels, TRP Channels, Xenopus, TRPV1, Xenopus oocyte, Capsaicin, Dorsal Root Ganglion, Intracellular Ca2+ Concentration

Introduction

The genes of the transient receptor potential (TRP)3 superfamily, including TRP vanilloid 1 (TRPV1), have been compared, and evolutionary differences among vertebrates have been demonstrated (1). Especially in mammalians and birds, TRPV1 orthologues have been cloned, and their channel properties have been characterized in considerable detail (27). In other distantly related species, however, the properties of TRPV1 orthologues are not well examined.

Recently, it has been reported that TRPV1 may contribute to somatic thermosensation in crocodiles (8) and snakes (9), although the channel activity at the molecular level has not been analyzed in detail. In amphibians, which are subject to thermal environmental variations (poikilothermal animals), the function of TRPV1 is also unknown. An early study reported that capsaicin did not affect substance P release from the spinal cord, although it changed nociceptive responses to cutaneous stimuli in Rana esculenta (10). It has also been reported that frogs are completely insensitive to capsaicin (11). In addition, it is suggested that molecules of the heat sensor in the frog lack vanilloid sensitivity, as capsaicin does not produce any membrane current in Rana pipiens heat-sensitive dorsal root ganglion (DRG) neurons (12). TRPV1 is preserved in all terrestrial vertebrates examined so far (13). However, it has been reported that the channels do not always exhibit similar pharmacological properties. The most striking difference exists with respect to sensitivity to capsaicin; rabbits and chickens are less sensitive to it than other vertebrates (3, 6). Therefore, the frog TRPV1 molecule may lack sensitivity to capsaicin or have limited sensitivity to it.

There is no report that examines whether frog TRPV1 serves as a nociceptive receptor against acid and heat stimuli. Moreover, phylogenic analysis suggests that there is no apparent TRPV1 orthologue in teleost fish genomes (although genes similar to TRPV1 and TRPV2 exist) and only terrestrial vertebrates possess TRPV1 orthologues (1). Because amphibians diverged from amniotes in the early stage of the terrestrial evolutionary process, functional analysis of the amphibian TRPV1 orthologues may provide clues for understanding the functional evolution.

In this study we cloned TRPV1 from the western clawed frog Xenopus tropicalis (xtTRPV1) and expressed it in HeLa cells and Xenopus laevis oocytes to characterize its ion channel properties. These data showed that xtTRPV1 possessed a functional vanilloid binding site. Capsaicin induced nocifensive behavior in the X. tropicalis in vivo with potency similar to that observed in vitro. We found that xtTRPV1 was less sensitive to capsaicin due to the differences of two amino acids from mammalian orthologues. We also found that xtTRPV1 was activated by acidic and heat stimuli. Our data demonstrate that xtTRPV1 plays a role as a polymodal receptor like mammalian TRPV1.

EXPERIMENTAL PROCEDURES

Cell Preparation

X. tropicalis were kindly provided by the National Bio-Resource Project of the Ministry of Education, Culture, Sports, Science, and Technology of Japan (MEXT). They were housed in large plastic tanks, fed once every 2 days, and kept on a 12-h light/dark cycle. Room temperature was maintained at 22–25 °C. DRG neurons were obtained from X. tropicalis according to the procedure reported elsewhere with some modification (14). In brief, X. tropicalis (~5 cm) were sacrificed by decapitation. The spinal column was opened, and DRGs were detached under a dissecting microscope. The lumbar DRGs were removed, and attached fibers were trimmed in Ca2+- and Mg2+-free phosphate-buffered saline, 137 mm NaCl, 2.7 mm KCl, 10 mm Na2HPO4·12H2O, mm 1.8 KH2PO4). Isolated DRGs were enzymatically dissociated in Liebowitz-15 (Invitrogen) tissue culture medium (diluted with a 3/13 volume of water) supplemented with collagenase P (2.5 mg/ml; Roche Applied Science), dispase II (2 mg/ml; Roche Applied Science), DNase (0.5 mg/ml; Roche Applied Science), penicillin (100 units/ml; Meiji Seika), and streptomycin (100 μg/ml; Banyu) for 30 min at 37 °C. After enzyme digestion, individual cells were mechanically dissociated by pipetting up and down using a fire-polished Pasteur pipette. Then the cell suspension was centrifuged (85 × g for 2 min), and the pellet-containing cells was resuspended in culture medium. Aliquots were plated onto glass coverslips coated with poly-l-lysine (Sigma) in a humidified atmosphere at ~25 °C. The cells were used for experiments within 1 day after preparation.

Cloning of xtTRPV1

Using total RNA extracted from peripheral nerves of the X. tropicalis as a template, the full-length complementary DNA (cDNA) of xtTRPV1 was amplified by RT-PCR using PCR primers (forward, 5′-ATGAAAATGAAGAAAATGGGAA-3′; reverse, 5′-TCACTCTGCCTTGGATGTCA-3′) that were designed based on the genome sequence data base published by Ensembl. The xtTRPV1 gene was cloned into pENTR/D-Topo (Invitrogen) and then subcloned into the pVenus-NLS vector for transfection into HeLa cells or into the pOX(+) (15) vector for oocyte expression. pVenus-NLS was constructed by introducing five mutations (F46L/F64L/M153T/V163A/S175G) into pYFP-C1 (Clontech) as previously described (16) and by inserting the oligonucleotide (TCCGGAGATCCAAAGAAAAAGAGAAAAGTAGATCCAAAAAAGAAGAGAAAGGTAGATCCAAAAAAGAAGAGAAAGGTAAGATCT) coding three copies of the nuclear localization signal of the simian virus 40 large T-antigen (17) between the BspEI and BglII sites.

