PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of wtpaEurope PMCEurope PMC Funders GroupSubmit a Manuscript
 
J Immunol. Author manuscript; available in PMC 2012 June 1.
Published in final edited form as:
PMCID: PMC3242066
UKMSID: UKMS36816
Integrin αVβ5 Mediated TGF-β Activation by Airway Smooth Muscle Cells in Asthma
Amanda L Tatler,* Alison E John,* Lisa Jolly,* Anthony Habgood,* Jo Porte,* Chris Brightling, Alan J Knox,* Linhua Pang,* Dean Sheppard, Xiaozhu Huang, and Gisli Jenkins*
*Nottingham Respiratory Biomedical Research Unit, University of Nottingham
Institute for Lung Health, University of Leicester
Lung Biology Centre, University of California San Francisco
Corresponding author: Dr Gisli Jenkins, Gisli.jenkins/at/nottingham.ac.uk Tel: 0115 8231712 Fax: 0115 8239146
Severe asthma is associated with airway remodelling, characterised by structural changes including increased smooth muscle mass and matrix deposition in the airway, leading to deteriorating lung function. Transforming growth factor-β (TGF-β) is a pleiotropic cytokine leading to increased synthesis of matrix molecules by human airway smooth muscle cells (HASMs) and is implicated in asthmatic airway remodelling. TGF-β is synthesised as a latent complex, sequestered in the extracellular matrix, and requires activation for functionality. Activation of latent TGF-β is the rate-limiting step in its bioavailability. This study investigated the effect of the contraction agonists LPA and methacholine on TGF-β activation by HASMs and its role in the development of asthmatic airway remodelling. The data presented show that LPA and methacholine induced TGF-β activation by HASMs via the integrin αVβ5. Our findings highlight the importance of the β5 cytoplasmic domain since a polymorphism in the β5 subunit rendered the integrin unable to activate TGF-β. This is the first description of a biologically relevant integrin that is unable to activate TGF-β. These data demonstrate for the first time that murine airway smooth muscle (ASM) cells express αVβ5 integrins and activate TGF-β. Finally, these data show that inhibition, or genetic loss, of αVβ5 reduces allergen-induced increases in airway smooth muscle thickness in two models of asthma. These data highlight a hitherto un-described mechanism of TGF-β activation in asthma and support the hypothesis that bronchoconstriction may promote airway remodelling via integrin mediated TGF-β activation.
Airway hyper-responsiveness, a key feature of asthma, is the enhanced contraction of the airway smooth muscle layer in response to inhaled stimuli, which leads to variable airway obstruction. This phenomenon is responsible for the acute exacerbations associated with asthma. Recurrent exacerbations are a feature of severe asthma. Similarly, the structural changes of airway remodelling are also commonly associated with cases of severe asthma (1) and deteriorating lung function over time (2, 3). It has recently been shown that broncho-constriction can induce features of airway remodelling in mild asthmatics, including collagen deposition and goblet cell hyperplasia (4), however, the mechanism responsible for this is unknown.
Transforming growth factor-β (TGF-β) has been implicated in the pathogenesis of airway remodelling in asthma (5). TGF-β promotes airway remodelling due, in part, to its effects on ASM cell proliferation, epithelial cell apoptosis and its potent pro-fibrotic actions, including increasing synthesis of collagen and fibronectin (6-8). It promotes extracellular matrix deposition, ASM proliferation and mucous production in an animal model of allergic asthma without affecting existing airway inflammation (9). Over-expression of Smad2, a TGF-β signalling protein, causes thickening of the ASM layer and deposition of collagen following allergen challenge (10). Moreover, the importance of TGF-β signalling in asthma pathogenesis is supported by a genome-wide association studying demonstrating a link between a single nucleotide polymorphism in the SMAD3 gene and asthma (11).
TGF-β is secreted from cells in non-covalent association with its pro-peptide, the latency associated peptide (LAP), which renders it inactive. Activation of latent TGF-β (L-TGF-β) is the rate limiting step in its bioavailability (12) and mechanisms of TGF-β activation are fundamental to disease. Several mechanisms of activation have been described in vitro including proteolytic activation by plasmin, matrix metalloproteases (MMP’s) and tryptase, physical activation by extremes of heat and oxidation, and activation by thrombospondin-1 (13-17). Several studies have described increased TGF-β activity in asthma (18-20). Activation of TGF-β in asthma may occur by several mechanisms. Epithelial cells may activate TGF-β in response to damage to the epithelial layer. Mast cells, which are present in large numbers in the asthmatic bronchial mucosa, can activate TGF-β proteolytically through the release of proteases from their granules (15, 21-23). In vivo integrins appear to play the major role in TGF-β activation, at least in development (24, 25), and recently fibroblast specific deletion of the αvβ8 integrin has been shown to reduce airway remodelling by reducing TGF-β induced CCL2 and CCL20 dependent dendritic cell migration (26). However, whether smooth muscle cell TGF-β activation can directly contribute to airway remodelling is unknown.
Integrins are heterodimeric cell surface molecules involved in cell-cell interactions and cell-matrix interactions. Six of the 24 currently described integrins recognise and bind arginine-glycine-aspartate (RGD) motifs in the LAP of both TGF-β1 and TGF-β3. Four of these have been reported to activate TGF-β in vitro including αVβ6 (27), αVβ8 (28), αVβ3 (29) and αVβ5 (30). Integrin meditaed TGFβ activation has been best characterised for the αvβ6 and the αvβ8 integrins. Activation of TGF-β by the αvβ8 integrin involves MMP14 and proteolytic cleavage of the latent TGF-β molecule, whereas αVβ3, αVβ5 and αvβ6 integrins activate TGF-β by a mechanism requiring an intact cytoskeleton and cell contraction (27, 30-32). Activation of TGF-β by αVβ6 integrins is spatially restricted to epithelial cells, whereas αVβ5, and to a lesser extent αVβ3, are present on mesenchymal cells and are able to activate mesenchymal TGF-β (30, 33, 34). This raises the possibility that cellular contraction during broncoconstriction may promote TGF-β activation via cell surface integrins.
The aims of this study were to investigate whether contraction agonists could promote TGF-β activation in human ASM (HASM) cells, and determine whether this process was dysregulated in asthma. We found that LPA induced TGF-β activation by HASM cells via an integrin αVβ5-mediated mechanism that involved reorganisation of the cytoskeleton. Furthermore, methacholine also induced TGF-β activation by HASM cells. HASM cells isolated from asthmatic patients activated more TGF-β in response to both contraction agonists than cells from non-asthmatic individuals. Furthermore, a polymorphism in the cytoplasmic domain of the integrin β5 (itgb5) gene resulted in a β5 subunit that was unable to activate TGF-β. Using the ovalbumin (OVA) model of airway remodelling we demonstrated co-association of αVβ5 integrins and phospho-Smad2 staining in the airway smooth muscle (ASM) layer of remodelled airways, as well as global increases in TGF-β activation. Finally, using two distinct murine models of asthma, we show that both inhibition, and genetic loss, of the αVβ5 integrin results in significantly less ASM surrounding the airways despite enhanced inflammation. This suggests that the αvβ5 integrin may play an important role mediating airway remodelling, as well as supporting the notion that inflammation and remodelling can be dissociated in asthma. These data suggest a potential novel mechanism through which contraction of the ASM layer during asthma attacks could promote airway remodelling in patients with poorly controlled disease.
