PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Arthritis Rheum. Author manuscript; available in PMC May 1, 2013.
Published in final edited form as:
PMCID: PMC3238788
NIHMSID: NIHMS341739
CX3CR1 deficient mice have decreased Th17 and antigen-specific humoral responses in the collagen induced arthritis (CIA) model
Teresa K. Tarrant, M.D.,1 Peng Liu, M.D., Ph.D.,1 Rishi R. Rampersad, B.A.,1 Denise Esserman, Ph.D.,2 Lisa R. Rothlein, B.A.,1 Roman G Timoshchenko,1 Marcus W. McGinnis,1 David J Fitzhugh,1 Dhavalkumar D. Patel, M.D., Ph.D.,1,6 and Alan M. Fong, Ph.D1
1Thurston Arthritis Research Center and the Department of Medicine, Division of Rheumatology, Allergy, and Immunology, University of North Carolina School of Medicine, Chapel Hill, NC 27599, USA
2UNC School of Public Health, Chapel Hill, NC 27599, USA
6Novartis Institutes for BioMedical Research, Basel, Switzerland
Correspondences and requests for reprints should be addressed to: Teresa Tarrant, MD, Assistant Professor of Medicine, University of North Carolina at Chapel Hill, CB# 7280, 3300 Manning Dr., Chapel Hill, NC 27599, tarra002/at/med.unc.edu
Objective
CX3CR1 is a chemokine receptor that uniquely binds to its ligand fractalkine (FKN or CX3CL1) and has been shown to be important in inflammatory arthritis responses largely due to effects on cellular migration. In this study, we tested the hypothesis that genetic deficiency of CX3CR1 would be protective in the chronic inflammatory arthritis model, collagen induced arthritis (CIA). Because CX3CR1 is expressed on T cells and antigen-presenting cells, we additionally examined adaptive immune functions in this model.
Methods
Autoantibody formation, clinical, histologic, T cell proliferative, and cytokine responses were evaluated in DBA-1J mice deficient in (-/-) or wildtype (+/+) for CX3CR1 after immunization with heterologous type II collagen.
Results
CX3CR1-/- mice had an approximate 30% reduction in arthritis by two independent measures of paw swelling (p<0.01) and clinical disease score (p<0.0001). Additionally, CX3CR1-/- mice had an approximate 50% decrease in anti-type II collagen autoantibody formation (p<0.05), decreased Th17 intra-articular cytokine expression (IL-17 p<0.01 and IL-23 p<0.001), and decreased total numbers of Th17 cells in inflamed joints (p<0.05).
Conclusions
Deficiency of CX3CR1 is protective in inflammatory arthritis and may have effects that extend beyond migration that involve adaptive immune responses in autoimmune disease.
Many chemokine-receptor interactions have been implicated in the inflammatory cellular trafficking of rheumatoid arthritis (RA) (reviewed in (1)). However, the promiscuity of ligand-receptor interactions within most chemokine receptor families has been difficult to overcome therapeutically in clinical trials that have targeted the blockade of an individual chemokine or its receptor in arthritis patients (2, 3). The solitary member of the CX3CR family, CX3CR1, is unique in that it has only one known ligand, fractalkine (FKN or CX3CL1) (4), and blockade of the CX3CL1/CX3CR1 signaling axis has been shown to be efficacious in several pre-clinical models of inflammation (reviewed in (5)). With particular relevance to RA, CX3CL1 and CX3CR1 are upregulated in inflammatory cells within the synovial tissue in rat adjuvant induced arthritis (AIA) (6), and CX3CL1 mediates T-cell dependent proliferation of synovial fibroblasts from RA patients (7). In the mouse collagen induced arthritis (CIA) chronic model, mice treated with a neutralizing antibody to CX3CL1 have lower clinical scores, improved histology, and decreased migration of adoptively transferred splenic monocytes to the joint (8). Additionally, patients with RA have increased CX3CR1+ T cells circulating in the peripheral blood (6), and increasing levels of CX3CR1+ T cells and monocytes in the synovial fluid that correlate with disease activity (6). These data suggest that CX3CL1/CX3CR1 signaling plays an important role in the trafficking and function of inflammatory cell subsets in RA.