HeLa cells were cultured in Dulbecco's modified Eagle's medium (Sigma) supplemented with 10% fetal bovine serum (Invitrogen), 100 units/ml penicillin, and 100 μg/ml streptomycin. The cells were transfected with the expression vector using a transfection reagent (LipofectamineTM LTX Reagent, Invitrogen) and used 24 h after transfection. xtTRPV1-expressing HeLa cells were detected by GFP fluorescence (Venus) with appropriate filters. Single and double amino acid mutants of xtTRPV1 were made using a PrimeSTAR Mutagenesis Basal kit (Takara) with the following sets of primers: for Y523S, forward (5′-AGCTACTCTGAATTTCTGTTCTTTGCC-3′) and reverse (5′-AAATTCCAGAGTAGCTGTCAGCAATCAA-3′); for A561T, forward (5′-AGCTGGACAATGTGCTGTACTACACG-3′) and reverse (5′-CACATTGGTCCAGCTCATTGCTAAACA-3′). All wild-type and mutant clones used were verified by sequencing.

Ca2+ Imaging

The intracellular calcium concentration ([Ca2+]i) in single cells was measured with a fluorescent calcium indicator, fura-2, by dual excitation using a fluorescent imaging system controlling illumination and acquisition with software (Aqua Cosmos; Hamamatsu Photonics, Japan) as described previously (18). To load fura-2, cells were incubated for 0.5–1 h at 37 °C with 10 μm fura-2 acetoxymethyl ester (Fura-2 AM; Molecular Probes) and 0.02% cremophore EL (Sigma) in HEPES-buffered solution: 103 mm NaCl for xtDRG, 134 mm NaCl for xtTRPV1-HEK, 6 mm KCl, 1.2 mm MgCl2, 2.5 mm CaCl2, 10 mm HEPES (pH 7.4 with NaOH). A coverslip with fura-2-loaded cells was placed in an experimental chamber mounted on the stage of an inverted microscope (IX71; Olympus) equipped with an image acquisition and analysis system. To measure [Ca2+]i, cells were illuminated every 5 s with light at 340 and 380 nm, and the respective fluorescent signals of 500 nm were detected. The fluorescent light was projected to a charge-coupled device camera (ORCA-ER; Hamamatsu Photonics), and the intensities of fluorescent light at F340, F380, and their ratio (F340/F380) were stored on the hard disc of a computer (Endeavor pro2500; Epson). Cells were continuously superfused with the external solution through multibarreled tubes by gravity at a flow rate of 1.5 ml/min, and the bath level was adjusted so that the total bath volume was about 0.5 ml. Drugs were applied through multibarreled tubes of puffer pipettes. All experiments were carried out at room temperature (22–25 °C) except for heat stimulation. For heat stimulation, heated HEPES-buffered solution was applied by perfusion. The temperature of the bathing solution was monitored with a temperature sensor (IT-21; AD Instrument), the tip of which was placed near the cell of interest. Heat stimulation was stopped when the chamber temperature reached the intended value.

Two-electrode Voltage Clamp Method

The TRPV1 channel of X. tropicalis was heterologously expressed in oocytes of X. laevis, and ionic currents were recorded using the two-electrode voltage-clamp method (13). xtTRPV1 complementary RNA (cRNA) was synthesized using pOX (+) vectors containing xtTRPV1 with an mMESSAGE MACHINE SP6 kit (Ambion) according to supplier's instructions. Then 50 nl of xtTRPV1 cRNA (50–200 ng/μl) was injected into defolliculated oocytes, and ionic currents were recorded for 1–6 days post-injection. The oocytes were voltage-clamped at −60 mV. Capsaicin was diluted into ND96 solution (96 mm NaCl, 2 mm KCl, 1.8 mm CaCl2, 1 mm MgCl2, and 5 mm HEPES, pH 7.6) and applied to the oocytes by perfusion. For thermal stimulation, heated ND96 solution was applied. For acidic stimulation, ND96 solution at pH 4.0 was applied.

Behavioral Experiment

X. tropicalis (~5 cm) was placed in water in a glass bottle (22–25 °C) and allowed to habituate to the environment for 20 min before tests to allow appropriate behavioral immobility. To observe capsaicin-induced jumping behavior, concentrated capsaicin was added directly to the water in which the X. tropicalis was immersed. Before the addition of capsaicin, the frog was mostly quiescent. After the addition of capsaicin, the frog began jumping along the wall of the glass bottle. We counted the number of jumps as nocifensive behavior for 5 min before and 20 min after the addition of capsaicin. The effect of a vehicle (dimethyl sulfoxide; DMSO) on jumping behavior was assessed by adding it to the water. To record the number and timing of the jumping behavior, we manually applied electrical noises to an AD convertor (PowerLab, AD Instrument). The effect of heat on X. tropicalis was observed in a similar way to that of capsaicin. In brief, after habituation, the water in the glass bottle was replaced with heated water at appropriate temperatures. Immediately, the glass bottle containing the frog was immersed in a water bath at the same temperature.

Chemicals

Capsaicin was purchased from Sigma. Capsaicin was dissolved in ethanol for the calcium imaging experiment, and for the behavioral test it was dissolved in DMSO at a high concentration as a stock solution. Amiloride and capsazepine from Sigma were dissolved in DMSO to make a stock solution (100 mm). The drugs were diluted to their final concentrations with external solution.

Data Analysis

The data are presented as the mean ± S.E. (n = number of observations). Statistical significance was tested using the unpaired Student's t test with p values <0.05. Values of the 50% effective concentrations (EC50) were determined using Origin software (OriginLab). These data were obtained from at least three different transfections or animals per experiment.