Cell Culture
Both tracheal and bronchial HASM cells were used. Tracheal HASM cells were obtained from post-mortem tracheal specimens from donors with no history of respiratory disease or evidence of airway abnormalities as previously described (35). Bronchial HASM cells were derived from bronchial biopsies and were kindly supplied by Professor Chris Brightling (University of Leicester, UK). Asthmatic subjects recruited at Glenfield Hospital (University of Leicester) were carefully characterised and presented with an appropriate history, objective evidence of variable airflow obstruction and/or AHR as described previously (36). The subjects were free from exacerbations requiring systemic corticosteroids and/or antibiotics for 6 weeks prior to the bronchoscopy. Cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% foetal calf serum (FCS), penicillin G (100U/ml), streptomycin (100μg/ml) and L-glutamine (4mM). All cells were used at passage 6 and were growth arrested in serum free medium for 24 hours prior to experiments. CS-1 cells, a non-adherent hamster melanoma cell line, were a kind gift of Professor Dean Sheppard (University of California: San Francisco). They were cultured in RPMI 1640 plus 10% FCS, L-glutamine (4mM), penicillin (100U/ml), streptomycin (100μg/ml) and amphotericin B (2.5μg/ml). Following transfection with integrin β5 constructs the cells became adherent to plastic. They were then cultured as before with the addition of the antibiotic G418 at 500μg/ml, as this was the concentration that killed 100% of untransfected CS-1 cells after 1 week of culture (data not shown).
TMLC Co-culture Assay
Transformed mink lung epithelial cells (TMLC) that stably express a portion of the plasminogen activator inhibitor-1 (PAI1) promoter driving a luciferase gene were used as a reporter cell to detect TGF-β activity (32). HASM cells were plated at 2.5×105 cells/ml and growth arrested for 24 hours. TMLC were plated directly on top of HASM cells at 5×105 cells/ml. The cells were then stimulated as required for each experiment. After 16 hours the cells were lysed using a luciferase reporter assay kit (Promega) and the luminescence measured as relative luciferase units (RLU)
Quantitative Reverse Transcriptase Polymerase Chain Reaction (QPCR)
Following stimulation total cell RNA was extracted using NucleoSpin RNA II kit (Macharey Nagel) and reverse transcribed into complimentary DNA (cDNA) using Moloney murine leukaemia virus reverse transcriptase. cDNA was subjected to QPCR analysis to assess expression of the TGF-β-inducible gene PAI1 using β2-microglobulin (β2-M) as a housekeeping gene. Distinct primer sets were used to amplify murine DNA and hypoxanthine-guanine phosphoribosyltransferase (HPRT) was used as a housekeeping gene in these cases. Primer sequences were as follows:
  • PAI1 sense: 5′-TCTGCAGACCTGGTTCCCAC-3′
  • PAI1 antisense: 5′-AGCCCCGTAGTTCCATCCTG-3′
  • β2-M sense: 5′- AATCCAAATGCGGCATCT-3′
  • β2-M antisense: 5′- GAGTATGCCTGCCGTGTG-3′
  • Fibronectin sense: 5′-CAGGATCAACTTACGGAG-3′
  • Fibronectin antisense: 5′-GCCAGTGACAGCATACA-3′
  • Collagen sense: CCAAATCTGTCTCCCCAGAA
  • Collagen antisense: TCAAAAACGAAGGGGAGATG
  • mPAI1 sense: 5′-GGCCAAAGGAAAAAGCACTGT
  • mPAI1 antisense: 5′-GGGCCACCATTTGATCTGTCT
  • mHPRT sense: 5′-TGAAAGACTTGCTCGAGATGTCA
  • mHPRT antisense: 5′-CCAGCAGGTCAGCAAAGAACT
Amplification was performed using a MXPro3000 (Stratagene) with SYBR® Premier Ex Taq (Takara Bio) on the following program: initial denaturation at 95°C for 30 seconds followed by 40 cycles comprising of 95°C for 5 seconds, 60°C for 30 seconds and 72°C for 15 seconds. Amplification of a single DNA product was confirmed by melting curve analysis. Data was expressed as relative expression using the ΔΔCt equation as previously described (37).
Isolation of Nuclear and Cytoplasmic Protein Fractions
Nuclear and cytoplasmic protein fractions were isolated from LPA stimulated HASM cells as previously described (38, 39) using the NXtract CelLytic™ nuclear extraction kit (Sigma) according to the manufacturer’s protocol.
Western Blot
Levels of Smad2 and Smad3 in cytoplasmic and nuclear fractions were determined by western blotting. Protein samples (30μg per lane) were subjected to electrophoresis on a 10% SDS-polyacrylamide gel and electroblotted to PVDF membrane. After blocking for 1 hour (5% non-fat milk in Tris buffered saline plus 0.1% Tween 20 (TBST), the membrane was incubated overnight at 4°C with monoclonal anti-Smad2/3 antibody (1:500 in blocking buffer) (Cell Signalling Technologies). After washing, the membrane (PBS pH 7.4 plus 0.3% Tween-20) was incubated with horseradish peroxidase conjugated secondary antibody (1:2000 in blocking buffer) for 1 hour at room temperature. The membrane was incubated with ECL™ Western blotting detection reagent and visualised by exposing to Hyperfilm-ECL.
Cell Titer-Glow® Assay
Cell Titer-Glow® luminescent cell viability assay (Promega) was utilised to determine cell number in co-culture experiments comparing non-asthmatic and asthmatic HASM cells. Additional wells of cells were set up and treated in the same manner as the experimental wells. After the 16 hour incubation period 100μl Cell Titer-Glow® reagent was added to each well and the plate placed on a rocker for 10 minutes at room temperature. The luminescence was measured and data converted into actual cell numbers using a standard curve of known cell numbers.
Stable Transfections
DNA plasmid constructs corresponding to the common full length integrin β5 subunit and a polymorphic integrin β5 subunit in the vector pc.DNA3.1 were kindly provided by Professor Kawahara (Kanazawa University, Japan). The transfection reagent Transfast (Promega) was used to stably transfect CS-1 hamster melanoma cells according to the manufacturer’s protocol.
Flow Cytometry for Integrin αVβ5
Cell surface expression of the integrin αVβ5 was assessed by flow cytometry as previously described (32). Briefly, cells were counted and 0.5×106 cells were first blocked in goat serum for 20 minutes and then stained with an anti-αVβ5 antibody (clone ALULA raised in mouse, a kind gift of Professor Dean Sheppard) at 25μg/ml for 20 minutes. After washing the cells in PBS, the cells were stained with a phycoerythrin (PE) labelled anti-mouse secondary antibody for 20 minutes. Negative control cells were blocked with goat serum but only stained with the secondary PE-labelled antibody. Cells were analysed using a BD FacsCanto flow cytometer.
Co-Immunoprecipitation (Co-IP) of Integrin β5 with Talin
The interaction of integrin β5 subunit with the cytoskeletal protein talin was investigated using a Universal Magnetic Co-IP kit (Active Motif) according to the manufacturer’s instructions. A rabbit polyclonal antibody directed against integrin β5 and a mouse monoclonal directed against talin 1 and 2 (clone 8D4) were used (both from Abcam). 500μg protein was immunoprecipitated with 5μg antibody and protein G magnetic beads. Following separation of proteins by SDS-PAGE the membrane was probed with second antibody.