CX3CR1 signaling is also important in the pathogenesis of inflammatory vascular disease and atherosclerosis (9-12), which is a complication from longstanding RA (13). Our group has shown that CX3CR1 deficiency is protective from intimal hyperplasia after arterial injury in mice as a result of decreased monocyte trafficking (9) and decreased dendritic cell accumulation (11) in atherosclerotic plaques. In humans, a naturally occurring gene polymorphism (CX3CR1-M280) correlates with a lower prevalence of atherosclerosis (10, 12), which could potentially be explained by reduced CX3CL1-dependent cellular adhesion in inflammatory cells expressing CX3CR1-M280 (10). These data suggest that blockade of CX3CR1 interactions may be an important therapeutic target for the treatment of RA and the inflammatory sequelae that arise from it, such as atherosclerosis.
Because CX3CR1 is predominantly expressed on T cells and antigen presenting cells (11, 14, 15), we hypothesized that adaptive immune responses may be affected beyond the migration abnormalities seen with blockade of the ligand CX3CL1 (8) in an immunization model of inflammatory arthritis (CIA). Consequently, we investigated clinical disease outcomes, autoantibody formation, T cell responses, histopathology, and cytokine responses in the CIA model comparing mice with a gene deletion of CX3CR1 (CX3CR1-/-) to that of wildtype controls (+/+). Our results suggest that inhibition of CX3CR1 may have beneficial effects in inflammatory arthritis beyond that of migration since decreased autoantibodies and pro-inflammatory Th17 responses were observed in CX3CR1-deficient animals.
Animals
All animals were bred, housed, and cared for in DLAM facilities under the approved IACUC protocol number 09-245.0 in pathogen free specific conditions.
Antibodies
Antibodies used for these experiments purchased from eBioscience (San Diego, CA) included anti-CD3 and anti-CD28 for T cell proliferation studies, and anti-CD4-eFluor 450, and anti-IFN-γ-APC for flow cytometry. Anti-CX3CR1 antibodies (R&D, Minneapolis, MN) and anti-IL-17A-PE antibodies (BD Pharmingen, San Diego, CA) were also used for flow cytometry.
Induction and evaluation of Collagen Induced Arthritis
CX3CR1-/- and wildtype controls were backcrossed ≥ 7 generations on the highly susceptible CIA background, DBA-1J (16). 8 week old male mice were immunized with Freund’s adjuvant (Sigma Aldrich, St. Louis, MO), Complete on day -21 and Incomplete on day 0, with 100 μg per mouse of bovine type II collagen (Chondrex, Redmond, WA) in a 1:1 mixture of adjuvant and collagen injected subcutaneously into the base of the tail. Our protocol utilizes a second booster injection because 1) a single injection has more variability in disease onset, 2) using two injections, most animals achieve maximum disease by 6 weeks compared to only 40% after a single injection, and 3) a single injection results in less overall total disease severity. This protocol has been well characterized by Wooley and others (16). Mice were measured by a blinded observer for 1) a clinical disease scoring index and 2) measurement of paw swelling from baseline. Clinical disease index was performed with the following scoring system: 0=normal paw; 1=mild but definite swelling of either the ankle or digits; 2=moderate redness and swelling of an ankle ± any number of digits; 3=maximal redness and swelling of the entire paw and digits with or without ankylosis. The maximum score per paw was 3 with a total score obtainable of 12 per mouse. This scoring system has been validated by our group previously (17, 18). Paw swelling measurements were obtained by measuring the thickness of the fore- and hindlimbs at the wrist or ankle respectively. Paw swelling is presented as a change in the mean thickness of the mouse’s fore- and hindlimbs (mm) from its baseline average.
Histopathology
At experiment termination, hindlimbs were fixed (4% paraformaldehyde), decalcified (formic acid), and embedded in paraffin. Serial 5 μm sections were cut and stained with hematoxylin and eosin (H&E) according to standard protocols for morphologic analysis.