RESULTS

Cloning of X. tropicalis TRPV1

xtTRPV1 was cloned from total RNA extracted from peripheral nerves. The cDNA nucleotide sequence coding for xtTRPV1 consisted of 2520 bp, and the predicted protein of xtTRPV1 had 840 amino acid residues. Like other TRPV1 members, the X. tropicalis orthologue contained six putative hydrophobic transmembrane and six N-terminal ankyrin repeat domains. Upon alignment with vertebrate TRPV1 orthologues, the amino acid sequence similarities were as follows: 92% with X. laevis, 61% with the rattlesnake, 64% with the chicken, and 60–64% with mammals (Fig. 1).

FIGURE 1.
Phylogenetic tree of TRPV1 amino acid sequences. Amino acid similarities between X. tropicalis TRPV1 and TRPV1s of representative terrestrial vertebrate species are shown as percentages. The phylogenetic tree was reconstructed using estimated numbers ...

Characterization of Recombinant X. tropicalis TRPV1 Receptor

xtTRPV1 was transiently expressed in HeLa cells (xtTRPV1-HeLa) to characterize the channel properties. Because the TRPV1 channel has high Ca2+ permeability (19), we examined whether capsaicin could stimulate TRPV1 channels using Ca2+ imaging with fura-2. Fura-2-loaded xtTRPV1-HeLa were stimulated with various concentrations of capsaicin (Fig. 2A). In xtTRPV1-HeLa, capsaicin elicited a tiny [Ca2+]i increase at 30 μm. At 100 μm, [Ca2+]i peaked during its application and returned to the resting level after washout. The concentration-response relationship for capsaicin is depicted in Fig. 2B. We found that the capsaicin sensitivity of xtTRPV1 was extremely low compared with mammalian TRPV1 orthologues (2, 4, 5, 7, 20). The EC50 of capsaicin was estimated to be ~85.4 μm, although we could not obtain maximal responses to capsaicin. At higher concentrations of capsaicin (>1 mm), nonspecific action was evoked in xtTRPV1-untransfected HeLa cells, which prevented us from observing maximal responses. In xtTRPV1-untransfected HeLa cells, capsaicin did not evoke [Ca2+]i increases up to 300 μm (data not shown).

FIGURE 2.
Capsaicin increases [Ca2+]i in HeLa cells expressing xtTRPV1. A, representative [Ca2+]i increases in response to capsaicin stimulation for 1 min at different concentrations are shown. B, shown is a concentration-response relationship for capsaicin in ...

It has been reported that the mammalian TRPV1 channel is activated by extracellular low pH and heat (20). We compared the TRPV1 amino acid residues that were reported to be responsible for proton sensitivity (Fig. 3A) (21) and found that they were conserved in X. tropicalis TRPV1. To examine whether acidic stimuli evoked [Ca2+]i increases in xtTRPV1-HeLa, they were stimulated with various concentrations of protons and subsequently with capsaicin at 300 μm (Fig. 3B). Protons evoked [Ca2+]i increases in a concentration-dependent manner (Fig. 3C). Very few xtTRPV1-untransfected HeLa cells (only 4 of 58 cells) responded to pH 5.0, at which xtTRPV1-HeLa cells responded considerably. Next we assessed whether xtTRPV1 responded to heat. Heat also evoked [Ca2+]i increases in xtTRPV1-HeLa (Fig. 3D). Temperature-response relations in xtTRPV1-HeLa and untransfected HeLa cells are shown in Fig. 3E. At 38 °C or higher temperatures, significant increases of [Ca2+]i were induced by heat stimulation in xtTRPV1-HeLa compared with untransfected HeLa cells.

FIGURE 3.
Protons and heat increase [Ca2+]i in HeLa cells expressing xtTRPV1. A, amino acid sequence alignments of the regions encompassing the putative proton-sensing residues (shown with arrows) of TRPV1 from representative terrestrial vertebrates are shown. ...

Next, the ion channel properties of xtTRPV1 were examined by expressing it in oocytes of X. laevis and measuring ionic currents using the two-electrode voltage-clamp method. We first examined whether the oocytes expressing xtTRPV1 were activated by heat. Heat stimuli induced inward currents, the amplitudes of which were gradually increased by repetition (data not shown). Fig. 4A shows a representative membrane current at the third heat stimulus. No current was induced by heat stimulation in water-injected oocytes (Fig. 4B). When analyzed with Arrhenius plots, the average temperature threshold for activation was 38.33 ± 0.75 °C (n = 6) (Fig. 4C), the value of which did not change regardless of the repetition of heat stimuli. The threshold temperature for activation was essentially consistent with that of xtTRPV1-HeLa. Capsaicin stimulation did not elicit observable currents in the oocytes expressing xtTRPV1, although a high concentration of capsaicin (300 μm) that activated xtTRPV1-HeLa was applied (Fig. 4D). Oocytes injected with xtTRPV1 cRNA responded to acidic stimulation (Fig. 4E). Water-injected oocytes also responded to acidic stimulation (Fig. 4F), but the current amplitudes were much smaller than those elicited by oocytes injected with xtTRPV1 cRNA.

FIGURE 4.
Current responses of xtTRPV1 to heat, capsaicin, and acid. Responses of oocytes injected with xtTRPV1 cRNA (A) or water (B) to heat stimulation are shown. Repeated heat stimuli (4–5 times) were applied to the oocytes. The representative traces ...