Ovalbumin Murine Model of Asthma
All animal care and procedures were approved by the University of Nottingham Ethical Review Committee and were performed under Home Office Project and Personal License authority within the Animal (Scientific Procedures) Act 1986. Female Balb/c 6 week old mice were purchased from Charles River (Margate, Kent, UK) and housed in the Biomedical Services Unit, University of Nottingham for at least 7 days after delivery with free access to food (Tekland Global 18% protein rodent diet, Bicester, Oxen, UK) and water. On day 0 of the study, mice were sensitised by intraperitoneal (IP) injection of 10μg OVA (obtained from Sigma) diluted 1:1 with the adjuvant Alum (Sigma) followed by a subsequent sensitisation on day 12. At day 19 the mice were challenged daily by oropharyngeal administration of either 400μg/ml OVA in 50μl saline or 50μl saline alone for 6 days followed by further challenges on days 26, 28, 30 and 33. The mice were sacrificed on day 34. During the inhibition of αVβ5 study, mice were sensitised as described then treated every two days from day 18 with 4mg/kg anti-αVβ5 (clone ALULA) by ip injection, until the end of the study. Bronchoalveolar lavage (BAL) was performed using 1ml PBS. Both frozen and formalin-fixed tissue was collected for immunohistochemistry. For formalin fixed tissue, the left lobe was inflated with formalin and fixed in formalin overnight, then embedded in paraffin wax. For frozen tissue, the left lobe was inflated with 1ml OCT then frozen in pre-cooled isopentane and stored at −80°C. The remaining four lobes were separated and snap frozen in liquid nitrogen until needed.
Aspergillous fumigatus (Asp.f) Murine Model of Asthma
The University of California San Francisco Committee on Animal Research (IACUC) approved the use of all mice for all reported experiments. The animals were allowed free access to food (Tekland Rodent Laboratory Chow, WI, USA) and water. β5 knockout mice (itgb5-/-) were generated as previously described (40) and bred onto a 129 SvJae background. The murine model of Aspergillous fumigatus (Asp. f) allergic lung disease was used using methods previously described (41). In brief, isofluorane anaesthetised mice were given 10μg (in 40μl saline) of Asp.f (Hollister-Stier Laboratories, WA) or 40μl saline to the nostrils using a micropipette with the mouse held in the supine position. After three treatments per week for a total of nine doses, mice were euthanized 48 hours after the last intranasal challenge. BAL was performed using 3 separate 1ml washes with PBS. These were combined, centrifuged at 1500rpm for 5 minutes and the resulting cell pellet resuspended in 1ml PBS. Total inflammatory cells were counted using a haemocytometer. Formalin-fixed tissue was collected for immunohistochemistry. The left lobe was inflated with formalin and fixed in formalin overnight, then embedded in paraffin wax.
αSMA/αVβ5 Dual Staining
3μm thick sections of frozen murine lung tissue were used. Following fixation in Zamboni’s fixative for 20 minutes, the sections were boiled in 2mM citrate buffer for 3 minutes and then blocked with avidin and biotin blocking solutions (Vector Labs) each for 15 minutes in PBS. The tissue was then blocked in 5% goat serum plus 0.1% BSA in PBS for 30 minutes and incubated with an αVβ5 antibody (Abcam 15459, 1:200) overnight. After washing in PBS, the slides were incubated with a Dylight649 conjugated secondary antibody. The cells were then stained with a 1:100 dilution of an α-SMA antibody (clone 1A4) using a mouse on mouse antibody detection kit (Vector labs) according to the manufacturer’s instructions. Staining was visualised using a laser scanning confocal microscope and Nikon NIS Elements image analysis software. Images were acquired at a single plane through the tissue.
αSMA/P-Smad2 Dual Staining
5μm thick sections of paraffin wax embedded tissue were used. Following dewaxing and rehydration, antigen retrieval was performed by boiling the sections for 20 minutes in citrate buffer. The sections were blocked in 5% normal goat serum plus 0.1% bovine serum albumin. The sections were incubated with anti-Phospho-Smad2 overnight (1:200) and then a DyLight594 conjugated secondary antibody. The sections were then counterstained with an anti-mouse anti-αSMA antibody using a Mouse on Mouse Fluoroscein kit (Vector) according to the manufacturer’s instructions. Staining was visualised using a laser scanning confocal microscope and Nikon NIS Elements image analysis software. Images were acquired at a single plane through the tissue.
αSMA Immunohistochemistry
αSMA immunohistochemistry was performed on 5μm thick sections of paraffin wax embedded tissue. These were dewaxed in xylene and rehydrated in increasing concentrations of ethanol then washed in phosphate buffered saline (PBS). Antigen retrieval was performed by boiling the sections for 20 minutes in citrate buffer. The sections were blocked to inhibit non-specific binding of the primary antibody in 5% normal goat serum plus 0.1% bovine serum albumin in PBS for 30 minutes. The sections were incubated with primary antibody overnight (1:1000). Sections were then incubated with a DyLight488-conjugated secondary antibody for 30 and the sections were counterstained with a Dapi nuclear stain. Negative control slides that were not stained with the primary antibody prior to incubation with the secondary antibody were performed for each experiment. αSMA quantification around smaller airways was performed using NIS Elements software by Nikon measuring area in μm of αSMA staining. The definition of a small airway in mice is currently ambiguous. However, a previous study has defined a small airway as one which has a diameter of 100-200μm (42). This study utilised this definition. Only cross-sectional airways with a radius of less than 100μm were quantified.
Murine PAI1 Sandwich ELISA
Snap frozen lung lobes were defrosted in ice-cold lysis buffer (20mM Tris-HCl, 1% Triton-X 100, 137mM NaCl, 2mM EDTA, 25mM β-glycerophosphate, 10% glycerol, 1mM Na3VO4, 1mM phenylmethanesulfonyl fluoride, 10μg/ml leupeptin, 1mM dithiothreitol, 0.1U/ml protease inhibitor cocktail). The lungs were homogenised using a hand-held homogeniser. Samples were centrifuged at 13000rpm for 10 minutes and the supernatant collected. The concentration of murine PAI1 in lung homogenates from OVA sensitised, saline and OVA challenged mice was determined using a murine PAI1 total antigen sandwich ELISA (Patricell Ltd) according to the manufacturer’s instructions.
Statistics
Statistical analysis was performed using GraphPad Prism 4 software. Where data measured differences between groups the mean values for pooled data were compared. Where mechanistic pathways in normal cells were being assessed, experiments were replicated at least three times and representative examples shown and experimental replicates assessed statistically. Comparison of 2 data sets was performed by two-tailed unpaired t test. Comparison of more than 2 data sets was performed by two way analysis of variance (ANOVA). P values less than 0.05 were accepted as significant.
Contraction Agonist Induced TGF-β Activation in HASM Cells
To determine whether contraction agonists activated TGF-β in HASM cells, these cells were stimulated with LPA and methacholine, and TGF-β activity was measured using 3 independent assays. Both LPA and methacholine induced concentration dependent increases in active TGF-β as measured by co-culture assay (Figure 1A and 1B). There was no effect of either agonist on the reporter cells alone (data not shown). LPA also induced a time dependent increase in PAI1 mRNA expression, which was maximal at 8 hours (Figure 1C). This increase was abrogated by a pan TGF-β neutralising antibody confirming that LPA induced PAI1 gene expression was mediated by TGF-β. Methacholine was also able to induce PAI1 mRNA in a TGF-β dependent manner (Figure 1D). Finally, both LPA and methacholine stimulation induced the translocation of Smad2 and 3 to the nucleus (Figure 1E and 1F). These data confirm that the contraction agonists LPA and methacholine activated TGF-β in HASM cells.