Anti-collagen antibody ELISA
IgG anti-type II collagen antibodies were measured by standard sandwich ELISA (Chondrex, Redmond, WA). Autoantibodies in CIA can be assessed at many time points, but are typically analyzed between days -7 and 14, when they are most elevated (19). We chose to analyze autoantibodies before the second injection and disease onset (day -7 and day 0) to examine the rise in production of autoantibodies, which are thought to precede clinical illness and be directly pathogenic (20). Serum was collected from CIA immunized mice (days -7 and 0) by tail vein according to previously published protocols (21) and diluted 1:5,000 for autoantibody measurement by ELISA, as performed per manufacturer’s instructions.
Lymph node T cell proliferation and intra-cytokine staining for IL-17 and IFN-γ
In CIA, autoantigen recognition and T cell proliferation and differentiation are initiated in the first 2 weeks of initial immunization (22). This is typically the optimal time to assess T cell proliferative responses and T cell cytokine production to in vitro stimulation. We isolated the draining lymph nodes (iliac and inguinal) from the site of immunization (base of the tail) where we expected to see the most potent immune response (day -7 second injection). For proliferation studies, cells were isolated in RPMI + 1% naïve syngeneic mouse sera + 10 mM HEPES + 25 units/ml heparin, and then further enriched for CD4+ T cells using the negative selection MACS mouse CD4+ T cell isolation kit (Miltenyi Biotec, Auburn, CA) as per manufacturer’s instructions. Enriched T cells from WT or CX3CR1-/- mice were stimulated in 96 well flat-bottomed plates using 3 conditions: 1.) with anti-CD3 (1μg/ml) + anti-CD28 (1μg/ml), 2.) with irradiated APCs from the spleen of a naïve syngeneic mouse + T cell proliferation grade bovine type II collagen (100 μg/ml) (Chondrex, Redmond, WA), or 3.) with irradiated APCs in media alone. Cultures were incubated at 37° C for 48 hrs, then 1 μCi of 3H-thymidine was added to each well, and cultures were incubated an additional 15-18 hr prior to scintillation counting. For intra-cytokine staining of IL-17 or IFN-γ, lymphocytes were stimulated with anti-CD3 (5μg/ml coated plate) and anti-CD28 (1μg/ml) in 24-well cell culture for 6 hrs, and Golgi Stop (1ul/ml, BD Biosciences, San Jose, CA) was added to the culture for the last two hours. Cells were harvested and stained for surface CD4 and intracellular IL-17 and IFN-γ, and then analyzed by flow cytometry.
RT-PCR for intra-articular cytokine, matrix metalloproteinase, and chemokine/receptor analysis
Arthritic paws (score=2) were collected for RNA analysis on day 10, which is early onset of arthritis and were compared to naïve, unimmunized paws (score=0). All paw samples were homogenized using an OmniTH homogenizer. Total RNA was extracted with TRIZOL reagent (Invitrogen Life technologies, Carlsbad, CA) and cDNA synthesis was carried out with Superscript II reverse transcriptase (Invitrogen Life technologies) according to the manufacturer’s protocol. Real time quantitative PCR (qRT-PCR) was performed using a Bio-Rad iCycler and Sensimix SYBR and Fluorscein kit (Quantace, LTD, Tauton, MA). The total volume of each reaction was 25 μl including 12.5 μl of 2X SYBR Green supermix, 0.625 μl of each primer at a concentration of 20 μM, 10.25μl of RNase-free water and 1 μl of cDNA. The PCR was carried out using the following thermocycling conditions: 95°C for 3 min, 40 cycles at 60°C for 30s, 95°C for 1 min and 60°C for 1 min. IDUA rRNA was used as a control. The following sets of primers were used: IDUA: forward-GCATCCAAGTGG GTGAAGTT, reverse-CATTGAGCAGGTCCGGATAC; FKN: forward-CGCGTTCTTCCATTTGTGTA, reverse- GTCTGTGCTGTGTCGTCTCC; MMP1; forward-AACTACATTTAGGGGAGAGGTGT, reverse-GCAGCGTCAAGTTTAACTGGAA; MMP2: forward-CGGAGA TCTGCAAACAGGACA, reverse-CGCCAAATAAACCGGTCCTT; MMP9: forward-GCGTGTCTG GAGATTCGACTT, reverse-TATCCACGCGAATGACGCT; MMP13: forward-CTTCTTCTTGTTGAGCTGGACTC, reverse-CTGTGGAGGTCACTGTAGACT; TNFα: forward-CATCTTCTCAAAATT CGAGTGACAA, reverse-TGGGAGTAGACAAGGTACAACCC; IL1-β: forward- GGT CAA AGG TTT GGA AGC AG, reverse- TGT GAA ATG CCA CCT TTT GA; IL6: forward-. CAA AGC CAG AGT CCT TCA GAG, reverse- GGA TGG TCT TGG TCC TTA GC; IL17: forward- CTC CAG AAG GCC CTC AGA CTA C, reverse- AGC TTT CCC TCC GCA TTG ACA CAG; IL23p19: forward - AGC GGG ACA TAT GAA TCT ACT AAG AGA, reverse - GTC CTA GTA GGG AGG TGT GAA GTT G -3. The RT-PCR primers that were used for IL-17 detection in the joint are specifically directed toward the family member IL-17A, which is exclusively expressed by T cells (23).
Intra-articular determination of Th17 cells
Inflammatory cells were liberated from the early inflamed joint according to our previously published protocol (18) using dissection of the joint capsule followed by Collagenase D (Sigma Aldrich, St. Louis, MO) digestion at 2 mg/ml in warmed PBS for 30 minutes. Afterward, cells were strained through a 70 micron filter to inhibit contamination with stromal cells, stained for surface CD4 expression, fixed and permeabilized with BD Cytofix/Cytoperm (BD Bioscience, San Diego, CA), and then stained for intracellular IL-17A.
Data analysis
For clinical disease and paw swelling curves, a statistical curve-fit was used as in our previous reports (17, 18) to determine whether significant differences existed in disease over time between CX3CR1-/- mice versus wildtype controls. The advantage of this statistical test is its effectiveness for studying change. A backward selection (α=.05) procedure was used to select a linear mixed model with the best fit for the individual curves. Statistical variables included group, time, and experiment effect. The longitudinal analysis (mixed model) affords us the ability to distinguish variation that may be observed across time for a particular mouse from the variation among the group (24). The overall group effect was assessed using a likelihood ratio test (LRTx) (α=.05). The best fit curves were plotted using predicted values calculated using the fixed effects from the models, averaging across experiment, which was controlled for if it was a significant (α=.05) predictor in the model using SAS, v. 9.1. For T cell proliferation, anti-collagen antibody assays, intra-articular cytokine analysis by RT-PCR, and quantification of Th17 cells in inflamed joints by flow cytometry, an unpaired two-tailed t test was used to compare the means between groups.
CX3CR1-/- mice have less arthritis in CIA when compared to controls
In humans with RA, increased CX3CR1 expression on circulating T cells (6, 25) and on T cells and monocytes in the synovial fluid (6) correlates with disease activity. To investigate whether or not absence of CX3CR1 expression confers protection in inflammatory arthritis, we examined CX3CR1-/- mice and their wildtype controls in a chronic inflammatory arthritis model (CIA), which has similarities to rheumatoid arthritis in its histopathology, MHC II restriction, and waxing-waning clinical course (16). We found that animals with a targeted genetic deletion of CX3CR1 had approximately 30% less disease when compared to controls by two independent measures of paw swelling (p<0.01) and clinical disease severity index (p<0.0001) (Figure 1A, B). Although there was less inflammation in CX3CR1-/- mice (Figure 1A, B), the CX3CR1-/- animals were capable of developing erosions (Figure 1D) similar to wildtype controls (Figure 1C) by histopathology.