[Ca2+]i Responses to Polymodal Stimuli in Isolated X. tropicalis DRG Neurons

To compare the properties of recombinant xtTRPV1 with endogenous xtTRPV1, the effects of capsaicin, extracellular low pH, and heat on [Ca2+]i were examined in DRG neurons isolated from X. tropicalis (xtDRG neurons). xtDRG neurons were stimulated with various concentrations of capsaicin and subsequently with KCl (80 mm, Fig. 5A). At 30 μm or higher, capsaicin evoked [Ca2+]i increases in xtDRG neurons. Unlike the recombinant xtTRPV1 receptor, [Ca2+]i increases induced by capsaicin rapidly returned to the basal level after its washout even when a high concentration (300 μm) was used. Fig. 5B shows the concentration-dependent relationship for capsaicin in xtDRG neurons. The EC50 for capsaicin was estimated to be 49.8 μm, the value of which was similar to that in xtTRPV1-HeLa. Consistent with our previous reports on rodents (22, 23), capsaicin-sensitive DRG neurons in X. tropicalis were distributed in relatively small neurons (Fig. 5C). The average sizes of capsaicin-responding xtDRG neurons (389 ± 22.6 μm2) was significantly smaller than those of non-responding ones (620 ± 14.1 μm2, p < 0.05). The capsaicin-induced [Ca2+]i increase was reversibly inhibited by capsazepine (50 μm, Fig. 5D), although capsazepine itself elicited [Ca2+]i increases in a few neurons.

FIGURE 5.
Capsaicin increases [Ca2+]i in xtDRG neurons. A, shown are representative [Ca2+]i increases in response to capsaicin at different concentrations and KCl (K, 80 mm) applied for 1 min. B, shown is a concentration-response relationship for capsaicin in xtDRG ...

Like xtTRPV1-HeLa, protons evoked [Ca2+]i increases in capsaicin-responding xtDRG neurons in a concentration-dependent manner (Fig. 6, A and B). However, the threshold pH was slightly higher in xtDRG neurons (pH 6.5) than that of recombinant TRPV1, pH 6.0. It has been reported that acid-sensitive ion channels blocked by amiloride are expressed in frog DRG neurons (12). Therefore, we examined the effect of amiloride (100 μm) on the proton-induced [Ca2+]i increase in xtDRG neurons. In approximately half (6 of 11) of the xtDRG neurons, amiloride inhibited the [Ca2+]i increases induced by pH 6.5 (data not shown).

FIGURE 6.
Protons and heat increase [Ca2+]i in xtDRG neurons. A, representative [Ca2+]i increases in response to protons at pH 7.0, pH 5.5, capsaicin (cap, 300 μm) and KCl (K, 80 mm) for 1 min are shown. B, concentration-response relationships for stimulation ...

Heat also activated xtDRG neurons in a temperature-dependent manner (Fig. 6, C and D). The thermal threshold in xtDRG neurons was 38 °C, which was consistent with that of recombinant TRPV1. Heat (>42 °C) also evoked [Ca2+]i increases in a small number (3 of 26) of capsaicin-non-responding xtDRG neurons. These data demonstrated that recombinant TRPV1 channels possessed polymodal sensitivity similar to endogenous TRPV1-expressing xtDRG neurons.

Nocifensive Behavior in Response to Capsaicin and Heat

We next examined the effects of capsaicin and heat on X. tropicalis in vivo. X. tropicalis were placed in glass bottles filled with water and challenged with various concentrations of capsaicin dissolved in water in which the X. tropicalis were immersed. Capsaicin evoked a nocifensive behavior (jumping), which is indicated as vertical lines in Fig. 7A. The numbers of the behavior for each 1-min interval before and after the application of capsaicin (100 μm) are shown in Fig. 7C. At 100 μm, the nocifensive behavior started just after the application of capsaicin and continued intermittently. Fig. 7E shows the number of times of the behavior for the first 3 min of the capsaicin application for different concentrations. The concentration-response relationship for capsaicin essentially corresponded to the data for xtTRPV1-HeLa and xtDRG neurons.

FIGURE 7.
Capsaicin and heat evoke nocifensive behavior in X. tropicalis. Representative traces for nocifensive behavior induced by capsaicin (A) and heat (B) are shown. Vertical lines show the timing of jumping behaviors induced by applied stimuli (the length ...

We also observed nocifensive behavior in X. tropicalis induced by heat. Frogs began jumping just after the application of water at 38 °C (Fig. 7B). The nocifensive response to heat was remarkable during the first 1 min; thereafter the movement of the X. tropicalis became sluggish (Fig. 7D). Fig. 7F shows the counts of the behavior for 1 min after heat stimulation at different temperatures. The temperature-response relationship was almost identical to those of xtTRPV1-HeLa and xtDRG neurons. We could not obtain stable data on nocifensive behavior induced by acid stimulation, as acid elicited behavioral changes with different timings and magnitudes in different animals. Similar discrepancies have been reported by Kuffler et al. (12). They explained that this occurred because frog skin has rich blood circulation that may greatly dilute the protons to prevent them from reaching a concentration that would activate peripheral endings of the afferent fibers.

Characterization of the Capsaicin Responses in xtTRPV1 Mutant Channels

In the present experiment, we found that xtTRPV1 was actually sensitive to capsaicin, although its sensitivity was extremely low compared with the majority of mammalian orthologues such as that of the human (2). It has been suggested that Ser-512 (3) and Thr-550 (6), located in the third and fourth putative transmembrane domains in capsaicin-sensitive TRPV1 (in humans and rodents), interact with vanilloid ligands. Comparison of the amino acid sequences revealed that these two amino acids changed to Tyr-523 and Ala-561 in X. tropicalis TRPV1, corresponding to Ser-512 and Thr-550 in the human, respectively (Fig. 8A). Therefore, to investigate whether these amino acids (one or both) were related to low vanilloid sensitivity in X. tropicalis TRPV1, we studied the effects of capsaicin on single (Y523S, A561T) and double (Y523S/A561T) point mutants of TRPV1. These mutant channels were transiently expressed in HeLa cells, which were stimulated by various concentrations of capsaicin (Fig. 8B). As expected, the sensitivity to capsaicin was increased by mutation of the above two-amino acid residues (Fig. 8C). The EC50 values for capsaicin in wild, Y523S, A561T, and Y523S/A561T channels were 85.4, 42.1, 0.82, and 0.18 μm, respectively. The capsaicin sensitivity to Y523S/A561T channels was almost identical to that for the human orthologue (EC50 = 0.19 μm (24)).