Figure 1
Figure 1
Contraction Agonist Induced TGF-β Activation by HASM Cells
Contraction Agonist-Induced TGF-β Activation was Mediated via αVβ5 Integrin
To identify the mechanism of TGF-β activation in HASM cells an αVβ5 blocking antibody was used. LPA, and methacholine, induced TGF-β activation was assessed by assessing PAI1 mRNA levels and both were abrogated by the αVβ5 blocking antibody (Figure 2A and 2B). Because cytoskeletal proteins are central to contraction induced TGF-β activation (27, 30) the pharmacological inhibitor of actin reorganisation, cytochalasin D, was used. LPA-induced TGF-β activation was inhibited by cytochalasin D (Figure 2C). To determine whether bronchodilation inhibited LPA-induced TGF-β activation the β2-adrenoreceptor (β2) agonist formoterol was used. Addition of formoterol completely inhibited LPA-induced increases in PAI1 gene expression (Figure 2D).
Figure 2
Figure 2
LPA-Induced TGF-β Activation is Mediated via αVβ5 Integrin and Involves the Cytoskeleton
A Polymorphism in the β5 Subunit Cytoplasmic Tail Abrogated αVβ5-Mediated TGF-β Activation
To establish whether cytoskeletal interactions with the β5 cytoplasmic domain were involved in mediating TGF-β activation, the effect of a previously described β5 polymorphism on LPA-induced TGF-β activation was investigated (43). This polymorphism involves a 9 base pair (bp) deletion within the integrin β5 cytoplasmic domain resulting in a β5 subunit that lacks amino acids FNK767-769. Full length DNA constructs corresponding to both the common allele of β5 (FNKFNK) and the polymorphic β5 (FNK) (both were kind gifts from Professor Kawahara, Kanazawa University) were stably transfected into CS-1 hamster melanoma cells, which do not express any endogenous ITGB3 or ITGB5 genes. Following transfection, the cell surface expression of αVβ5 was assessed by flow cytometry. Both cell lines transfected with the common and polymorphic allele expressed αVβ5 integrin on the cell surface (figure 3A and 3B) although levels of expression were higher following transfection of the polymorphic allele. TGF-β activation was assessed in these cell lines by co-culture assay. Co-culture of cells expressing the common allele with TMLC reporter cells demonstrated that the common allele was able to activate TGF-β basally (see figure 3C), as shown by a decrease in luciferase activity in the presence of a TGF-β neutralising antibody. However, cells transfected with the polymorphic allele were unable to activate TGF-β basally (Figure 3D).
Figure 3
Figure 3
A Polymorphism in the β5 Cytoplasmic Tail Abrogates αVβ5-Mediated TGF-β Activation
The deletion of FNK767-769 in the polymorphic β5 subunit occurs within a NxxY talin binding domain. To assess whether talin interactions with the β5 cytoplasmic domain were altered in cells expressing the polymorphic β5 subunit co-immunoprecipitation studies were performed. Initially, the β5 integrin subunit was immunoprecipitated from CS-1 cell lysates expressing either full length or polymorphic β5 and immunoblotted for talin (Figure 4A). To further investigate these interactions, talin was immunoprecipitated and immunoblots for β5 integrin subunit performed (Figure 4B). Full length talin (220kDa) bound to both common and polymorphic β5 subunits, whereas the talin rod domain (190kDa) only consistently bound to the polymorphic allele of the β5 subunit.
Figure 4
Figure 4
Talin Interacts with Both Full-Length and Polymorphic β5 Subunits
Asthmatic HASM Cells Activated More TGF-β than Non-asthmatic HASM Cells
Having demonstrated that the contraction agonists LPA and methacholine induced αVβ5 integrin mediated TGF-β activation in HASM cells via the cytoskeleton we wanted to determine whether there was any difference between HASM’s from patients with asthma compared with controls. When asthmatic HASM cells were stimulated with increasing concentrations of LPA they activated more TGF-β compared with non-asthmatic cells (Figure 5A, p<0.005). LPA also induced TGF-β activation in a time dependent manner as measured by PAI-1 mRNA levels (P<0.05), and asthmatic HASM cells elicited an exaggerated response to LPA stimulation at each time point tested (P<0.05), which was maximal 6 hours following stimulation (Figure 5B). Furthermore, asthmatic HASM cells activated more TGF-β than non-asthmatic cells in response to methacholine stimulation as measured by both co-culture assay (Figure 5C) and by PAI1 QPCR (Figure 5D). To determine whether this increased TGF-β activation resulted in increased expression of genes associated with airway remodelling we assessed expression of both fibronectin and collagen type 1A (COL1A) by QPCR in response to LPA stimulation. Asthmatic HASM cells expressed greater levels of fibronectin mRNA in response to LPA treatment than non-asthmatic cells (Figure 5E). Although there was a trend towards increased COL1A expression no statistically significant differences between diseased and non-diseased HASM were detected (Figure 5F). Finally, total TGF-β levels were measured and found to be two-fold higher in unstimulated asthmatic HASMs compared with non-asthmatic HASM’s (P<0.005) (Figure 5G).
Figure 5
Figure 5
Asthmatic HASM Activate More TGF-β than Non-asthmatic HASM Cells
The αVβ5 integrin Mediated Increased TGF-β activity in Asthmatic Cells but this was not due to Increased Cell Surface αVβ5 integrin Expression
To determine whether the enhanced TGF-β activity observed in asthmatic HASM’s was mediated by the αVβ5 integrin we stimulated HASM’s from asthmatic patients with LPA in the presence of a αVβ5 blocking antibody (Figure 6A and B). The αVβ5 integrin blocking antibody completely abrogated LPA-induced increases in TGF-β activity as assessed by co-culture assay in both asthmatic and non-asthmatic HASMs (Figure 6A and 6B). This indicated that increased LPA induced TGF-β activation observed in asthmatic HASM’s was mediated via the αVβ5 integrin. To determine whether the increased αVβ5 integrin-mediated TGF-β activation was due to higher levels of the αVβ5 integrin on the cell surface of asthmatic HASM cells, β5 integrin subunit cell surface expression was measured by flow cytometry and compared with non-asthmatic cells (Figure 6C and 6D). There was no difference in the mean fluorescent intensity (MFI) of cell surface β5 integrin between asthmatic HASM cells or non-asthmatic HASMs.
Figure 6
Figure 6
The αVβ5 integrin Mediates Increased TGF-β activity in Asthmatic Cells but this is not due to Increased Cell Surface αVβ5 integrin Expression
ASM Cells Express αVβ5 Integrins in vivo and Activate TGF-β, which Promote ASM Hypertrophy in an Ovalbumin Model of Asthma
To investigate the role of the αVβ5 integrin in vivo we used the ovalbumin (OVA) model of airway remodelling. Histological sections from the saline challenged mice showed normal lung architecture, very few inflammatory cells and an intact epithelial layer (Figure 7A). Whereas histological sections from mice sensitised and challenged with OVA showed widespread airway inflammation and evidence of airway remodelling such as a thickened ASM layer (Figure 7B). The ASM layer stained positive for both αSMA and αVβ5 in saline and OVA treated animals, with αvβ5 integrins localised at the ends of actin fibres at cell-cell contacts and on the cell surface (Figure 7C and 7D). When smooth muscle bundles from Ova treated animals were visualised in cross section, it was apparent that ASM cells express αVβ5 integrin on the external surface of the actin fibres at the cell surface (Figure 7E). To confirm that ASM cells can activate TGF-β histological sections were dual labelled with antibodies against αSMA and P-Smad2. ASM cells, as demonstrated by αSMA expression, showed nuclear expression of P-Smad2 (arrowed Figure 7F). Global levels of TGF-β activation in the lung were elevated in OVA treated mice, as estimated by measuring levels of the TGF-β inducible protein PAI-1 in murine lung homogenates by sandwich ELISA (Figure 7G).