Figure 1
Figure 1
CX3CR1-/- mice have decreased clinical inflammation by two independent measures compared to wildtype controls in the collagen induced arthritis model (CIA)
CX3CR1-/- mice have decreased autoantibody formation to type II collagen but similar T cell proliferative responses
CX3CR1 is expressed on monocytes (15), B cells (26), and dendritic cells (6, 27), which are antigen presenting cells important for the induction of antibody responses. Additionally, the percent of dendritic cells expressing CX3CR1 is known to increase during joint inflammation in rat AIA (6), which could affect antigen presentation and subsequent autoantibody formation. For these reasons, we hypothesized that adaptive immune responses may be affected as a result of the absence of CX3CR1 on immune cells, and effects on CIA could extend beyond the migration abnormalities previously seen with blockade of the ligand CX3CL1 (8). Consequently, we examined levels of pre-clinical anti-type II collagen autoantibodies, which are known to be pathogenic in CIA and develop prior to the onset of clinical arthritis (20). In CIA, T cell activation, proliferation, and initiation of B cell responses are initiated in the first 2 weeks of initial immunization (22); therefore, we chose to examine lymph node derived T cell proliferative responses as well as autoantibody formation at this time point. Anti-type II collagen antibody responses from CX3CR1-/- mice were approximately 50% less than that of wildtype controls on both day -7 (p<0.05) and day 0 (p<0.01) with substantially higher autoantibodies in wildtype animals as they were approaching the onset of clinical disease (day 0) (Figure 2). In contrast, no significant differences were noted in T cell activation and proliferation (Table 1).
Figure 2
Figure 2
CX3CR1-/- mice have decreased autoantibody production compared to wildtype controls in CIA
Table 1
Table 1
T cell proliferative responses to CD3/CD28 engagement and type II collagen.
CX3CR1-/- mice with CIA have a selective decrease in Th17 cytokines and decreased total numbers of T helper 17 (Th17) cells in arthritic paws
Pro-inflammatory cytokines such as IL-1β, TNF-α, IL-6, IL-17, IL-23, and matrix metalloproteinases (MMPs) have been shown to play an important role in the pathophysiology of inflammatory arthritis in both humans and in animal models (28-32). Consequently, we chose to examine intra-articular cytokine production of these key pro-inflammatory mediators by RT-PCR (33) using severely inflamed joints (clinical score=2) from animals with early inflammation (day 10). MMP-1, -2, and -9 were similar between both groups (Figure 3B) in addition to CX3CL1 (Figure 3A). CX3CR1-/- mice had decreased, but not statistically significant, levels of pro-inflammatory MMP-13 (Figure 3B) and cytokines IL-6, IL-1β, and TNF-α (Figure 3A). In contrast, IL-17 levels were reduced >5 fold (p<0.01), and IL-23 was reduced >3 fold (p<0.001) in CX3CR1-/- mice (Figure 3A). To determine if there were fewer Th17 cells in the inflamed joints of CX3CR1-/- mice, we dissected and collagenase digested the joint capsules of severely inflamed (clinical score=2), early arthritis paws (days 14-16) from wildtype (n=10) and CX3CR1-/- (n=7) CIA mice and analyzed cellular infiltrate by flow cytometry. We chose endpoints of days 14-16 for flow cytometry as compared to day 10 for RT-PCR to ensure that protein levels of IL-17 were elevated above the limit of detection after transcriptional upregulation. CD4+ IL-17+ T lymphocytes were identified in the joints of CIA immunized mice, and CX3CR1-/- mice had a 3-fold decrease in the absolute number of articular Th17 lymphocytes as compared to wildtype mice (p<0.05) (Figure 4).