FIGURE 8.
Substitutions of Y523S and/or A561T increase capsaicin sensitivity. A, amino acid sequence alignments of terrestrial vertebrate TRPV1s within transmembrane domain 3 (TM3) and TM4 are shown. The mutations generated in xtTRPV1 are indicated at the bottom ...

The above observations were further confirmed by capsaicin-induced currents and the relative concentration-relation for capsaicin in Xenopus oocytes expressing X. tropicalis TRPV1 mutant channels (Fig. 9). As expected, substitutions of these two amino acid residues increased the sensitivity to capsaicin. The concentrations of capsaicin that elicited observable membrane currents decreased in the order A561T, Y523S, and A561T/Y523S. The lowest capsaicin concentrations that elicited clear currents for all three X. tropicalis mutant channels in the Xenopus oocytes were higher than those elicited in xtTRPV1-HeLa. The responses of Y523S and A561T mutant channels to acidic and heat stimuli were similar to those of the wild-type channel (data not shown). These mutagenesis analyses clearly demonstrated that two amino acids residues (Tyr-523 and Ala-561) in X. tropicalis TRPV1 were essentially responsible for the low sensitivity to capsaicin.

FIGURE 9.
Increased capsaicin sensitivities in oocytes expressing xtTRPV1 harboring Y523S and/or A561T mutations. Representative current traces after capsaicin stimulation in the oocytes expressing xtTRPV1 harboring A561T (A), Y523S (B), and Y523S/A561T (C) mutations ...

DISCUSSION

The cloning of TRPV1 from various species has provided substantial information on the structure-function relationships of TRPV1. Here we reported the cloning of the amphibian orthologue of TRPV1 and its characterization. Heterologous expression studies and characterization of native channels expressed in sensory neurons showed that xtTRPV1 was sensitive to capsaicin, acid, and heat. In the behavioral test in vivo, capsaicin and high temperatures evoked nocifensive responses. These results indicated that xtTRPV1 plays a role as a polymodal receptor similar to those of mammalian orthologues.

The amino acid sequence of xtTRPV1 showed ~60% similarity to various TRPV1 orthologues (Fig. 1). xtTRPV1 contains six putative membrane spanning domains with six N-terminal ankyrin repeats (data not shown). In the present study, to characterize this newly cloned TRPV1 orthologue, X. tropicalis TRPV1 was transiently expressed in HeLa cells and Xenopus oocytes. Then they were stimulated with polymodal stimuli such as capsaicin, protons, and heat. It has been reported that heat-sensitive sensory neurons of R. pipiens lack capsaicin sensitivity (12). However, using a Ca2+ imaging assay, we observed that capsaicin actually increased [Ca2+]i in xtTRPV1-HeLa. We also found [Ca2+]i increases in xtDRG neurons. The threshold concentrations of capsaicin were consistent in the two experimental systems, suggesting that endogenous TRPV1 responded to capsaicin, although its sensitivity was extremely low as discussed below. We could not observe current responses to capsaicin in oocytes expressing xtTRPV1, although this was not due to the oocyte expression system because we observed clear current responses when xtTRPV1 mutant channels were used (described below). In the case of mutant channels, capsaicin sensitivity in oocytes was lower than that in xtTRPV1-HeLa. Thus it may be possible that the threshold for capsaicin activation of wild-type xtTRPV1 became higher than 300 μm when expressed in oocytes, which made it difficult to examine as much higher concentrations of capsaicin are difficult to dissolve in bath solution. It is, however, clear that capsaicin activates amphibian TRPV1 channels as it does in HeLa cell and DRG neurons.

Heat stimulated xtTRPV1-HeLa, oocytes expressing xtTRPV1, and xtDRG neurons in similar temperature ranges, but the value was somewhat lower than those for mammalian orthologues (25). We also observed heat-evoked [Ca2+]i increases in some capsaicin-non-responding xtDRG neurons, suggesting that other calcium-permeable heat-sensing channels were expressed in xtDRG neurons such as TRPV3 and TRPV4, other thermosensitive TRP channels whose thermal thresholds are lower than for TRPV1 (26, 27). Quite recently, however, our group reported that the heat-sensitive TRPV3 channel in mammals was activated by cold in X. tropicalis (13). Moreover, Gracheva et al. (9) have demonstrated that transient receptor potential ankyrin1 (TRPA1), a cold sensor in mammalians, functions as a heat-sensitive detector in snakes. Therefore, in X. tropicalis, thermosensitive TRP channels whose temperature sensitivity is different from those in mammalian orthologues may be expressed in sensory neurons.

Regarding acid sensitivity, the threshold pH for xtTRPV1 activation in xtTRPV1-HeLa was lower (pH 6.0) than in sensory neurons (pH 6.5). This may be due to the expression of acid-sensitive ion channels (ASICs), because the [Ca2+]i response to pH 6.5 was partly inhibited by amiloride, a blocker of ASICs. Acid (pH 6.5) has been reported to evoke inward currents that are decreased by amiloride in frog DRG neurons (12). Additionally, it is suggested that TRPV1 receptor activity is modulated by the host cell expression system, as acid responses are different when TRPV1 is expressed in 1321 cells and HEK 293 cells (28).