Figure 7
Figure 7
A. Haematoxylin and eosin stain of lung section from a saline treated animal. Magnification x20
To assess the importance of αVβ5 integrin-mediated TGF-β activation on airway remodelling an αVβ5 blocking antibody (ALULA) was administered to mice undergoing OVA-induced airway remodelling and the ASM layer around smaller airways assessed. There was minimal staining for αSMA around the smaller airways of saline treated mice (Figure 8A) and the αVβ5 blocking antibody had no effect of saline treated animals (Figure 8B). In sections from mice treated with OVA and an isotype control antibody there was significant thickening of the ASM layer (Figure 8C), and this was reduced in animals receiving an αVβ5 blocking antibody (Figure 8D). The thickness of the ASM layer was quantified, confirming that mice treated with OVA plus an anti-αVβ5 antibody had significantly less αSMA staining around the airways compared with animals treated with OVA and an isotype control antibody (Figure 8E). However, there appeared to be enhanced inflammation on histological sections from mice with OVA induced remodelling treated with the αvβ5 integrin blocking antibody, compared with mice treated with isotype control (Figure 8G and 8H). Therefore, the inflammatory cell infiltrate was quantified on bronchoalveolar lavage (BALF). OVA treatment increased in the total number of inflammatory cells present in BALF (Figure 8F), which appeared enhanced in animals treated with an anti-αVβ5 blocking antibody, however these differences were not statistically significant. There was no difference in the differential cell counts between isotype control and αVβ5 antibody treated animals (data not shown).
Figure 8
Figure 8
A. Histological sections from mice treated with saline and an isotype control antibody were stained with FITC labelled anti-αSMA antibody (green) and a Dapi nuclear stain.
Itgb5-/- Mice Develop Less Allergen-Induced ASM Thickening
To further elucidate the role of αVβ5 in the development of airway remodelling we used an Aspergillous fumigatus (Asp.f) model of allergic airway remodelling in asthma in itgb5-/- mice. Both itgb5-/- and control animals, following saline challenge had minimal αSMA positive cells surrounding their airways (Figure 9A and 9B). Treatment of control mice with Asp.f caused thickening of the ASM layer (Figure 9C), which was reduced in Asp.f exposed itgb5-/- animals (Figure 9D). This reduction in ASM thickness was statistically significant when αSMA staining was quantified (Figure 9E). Similar to the observation in OVA exposed mice, Asp.f caused an increase in the total number of inflammatory cells present in control mice (P<0.005), which was further enhanced in Asp.f exposed itgb5-/- mice (P<0.05).
Figure 9
Figure 9
A. Histological sections from control mice treated with saline were stained with FITC labelled anti-αSMA. The sections were counterstained with a Dapi nuclear stain.
Discussion
The aims of this study were to investigate whether contraction agonists could induce TGF-β activation in HASM cells, to explore the mechanism of activation, and its relevance to asthmatic airway remodelling. We have shown that LPA and methacholine activate TGF-β in HASM’s and we have identified a novel mechanism of TGF-β activation in these cells involving the cytoskeleton, talin and the αVβ5 integrin. We have shown that HASM cells isolated from asthmatic patients activated more TGF-β via this pathway than cells isolated from non-asthmatic individuals. This is, as far as we are aware, the first time that this mechanism of increased TGF-β activation has been described in cells from patients with asthma. Furthermore, we show that murine ASM cells express the αVβ5 integrin in vivo, and can activate TGF-β in an OVA model of asthmatic airway remodelling. Finally, we show that impaired αVβ5 integrin function in vivo, through both pharmacological inhibition and gene deletion, results in reduced allergen-induced ASM thickness but increased airway inflammation. These data identify a key mechanism that dissociates inflammation from airway remodelling in asthma, and supports the novel hypothesis that recurrent bronchoconstriction may possibly lead to contraction-induced TGF-β activation by ASM cells promoting the development of asthmatic airway remodelling.
This is the first description of αVβ5 integrin-mediated TGF-β activation in airway smooth muscle cells. Activation of TGF-β by the αvβ5 integrin occurs in scleroderma fibroblasts promoting the transition of fibroblasts into fibrogenic myofibroblasts (44). Furthermore, myofibroblasts activate TGF-β from extracellular stores by transmitting contractile force via the αvβ5 integrin to latent TGF-β, which is inhibited by αvβ5 function-blocking antibodies (30). Smooth muscle cells are contractile cells, and both LPA and methacholine augment ASM contraction via effects on rhoA and rho kinase (45-47). Our data demonstrate that contraction-induced TGF-β activation was inhibited by blocking the αvβ5 integrin and LPA-induced TGF-β activation was inhibited by the inhibitor of actin assembly, cytochalasin D, and the β2 adrenergic receptor agonist formoterol. Combined, these data suggest that contraction agonists induced αvβ5 integrin mediated TGFβ activation via smooth muscle cell contraction. It is possible that formoterol inhibited TGF-β activation via effects on the cyclic AMP pathway independent of its bronchodilator effects, although the effects of cytochalasin D and observations in myofibroblasts (29) would suggest that cytoskeletal changes are central to αvβ5 integrin mediated TGF-β activation.
Further evidence to support the role of the cytoskeleton in αvβ5 integrin mediated TGF-β activation comes from data obtained from experiments using constructs encoding wild-type and a naturally occurring polymorphism in the β5 integrin subunit (43). This polymorphism leads to a 9 base pair deletion within the NxxY talin binding region of the β5 subunit’s cytoplasmic domain and results in the loss of 3 amino acids (FNK767-769) from the cytoplasmic tail. This polymorphism has not previously been shown to have any functional effect (43), but our data demonstrated that the polymorphism resulted in a β5 subunit that was unable to activate TGF-β. Talin is a cytoplasmic protein capable of binding to the cytoplasmic domains of β integrin subunits and is fundamental for inside-out activation of integrins (48). A role for talin and inside-out activation of integrins in integrin-mediated TGF-β activation has been suggested (49). The data presented here show that talin was still able to interact with the polymorphic β5 subunit, however the rod domain interactions were aberrant. The functional role of the talin rod domain is largely unclear, however, this would suggest that the rod domain of talin could be central for mediating cytoskeletal forces that promote integrin mediated TGFβ activation.
Our data show for the first time that HASM cells from asthmatic patients activated more TGF-β than cells from smooth muscle from non-asthmatic individuals in response to both LPA and methacholine stimulation. It is possible that the enhanced TGF-β activity is merely due to the enhanced total TGF-β secreted by HASMs from asthmatic patients, however we do not favour this possibility. The level of total TGF-β in HASMs from both non-asthmatics and asthmatics was in considerable excess of levels of active TGF-β following stimulation with LPA, as we have found in other cell systems (15, 32). The enhanced TGF-β activity detected in asthmatic cells was completely inhibited by blocking the αVβ5 integrin suggesting that the augmented TGFβ activity observed in asthmatic cells was completely dependent on the αVβ5 integrin. However, no increase in cell surface expression of αVβ5 integrin was found in asthmatic HASM cells compared with non-asthmatic cells. Several studies have suggested that asthmatic HASM has intrinsic hypercontractility compared with non-asthmatic HASM (50-52). Future work will investigate whether hypercontractility of asthmatic HASM cells is responsible for the enhanced TGF-β activation in response to contraction agonists.