We examined whether capsaicin and heat evoked nocifensive behaviors in X. tropicalis. It was reported that there were no signs of pain behavior when capsaicin (100 μm) was dropped into the eyes of R. pipiens (12). In the present study, however, we succeeded in quantification of nocifensive behaviors induced by capsaicin in X. tropicalis. This may be due to the differences in the sensitivities of TRPV1 to capsaicin among frog species or in the administration methods, as we used X. tropicalis and applied capsaicin systemically through the skin. The potency of capsaicin-induced nocifensive behaviors was almost identical to the stimulatory effect in the in vitro experimental systems (Figs. 2 and and5).5). Heat also evoked nocifensive behavior in X. tropicalis with similar thermal thresholds observed in calcium imaging and membrane current analyses.

These data revealed that the sensitivity to capsaicin of X. tropicalis TRPV1 was very low in recombinant xtTRPV1, native sensory neurons, and in a behavioral test in vivo. Similarly, low sensitivity of capsaicin to sensory neurons in the chicken (29) and the lack of a binding site for a radiolabeled TRPV1 agonist, [3H] resiniferatoxin, to the dorsal root ganglia membrane in the rabbit (30) have been reported. Gavva et al. (6) reported the molecular basis for decreased capsaicin sensitivity in the rabbit. We found that two amino acids critical for vanilloid sensitivity in mammalian TRPV1 were different in X. tropicalis and thus conducted point mutation studies. In single and double mutants of xtTRPV1, the capsaicin sensitivity increased ~2-fold (A561T), 100-fold (Y523S), and 1000-fold (Y523S/A561T) (Fig. 8). Increased capsaicin sensitivity was also observed in mutant channels expressed in Xenopus oocytes (Fig. 9). Accordingly, Ser-512 was more important for capsaicin sensitivity than Ala-561. These results indicated that the properties of amino acids were closely connected with functional vanilloid binding. Gavva et al. (6) suggested that H-bonding potential was important for agonist activity. Threonine has an H-bonding-capable hydroxyl group, whereas alanine is similar in size but lacks the H-bonding functional side-chain group. Serine also interacts with capsaicin via a hydrogen bond (6). We confirmed that Tyr-523 and Ala-561 were the critical amino acids responsible for the low sensitivity to capsaicin in xtTRPV1. Jordt and Julius (3) have reported that Ser-523 is essential for capsaicin sensitivity. However, the conclusion was only drawn from mutations introduced into rat TRPV1, and they did not demonstrate that mutations in the corresponding 523 position affected capsaicin sensitivity in native TRPV1 as this position of chicken TRPV1 is serine (Fig. 8A). Thus, the present study is the first report to show the importance of Tyr-523 in a native channel.

Capsaicin sensitivity of TRPV1 varies among vertebrate species (Fig. 10). Here we showed that the capsaicin sensitivity of X. tropicalis TRPV1 was low. The capsaicin sensitivity of chicken TRPV1 is also low, and Tewksbury and Nabhan (31) suggested the phenomenon of directed deterrence in chicken TRPV1. That is, for the hot pepper plant, birds are favored as vectors for seed dispersal, whereas mammalian predators are repelled. In some cases such as in mammalians, the sensitivity of TRPV1 to capsaicin may relate to adaptation. However, X. tropicalis are not likely to be exposed to capsaicin in the natural environment as they are fully aquatic anurans. Thus amino acid substitutions in their capsaicin binding sites may be neutral (that is, substitutions regarding capsaicin sensitivity would not influence the fitness of the X. tropicalis).

FIGURE 10.
Evolutionary processes of the vertebrate TRPV1 orthologues. The inferred evolutionary events are indicated on the respective branches. Divergence of each evolutionary lineage is according to the estimated divergence time (35). MYA stands for million years ...

On the other hand, with respect to temperature, TRPV1 is likely to be involved in adaptation to the thermal environment. The activation temperature threshold for the cloned X. tropicalis TRPV1 channels was slightly lower than that of human channels. X. tropicalis inhabit tropical areas, and their optimal ambient temperature range is 22–28 °C. Because temperatures beyond the appropriate range have detrimental effects (32, 33), the activation temperature threshold for xtTRPV1 may be lower than that of mammalian TRPV1, which is several degrees higher than the core body temperature. To support this, it is also reported that there are striking correlations between species core body temperatures and the temperature ranges that activate transient receptor potential melastatin 8 (TRPM8) (34). Therefore, thermal activation of TRPV1 may also be tuned to the most appropriate temperature ranges for respective species.

Phylogenetically, amphibians diverged the earliest among the terrestrial vertebrates (Fig. 10). Thus, investigating the physiological role of the TRPV1 channel may provide clues for understanding its functional evolution. In this study we clearly showed that TRPV1 was involved in detection of high temperature and acidic stimuli as in mammalians and chickens, indicating that TRPV1 functioned as a noxious receptor more than 350 million years ago (35). Phylogenetic analysis of the TRPV subfamily revealed that TRPV1 and TRPV2 were produced by gene duplication around the time of divergence of teleost fishes and terrestrial vertebrates (Fig. 10) (1, 13); thus TRPV1 may have acquired a physiological role for noxious detection soon after its emergence.

In this study we obtained consistent data in three different experimental systems; recombinant xtTRPV1-expression systems, xtDRG neurons, and nocifensive behavior in vivo. X. tropicalis are ideal experimental animals because they have a short generation time and small diploid genome (36) together with whole-genome sequence data (37). Taken together, the present results indicate that X. tropicalis may be suitable for the study of TRPV1 channel-mediating pain.

Acknowledgments

We are grateful to Dr. Yoshio Yaoita (National Bioresource Project, Center for Amphibian Biology, Hiroshima University) for providing the X. tropicalis strains. We thank Naomi Fukuta (Division of Cell Signaling, Okazaki Institute for Integrative Bioscience, National Institute of Natural Sciences) for technical support.

*This work was supported by grants-in-aid for Scientific Research from the Ministry of Education, Culture, Sports, Science, and Technology of Japan.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EBI Data Bank with accession number(s) AB682793

3The abbreviations used are:

TRP
transient receptor potential
DRG
dorsal root ganglion
TRPV1
transient receptor potential vanilloid1
xtDRG
X. tropicalis DRG
xtTRPV1
X. tropicalis frog TRPV1
xtTRPV1-HeLa
xtTRPV1 expressing HeLa cells.

REFERENCES

1. Saito S., Shingai R. (2006) Evolution of thermo-TRP ion channel homologs in vertebrates. Physiol. Genomics 27, 219–230 [PubMed]
2. Hayes P., Meadows H. J., Gunthorpe M. J., Harries M. H., Duckworth D. M., Cairns W., Harrison D. C., Clarke C. E., Ellington K., Prinjha R. K., Barton A. J., Medhurst A. D., Smith G. D., Topp S., Murdock P., Sanger G. J., Terrett J., Jenkins O., Benham C. D., Randall A. D., Gloger I. S., Davis J. B. (2000) Cloning and functional expression of a human orthologue of rat vanilloid receptor-1. Pain 88, 205–215 [PubMed]
3. Jordt S. E., Julius D. (2002) Molecular basis for species-specific sensitivity to “hot” chili peppers. Cell 108, 421–430 [PubMed]
4. Savidge J., Davis C., Shah K., Colley S., Phillips E., Ranasinghe S., Winter J., Kotsonis P., Rang H., McIntyre P. (2002) Cloning and functional characterization of the guinea pig vanilloid receptor 1. Neuropharmacology 43, 450–456 [PubMed]
5. Correll C. C., Phelps P. T., Anthes J. C., Umland S., Greenfeder S. (2004) Cloning and pharmacological characterization of mouse TRPV1. Neurosci. Lett. 370, 55–60 [PubMed]
6. Gavva N. R., Klionsky L., Qu Y., Shi L., Tamir R., Edenson S., Zhang T. J., Viswanadhan V. N., Toth A., Pearce L. V., Vanderah T. W., Porreca F., Blumberg P. M., Lile J., Sun Y., Wild K., Louis J. C., Treanor J. J. (2004) Molecular determinants of vanilloid sensitivity in TRPV1. J. Biol. Chem. 279, 20283–20295 [PubMed]
7. Phelps P. T., Anthes J. C., Correll C. C. (2005) Cloning and functional characterization of dog transient receptor potential vanilloid receptor-1 (TRPV1). Eur. J. Pharmacol. 513, 57–66 [PubMed]
8. Seebacher F., Murray S. A. (2007) Transient receptor potential ion channels control thermoregulatory behaviour in reptiles. PLoS One 2, e281. [PMC free article] [PubMed]
9. Gracheva E. O., Ingolia N. T., Kelly Y. M., Cordero-Morales J. F., Hollopeter G., Chesler A. T., Sánchez E. E., Perez J. C., Weissman J. S., Julius D. (2010) Molecular basis of infrared detection by snakes. Nature 464, 1006–1011 [PMC free article] [PubMed]
10. Chéry-Croze S., Godinot F., Jourdan G., Bernard C., Chayvialle J. A. (1985) Capsaicin in adult frogs. Effects on nociceptive responses to cutaneous stimuli and on nervous tissue concentrations of immunoreactive substance P, somatostatin, and cholecystokinin. Naunyn. Schmiedebergs. Arch. Pharmacol. 331, 159–165 [PubMed]
11. Szolcsányi J. (2004) Forty years in capsaicin research for sensory pharmacology and physiology. Neuropeptides 38, 377–384 [PubMed]
12. Kuffler D. P., Lyfenko A., Vyklický L., Vlachová V. (2002) Cellular mechanisms of nociception in the frog. J. Neurophysiol. 88, 1843–1850 [PubMed]
13. Saito S., Fukuta N., Shingai R., Tominaga M. (2011) Evolution of vertebrate transient receptor potential vanilloid 3 channels. Opposite temperature sensitivity between mammals and western clawed frogs. PLoS Genet. 7, e1002041. [PMC free article] [PubMed]
14. Philippi M., Vyklický L., Kuffler D. P., Orkand R. K. (1995) Serotonin- and proton-induced and modified ionic currents in frog sensory neurons. J. Neurosci. Res. 40, 387–395 [PubMed]
15. Dowland L. K., Luyckx V. A., Enck A. H., Leclercq B., Yu A. S. (2000) Molecular cloning and characterization of an intracellular chloride channel in the proximal tubule cell line, LLC-PK1. J. Biol. Chem. 275, 37765–37773 [PubMed]
16. Nagai T., Ibata K., Park E. S., Kubota M., Mikoshiba K., Miyawaki A. (2002) A variant of yellow fluorescent protein with fast and efficient maturation for cell-biological applications. Nat. Biotechnol. 20, 87–90 [PubMed]
17. Kalderon D., Roberts B. L., Richardson W. D., Smith A. E. (1984) A short amino acid sequence able to specify nuclear location. Cell 39, 499–509 [PubMed]
18. Ohta T., Imagawa T., Ito S. (2008) Novel gating and sensitizing mechanism of capsaicin receptor (TRPV1). Tonic inhibitory regulation of extracellular sodium through the external protonation sites on TRPV1. J. Biol. Chem. 283, 9377–9387 [PubMed]
19. Caterina M. J., Julius D. (2001) The vanilloid receptor. A molecular gateway to the pain pathway. Annu. Rev. Neurosci. 24, 487–517 [PubMed]