It has previously been shown in in vivo models that TGF-β activity is increased in asthma (20, 53) but the cell type responsible for the increased activation and the mechanism of activation have not been investigated. By assessing lung sections from a murine OVA model of asthma we have shown for the first time that ASM cells express αVβ5 and can activate TGF-β in vivo, suggesting that ASM cells may be an important source of TGF-β in asthma. A role for TGF-β activating integrins in asthmatic airway remodelling has been previously suggested since blocking all TGF-β binding integrin function using an RGDS peptide can prevent airway remodelling in an ovalbumin asthma model (54), and fibroblast specific deletion of the itgb8 integrin also reduces ovalbumin induced airway remodelling (26). Whilst, deletion of fibroblast itgb8 reduces TGF-β induced dendritic cell migration and inflammation leading to reduced airway remodelling (26), our data provide evidence that blockade of smooth muscle cell αVβ5 integrins significantly reduces allergen-induced increases in ASM irrespective of effects on inflammation. That ASM thickness was not completely reduced to levels comparable with saline treated animals implies that αVβ5-mediated TGF-β activation may not be the sole mechanism of TGF-β activation promoting increased airway smooth muscle cell mass. Although, αvβ8 integrin mediated TGF-β activation contributes to the development of asthmatic airway remodelling via effects on inflammation, its effects on airway smooth muscle were not investigated (26). Furthermore, the mechanism of TGF-β activation by the αvβ8 integrin does not require cytoskeletal integrity, and thus will not be directly affected by bronchoconstriction.
Whilst it is clear that controlling inflammatory responses are important in asthmatic airway remodelling (26, 55, 56), there is also a positive correlation between airway responsiveness to methacholine and subepithelial fibrosis (57). More recently it has been shown that recurrent bronchoconstriction promotes airway remodelling independent of airway inflammation (4). Furthermore, the muscarinic receptor antagonist tiotropium, which inhibits methacholine induced contraction, reduces allergen-induced increases in ASM mass (58). The mechanism responsible for bronchoconstriction-induced airway remodelling has not been determined, but our data would suggests that bronchoconstriction results in αvβ5 integrin induced TGF-β activation by HASM cells, which then drives structural changes associated with airway remodelling. In addition to reducing allergen-induced increases in ASM mass, blockade or loss of αVβ5 appeared to increase airway inflammation at least in the aspergillus model. The anti-inflammatory effects of TGF-β are well documented (27, 59, 60), therefore, it is possible that inhibiting TGF-β activity on immune and inflammatory cells may exacerbate the inflammation associated with allergen challenge as observed in our studies. Further studies are required to investigate a possible role for αVβ5 in regulating airway inflammation
These data demonstrate that contraction agonists can lead to TGF-β activation in smooth muscle cells via an αvβ5 integrin mediated pathway in vitro, and that this mechanism is accentuated in asthmatic HASMs. Furthermore, inhibiting the function of the αvβ5 integrin reduces airway smooth muscle mass in vivo, without reducing inflammation. It is conceivable that this mechanism may be responsible for the bronchoconstriction induced airway remodelling observed by other groups (4, 57). Thus, whilst global inhibition of αvβ5 integrin mediated TGF-β activation is unlikely to be a useful therapeutic strategy in asthma due to the effects on the inflammatory response, defining cell specific pathways of αvβ5 integrin mediated TGF-β activation, through careful in vitro cell biology, may aid the development of novel therapies for airway remodelling, in patients with poorly controlled disease.
Acknowledgements
We would like to thank Professor Kawahara for providing the β5 constructs and Professor Daniel Rifkin for supplying the TMLC reporter cells. We would also like to thank Katherine Huang for her assistance with the Asp.f in vivo model and Amha Atakilit for producing and supplying the αVβ5 blocking antibody for the in vivo studies. Furthermore, we would like to thank the nurses at Glenfield Hospital, Leicester and City Hospital, Nottingham for subject recruitment and to Ruth Saunders for isolation and characterisation of primary HASM cells.
Financial Support This work was supported by the Wellcome Trust (project grant number 085350, programme grant number 083122 and Senior Clinical Fellowship 082265), Asthma UK (project grant number 07/026) and the Nottingham Respiratory Biomedical Research Unit.
1. Benayoun L, Druilhe A, Dombret MC, Aubier M, Pretolani M. Airway structural alterations selectively associated with severe asthma. American journal of respiratory and critical care medicine. 2003;167:1360–1368. [PubMed]
2. Lange P, Parner J, Vestbo J, Schnohr P, Jensen G. A 15-year follow-up study of ventilatory function in adults with asthma. The New England journal of medicine. 1998;339:1194–1200. [PubMed]
3. Silva PL, Passaro CP, Cagido VR, Bozza M, Dolhnikoff M, Negri EM, Morales MM, Capelozzi VL, Zin WA, Rocco PR. Impact of lung remodelling on respiratory mechanics in a model of severe allergic inflammation. Respiratory physiology & neurobiology. 2008;160:239–248. [PubMed]
4. Grainge CL, Lau LC, Ward JA, Dulay V, Lahiff G, Wilson S, Holgate S, Davies DE, Howarth PH. Effect of bronchoconstriction on airway remodeling in asthma. The New England journal of medicine. 364:2006–2015. [PubMed]
5. Boxall C, Holgate ST, Davies DE. The contribution of transforming growth factor-beta and epidermal growth factor signalling to airway remodelling in chronic asthma. Eur Respir J. 2006;27:208–229. [PubMed]
6. Coutts A, Chen G, Stephens N, Hirst S, Douglas D, Eichholtz T, Khalil N. Release of biologically active TGF-beta from airway smooth muscle cells induces autocrine synthesis of collagen. American journal of physiology. 2001;280:L999–1008. [PubMed]
7. Moir LM, Burgess JK, Black JL. Transforming growth factor beta 1 increases fibronectin deposition through integrin receptor alpha 5 beta 1 on human airway smooth muscle. The Journal of allergy and clinical immunology. 2008;121:1034–1039. e1034. [PubMed]