20. Caterina M. J., Schumacher M. A., Tominaga M., Rosen T. A., Levine J. D., Julius D. (1997) The capsaicin receptor. A heat-activated ion channel in the pain pathway. Nature 389, 816–824 [PubMed]
21. Jordt S. E., Tominaga M., Julius D. (2000) Acid potentiation of the capsaicin receptor determined by a key extracellular site. Proc. Natl. Acad. Sci. U.S.A. 97, 8134–8139 [PubMed]
22. Ohta T., Ikemi Y., Murakami M., Imagawa T., Otsuguro K., Ito S. (2006) Potentiation of transient receptor potential V1 functions by the activation of metabotropic 5-HT receptors in rat primary sensory neurons. J. Physiol. 576, 809–822 [PubMed]
23. Kajihara Y., Murakami M., Imagawa T., Otsuguro K., Ito S., Ohta T. (2010) Histamine potentiates acid-induced responses mediating transient receptor potential V1 in mouse primary sensory neurons. Neuroscience 166, 292–304 [PubMed]
24. McIntyre P., McLatchie L. M., Chambers A., Phillips E., Clarke M., Savidge J., Toms C., Peacock M., Shah K., Winter J., Weerasakera N., Webb M., Rang H. P., Bevan S., James I. F. (2001) Pharmacological differences between the human and rat vanilloid receptor 1 (VR1). Br. J. Pharmacol. 132, 1084–1094 [PMC free article] [PubMed]
25. Tominaga M., Tominaga T. (2005) Structure and function of TRPV1. Pflugers. Arch. 451, 143–150 [PubMed]
26. Xu H., Ramsey I. S., Kotecha S. A., Moran M. M., Chong J. A., Lawson D., Ge P., Lilly J., Silos-Santiago I., Xie Y., DiStefano P. S., Curtis R., Clapham D. E. (2002) TRPV3 is a calcium-permeable temperature-sensitive cation channel. Nature 418, 181–186 [PubMed]
27. Güler A. D., Lee H., Iida T., Shimizu I., Tominaga M., Caterina M. (2002) Heat-evoked activation of the ion channel, TRPV4. J. Neurosci. 22, 6408–6414 [PubMed]
28. Bianchi B. R., Lee C. H., Jarvis M. F., El Kouhen R., Moreland R. B., Faltynek C. R., Puttfarcken P. S. (2006) Modulation of human TRPV1 receptor activity by extracellular protons and host cell expression system. Eur. J. Pharmacol. 537, 20–30 [PubMed]
29. Wood J. N., Winter J., James I. F., Rang H. P., Yeats J., Bevan S. (1988) Capsaicin-induced ion fluxes in dorsal root ganglion cells in culture. J. Neurosci. 8, 3208–3220 [PubMed]
30. Szallasi A., Blumberg P. M. (1993) [3H]Resiniferatoxin binding by the vanilloid receptor. Species-related differences, effects of temperature, and sulfhydryl reagents. Naunyn. Schmiedebergs. Arch. Pharmacol. 347, 84–91 [PubMed]
31. Tewksbury J. J., Nabhan G. P. (2001) Seed dispersal. Directed deterrence by capsaicin in chilies. Nature 412, 403–404 [PubMed]
32. Khokha M. K., Chung C., Bustamante E. L., Gaw L. W., Trott K. A., Yeh J., Lim N., Lin J. C., Taverner N., Amaya E., Papalopulu N., Smith J. C., Zorn A. M., Harland R. M., Grammer T. C. (2002) Techniques and probes for the study of Xenopus tropicalis development. Dev. Dyn. 225, 499–510 [PubMed]
33. Rosenblum E. B., Poorten T. J., Settles M., Murdoch G. K., Robert J., Maddox N., Eisen M. B. (2009) Genome-wide transcriptional response of Silurana (Xenopus) tropicalis to infection with the deadly chytrid fungus. PLoS One 4, e6494. [PMC free article] [PubMed]
34. Myers B. R., Sigal Y. M., Julius D. (2009) Evolution of thermal response properties in a cold-activated TRP channel. PLoS One 4, e5741. [PMC free article] [PubMed]
35. Benton M. J., Donoghue P. C. (2007) Paleontological evidence to date the tree of life. Mol. Biol. Evol. 24, 26–53 [PubMed]
36. Kashiwagi K., Kashiwagi A., Kurabayashi A., Hanada H., Nakajima K., Okada M., Takase M., Yaoita Y. (2010) Xenopus tropicalis. An ideal experimental animal in amphibia. Exp. Anim. 59, 395–405 [PubMed]
37. Hellsten U., Harland R. M., Gilchrist M. J., Hendrix D., Jurka J., Kapitonov V., Ovcharenko I., Putnam N. H., Shu S., Taher L., Blitz I. L., Blumberg B., Dichmann D. S., Dubchak I., Amaya E., Detter J. C., Fletcher R., Gerhard D. S., Goodstein D., Graves T., Grigoriev I. V., Grimwood J., Kawashima T., Lindquist E., Lucas S. M., Mead P. E., Mitros T., Ogino H., Ohta Y., Poliakov A. V., Pollet N., Robert J., Salamov A., Sater A. K., Schmutz J., Terry A., Vize P. D., Warren W. C., Wells D., Wills A., Wilson R. K., Zimmerman L. B., Zorn A. M., Grainger R., Grammer T., Khokha M. K., Richardson P. M., Rokhsar D. S. (2010) The genome of the Western clawed frog Xenopus tropicalis. Science 328, 633–636 [PMC free article] [PubMed]
38. Jones D. T., Taylor W. R., Thornton J. M. (1992) The rapid generation of mutation data matrices from protein sequences. Comput. Appl. Biosci. 8, 275–282 [PubMed]
39. Rzhetsky A., Nei M. (1992) Mol. Biol. Evol. 9, 945–967
40. Felsenstein J. (1985) Evolution 39, 783–791

Articles from The Journal of Biological Chemistry are provided here courtesy of American Society for Biochemistry and Molecular Biology