8. Kucich U, Rosenbloom JC, Shen G, Abrams WR, Hamilton AD, Sebti SM, Rosenbloom J. TGF-beta1 stimulation of fibronectin transcription in cultured human lung fibroblasts requires active geranylgeranyl transferase I, phosphatidylcholine-specific phospholipase C, protein kinase C-delta, and p38, but not erk1/erk2. Archives of biochemistry and biophysics. 2000;374:313–324. [PubMed]
9. McMillan SJ, Xanthou G, Lloyd CM. Manipulation of allergen-induced airway remodeling by treatment with anti-TGF-beta antibody: effect on the Smad signaling pathway. J Immunol. 2005;174:5774–5780. [PubMed]
10. Gregory LG, Mathie SA, Walker SA, Pegorier S, Jones CP, Lloyd CM. Overexpression of Smad2 drives house dust mite-mediated airway remodeling and airway hyperresponsiveness via activin and IL-25. American journal of respiratory and critical care medicine. 182:143–154. [PMC free article] [PubMed]
11. Moffatt MF, Gut IG, Demenais F, Strachan DP, Bouzigon E, Heath S, von Mutius E, Farrall M, Lathrop M, Cookson WO. A large-scale, consortium-based genomewide association study of asthma. The New England journal of medicine. 363:1211–1221. [PubMed]
12. Annes JP, Munger JS, Rifkin DB. Making sense of latent TGFbeta activation. Journal of cell science. 2003;116:217–224. [PubMed]
13. Lyons RM, Gentry LE, Purchio AF, Moses HL. Mechanism of activation of latent recombinant transforming growth factor beta 1 by plasmin. The Journal of cell biology. 1990;110:1361–1367. [PMC free article] [PubMed]
14. Yu Q, Stamenkovic I. Cell surface-localized matrix metalloproteinase-9 proteolytically activates TGF-beta and promotes tumor invasion and angiogenesis. Genes & development. 2000;14:163–176. [PubMed]
15. Tatler AL, Porte J, Knox A, Jenkins G, Pang L. Tryptase activates TGFbeta in human airway smooth muscle cells via direct proteolysis. Biochemical and biophysical research communications. 2008;370:239–242. [PubMed]
16. Brown PD, Wakefield LM, Levinson AD, Sporn MB. Physicochemical activation of recombinant latent transforming growth factor-beta’s 1, 2, and 3. Growth factors (Chur, Switzerland) 1990;3:35–43. [PubMed]
17. Ribeiro SM, Poczatek M, Schultz-Cherry S, Villain M, Murphy-Ullrich JE. The activation sequence of thrombospondin-1 interacts with the latency-associated peptide to regulate activation of latent transforming growth factor-beta. The Journal of biological chemistry. 1999;274:13586–13593. [PubMed]
18. Torrego A, Hew M, Oates T, Sukkar M, Chung K. Fan. Expression and activation of TGF-beta isoforms in acute allergen-induced remodelling in asthma. Thorax. 2007;62:307–313. [PMC free article] [PubMed]
19. Sagara H, Okada T, Okumura K, Ogawa H, Ra C, Fukuda T, Nakao A. Activation of TGF-beta/Smad2 signaling is associated with airway remodeling in asthma. The Journal of allergy and clinical immunology. 2002;110:249–254. [PubMed]
20. Lee SY, Kim JS, Lee JM, Kwon SS, Kim KH, Moon HS, Song JS, Park SH, Kim YK. Inhaled corticosteroid prevents the thickening of airway smooth muscle in murine model of chronic asthma. Pulmonary pharmacology & therapeutics. 2008;21:14–19. [PubMed]
21. Howat WJ, Holgate ST, Lackie PM. TGF-beta isoform release and activation during in vitro bronchial epithelial wound repair. American journal of physiology. 2002;282:L115–123. [PubMed]
22. Lindstedt KA, Wang Y, Shiota N, Saarinen J, Hyytiainen M, Kokkonen JO, Keski-Oja J, Kovanen PT. Activation of paracrine TGF-beta1 signaling upon stimulation and degranulation of rat serosal mast cells: a novel function for chymase. Faseb J. 2001;15:1377–1388. [PubMed]
23. Woodman L, Siddiqui S, Cruse G, Sutcliffe A, Saunders R, Kaur D, Bradding P, Brightling C. Mast cells promote airway smooth muscle cell differentiation via autocrine up-regulation of TGF-beta 1. J Immunol. 2008;181:5001–5007. [PubMed]
24. Yang Z, Mu Z, Dabovic B, Jurukovski V, Yu D, Sung J, Xiong X, Munger JS. Absence of integrin-mediated TGFbeta1 activation in vivo recapitulates the phenotype of TGFbeta1-null mice. The Journal of cell biology. 2007;176:787–793. [PMC free article] [PubMed]
25. Aluwihare P, Mu Z, Zhao Z, Yu D, Weinreb PH, Horan GS, Violette SM, Munger JS. Mice that lack activity of alphavbeta6- and alphavbeta8-integrins reproduce the abnormalities of Tgfb1- and Tgfb3-null mice. Journal of cell science. 2009;122:227–232. [PubMed]
26. Kitamura H, Cambier S, Somanath S, Barker T, Minagawa S, Markovics J, Goodsell A, Publicover J, Reichardt L, Jablons D, Wolters P, Hill A, Marks JD, Lou J, Pittet JF, Gauldie J, Baron JL, Nishimura SL. Mouse and human lung fibroblasts regulate dendritic cell trafficking, airway inflammation, and fibrosis through integrin alphavbeta8-mediated activation of TGF-beta. The Journal of clinical investigation. 121:2863–2875. [PMC free article] [PubMed]
27. Munger JS, Huang X, Kawakatsu H, Griffiths MJ, Dalton SL, Wu J, Pittet JF, Kaminski N, Garat C, Matthay MA, Rifkin DB, Sheppard D. The integrin alpha v beta 6 binds and activates latent TGF beta 1: a mechanism for regulating pulmonary inflammation and fibrosis. Cell. 1999;96:319–328. [PubMed]
28. Mu D, Cambier S, Fjellbirkeland L, Baron JL, Munger JS, Kawakatsu H, Sheppard D, Broaddus VC, Nishimura SL. The integrin alpha(v)beta8 mediates epithelial homeostasis through MT1-MMP-dependent activation of TGF-beta1. The Journal of cell biology. 2002;157:493–507. [PMC free article] [PubMed]
29. Asano Y, Ihn H, Yamane K, Jinnin M, Mimura Y, Tamaki K. Increased expression of integrin alpha(v)beta3 contributes to the establishment of autocrine TGF-beta signaling in scleroderma fibroblasts. J Immunol. 2005;175:7708–7718. [PubMed]
30. Wipff PJ, Rifkin DB, Meister JJ, Hinz B. Myofibroblast contraction activates latent TGF- 1 from the extracellular matrix. The Journal of cell biology. 2007;179:1311–1323. [PMC free article] [PubMed]
31. Jenkins RG, Su X, Su G, Scotton CJ, Camerer E, Laurent GJ, Davis GE, Chambers RC, Matthay MA, Sheppard D. Ligation of protease-activated receptor 1 enhances alpha(v)beta6 integrin-dependent TGF-beta activation and promotes acute lung injury. The Journal of clinical investigation. 2006;116:1606–1614. [PMC free article] [PubMed]
32. Xu MY, Porte J, Knox AJ, Weinreb PH, Maher TM, Violette SM, McAnulty RJ, Sheppard D, Jenkins RG. Lysophosphatidic Acid Induces {alpha}v{beta}6 Integrin-Mediated TGF-{beta} Activation via the LPA2 Receptor and the Small G Protein G{alpha}q. The American journal of pathology. 2009 [PubMed]
33. Asano Y, Ihn H, Yamane K, Jinnin M, Mimura Y, Tamaki K. Involvement of alphavbeta5 integrin-mediated activation of latent transforming growth factor beta1 in autocrine transforming growth factor beta signaling in systemic sclerosis fibroblasts. Arthritis and rheumatism. 2005;52:2897–2905. [PubMed]
34. Scotton CJ, Krupiczojc MA, Konigshoff M, Mercer PF, Lee YC, Kaminski N, Morser J, Post JM, Maher TM, Nicholson AG, Moffatt JD, Laurent GJ, Derian CK, Eickelberg O, Chambers RC. Increased local expression of coagulation factor X contributes to the fibrotic response in human and murine lung injury. The Journal of clinical investigation. 2009;119:2550–2563. [PMC free article] [PubMed]
35. Pang L, Knox AJ. Effect of interleukin-1 beta, tumour necrosis factor-alpha and interferon-gamma on the induction of cyclo-oxygenase-2 in cultured human airway smooth muscle cells. British journal of pharmacology. 1997;121:579–587. [PubMed]
36. Kaur D, Saunders R, Berger P, Siddiqui S, Woodman L, Wardlaw A, Bradding P, Brightling CE. Airway smooth muscle and mast cell-derived CC chemokine ligand 19 mediate airway smooth muscle migration in asthma. American journal of respiratory and critical care medicine. 2006;174:1179–1188. [PubMed]
37. Weglarz L, Molin I, Orchel A, Parfiniewicz B, Dzierzewicz Z. Quantitative analysis of the level of p53 and p21(WAF1) mRNA in human colon cancer HT-29 cells treated with inositol hexaphosphate. Acta biochimica Polonica. 2006;53:349–356. [PubMed]
38. Clifford RL, Deacon K, Knox AJ. Novel regulation of vascular endothelial growth factor-A (VEGF-A) by transforming growth factor (beta)1: requirement for Smads, (beta)-CATENIN, AND GSK3(beta) The Journal of biological chemistry. 2008;283:35337–35353. [PubMed]
39. John AE, Zhu YM, Brightling CE, Pang L, Knox AJ. Human airway smooth muscle cells from asthmatic individuals have CXCL8 hypersecretion due to increased NF-kappaB p65, C/EBPbeta, and RNA polymerase II binding to the CXCL8 promoter. J Immunol. 2009;183:4682–4692. [PubMed]
40. Huang X, Griffiths M, Wu J, Farese RV, Jr., Sheppard D. Normal development, wound healing, and adenovirus susceptibility in beta5-deficient mice. Mol Cell Biol. 2000;20:755–759. [PMC free article] [PubMed]
41. Gordon S, Wang, Woodruff, Yuan, Solon, Conway, Huang, Locksley, Fahy A Protective Role for Periostin in IgE Mediated Allergy and Airway Hyper-responsiveness. Clinical and Experimental Allergy. 2011 (In press) [PMC free article] [PubMed]
42. Sera T, Uesugi K, Himeno R, Yagi N. Small airway changes in healthy and ovalbumin-treated mice during quasi-static lung inflation. Respiratory physiology & neurobiology. 2007;156:304–311. [PubMed]
43. Kawahara E, Saito A, Kobayashi J, Maenaka S, Minamoto T, Imai MA, Oda Y. Adhesiveness of beta5 integrin variant lacking FNK767-769 is similar to that of the prototype containing FNKFNK764-769. Cell biology international. 2005;29:521–528. [PubMed]
44. Asano Y, Ihn H, Jinnin M, Mimura Y, Tamaki K. Involvement of alphavbeta5 integrin in the establishment of autocrine TGF-beta signalling in dermal fibroblasts derived from localised scleroderma. J Invest Dermatol. 2006;126(8):1761–9. [PubMed]
45. Toews ML, Ustinova EE, Schultz HD. Lysophosphatidic acid enhances contractility of isolated airway smooth muscle. J Appl Physiol. 1997;83:1216–1222. [PubMed]
46. Sakai J, Oike M, Hirakawa M, Ito Y. Theophylline and cAMP inhibit lysophosphatidic acid-induced hyperresponsiveness of bovine tracheal smooth muscle cells. J Physiol. 2003;549:171–180. [PubMed]
47. Bai Y, Sanderson MJ. The contribution of Ca2+ signaling and Ca2+ sensitivity to the regulation of airway smooth muscle contraction is different in rats and mice. American journal of physiology. 2009;296:L947–958. [PubMed]
48. Calderwood DA, Zent R, Grant R, Rees DJ, Hynes RO, Ginsberg MH. The Talin head domain binds to integrin beta subunit cytoplasmic tails and regulates integrin activation. The Journal of biological chemistry. 1999;274:28071–28074. [PubMed]
49. Sheppard D. Integrin-mediated activation of latent transforming growth factor beta. Cancer metastasis reviews. 2005;24:395–402. [PubMed]
50. Ammit AJ, Armour CL, Black JL. Smooth-muscle myosin light-chain kinase content is increased in human sensitized airways. American journal of respiratory and critical care medicine. 2000;161:257–263. [PubMed]
51. Bramley AM, Thomson RJ, Roberts CR, Schellenberg RR. Hypothesis: excessive bronchoconstriction in asthma is due to decreased airway elastance. Eur Respir J. 1994;7:337–341. [PubMed]
52. Thomson RJ, Bramley AM, Schellenberg RR. Airway muscle stereology: implications for increased shortening in asthma. American journal of respiratory and critical care medicine. 1996;154:749–757. [PubMed]
53. Rosendahl A, Checchin D, Fehniger TE, ten Dijke P, Heldin CH, Sideras P. Activation of the TGF-beta/activin-Smad2 pathway during allergic airway inflammation. American journal of respiratory cell and molecular biology. 2001;25:60–68. [PubMed]
54. Dekkers BG, Bos IS, Gosens R, Halayko AJ, Zaagsma J, Meurs H. The integrin-blocking peptide RGDS inhibits airway smooth muscle remodeling in a guinea pig model of allergic asthma. American journal of respiratory and critical care medicine. 181:556–565. [PubMed]
55. Humbles AA, Lloyd CM, McMillan SJ, Friend DS, Xanthou G, McKenna EE, Ghiran S, Gerard NP, Yu C, Orkin SH, Gerard C. A critical role for eosinophils in allergic airways remodeling. Science (New York, N.Y. 2004;305:1776–1779. [PubMed]
56. Flood-Page P, Menzies-Gow A, Phipps S, Ying S, Wangoo A, Ludwig MS, Barnes N, Robinson D, Kay AB. Anti-IL-5 treatment reduces deposition of ECM proteins in the bronchial subepithelial basement membrane of mild atopic asthmatics. The Journal of clinical investigation. 2003;112:1029–1036. [PMC free article] [PubMed]
57. Boulet LP, Laviolette M, Turcotte H, Cartier A, Dugas M, Malo JL, Boutet M. Bronchial subepithelial fibrosis correlates with airway responsiveness to methacholine. Chest. 1997;112:45–52. [PubMed]
58. Gosens R, Bos IS, Zaagsma J, Meurs H. Protective effects of tiotropium bromide in the progression of airway smooth muscle remodeling. American journal of respiratory and critical care medicine. 2005;171:1096–1102. [PubMed]
59. Kulkarni AB, Huh CG, Becker D, Geiser A, Lyght M, Flanders KC, Roberts AB, Sporn MB, Ward JM, Karlsson S. Transforming growth factor beta 1 null mutation in mice causes excessive inflammatory response and early death. Proceedings of the National Academy of Sciences of the United States of America. 1993;90:770–774. [PubMed]
60. Leung SY, Niimi A, Noble A, Oates T, Williams AS, Medicherla S, Protter AA, Chung KF. Effect of transforming growth factor-beta receptor I kinase inhibitor 2,4-disubstituted pteridine (SD-208) in chronic allergic airway inflammation and remodeling. The Journal of pharmacology and experimental therapeutics. 2006;319:586–594. [PubMed]