Figure 3
Figure 3
CX3CR1-/- mice have a statistically significant decrease in relative gene expression of IL-17 and IL-23 in paws with early inflammatory arthritis
Figure 4
Figure 4
CX3CR1-/- mice have fewer Th17 cells in inflamed arthritic joints
To further examine the relationship of CX3CR1 and IL-17 on T cells, we analyzed lymphocytes from the draining lymph nodes (iliac and inguinal) by flow cytometry and identified a small subpopulation of CX3CR1 expressing cells above background levels that also expressed CD4 and IL-17. Specifically, of the wildtype lymphocytes that stained positive for both CD4 and CX3CR1 0.96% ± 0.15% (n=5), we detected 5.14% ± 1.4% of this subpopulation to also be positive for IL-17. This population was too small to reliably perform migration studies. To investigate whether CX3CR1 deficiency had a functional effect on IL-17 production during antigen presentation in the lymph nodes after immunization, we harvested draining lymph nodes (iliac and inguinal) from immunized mice 2 weeks after the initial immunization (day -7) and stimulated isolated T cells in vitro with anti-CD3/CD28 antibodies. CD4+ T cells were selected and analyzed for intracellular expression of IFN-γ and IL-17, and no statistical differences were seen between CX3CR1-/- mice and controls (Figure 5B). This may be due in part to the small fraction of CD4+ CX3CR1+ T cells detected over background immunostaining for CX3CR1 as compared to the total population of CD4+ T cells (Figure 5A).
Figure 5
Figure 5
Wildtype CIA immunized mice have a subset of CD4+ T cells that express CX3CR1, but both CX3CR1-/- and wildtype stimulated CD4+ T cells are capable of producing Th1 and Th17 cytokines similarly
CX3CL1/CX3CR1 signaling has been established as an important pro-inflammatory chemokine receptor signaling interaction in chronic inflammatory diseases (reviewed in (5)) including RA (1, 6, 8, 34, 35) and atherosclerosis (10-12). Correlation studies have shown increased expression of CX3CL1 and/or CX3CR1 in RA (34, 35) and that they are more elevated in patients with severe disease (35). In a mouse CIA model, treatment of arthritic mice with a neutralizing antibody to the unique ligand for CX3CR1, CX3CL1, showed protection from disease that was mediated by inhibition of macrophage/monocytes trafficking to the joint (8). However, beyond impairment in macrophage/monocyte trafficking, changes in B and T cell function were not observed in these studies (8).
CX3CL1 is highly expressed on endothelial cells, intestinal epithelial cells, synoviocyte-like fibroblasts, and on some dendritic cells (6, 36-38). In contrast, its receptor CX3CR1 is expressed mostly on immune cells such as monocytes, macrophages, dendritic cells, NK cells, a subset of T cells, and recent reports that suggest a subset of B cells (11, 14, 15, 26). CX3CL1/CX3CR1 signaling activates the proinflammatory NF-kB pathway (39), and CX3CR1 deficiency is associated with decreased IL-6 and TNF-α production by macrophages and dendritic cells (40). Because of its predominant expression on immune cells and multiple implicated mechanisms of immune regulation, we examined the genetic deletion of CX3CR1 in the CIA model to determine whether or not additional mechanisms beyond that of cellular trafficking may be affected in inflammatory arthritis when the receptor, as opposed to the ligand, was targeted.
Our studies show that CX3CR1 deficiency confers protection in CIA, in part, through decreased humoral and T cell responses. Since professional antigen presenting cells (i.e. monocytes, macrophages, B cells, and dendritic cells) have CX3CR1 on their cell surface (9, 11, 15, 26, 27), it is conceivable that alteration of the CX3CR1+ subset of these antigen-presenting cells could lead to decreased production of autoantibodies, which are known to be pathogenic (20). Recently, Corcione et al. immunized CX3CR1-/- and wildtype mice with ovalbumin (OVA) to determine whether or not CX3CR1 deficiency had effects on antigen-specific antibody formation. Their study had findings similar to ours in that OVA-specific IgG production was decreased (26). Lymphoid follicle architecture, B cell, and T cell enumeration did not differ, thus the authors concluded that differences in autoantibodies could not be directly determined. Interestingly, a study by Bar-On et al (27) has identified a specific subpopulation of CX3CR1+ CD8α+ dendritic cells that share a gene signature overlapping with plasmacytoid dendritic cells. Since plasmacytoid dendritic cells are known for regulating B cell differentiation and antibody production (41), this CX3CR1+ dendritic cell subset may have functions that affect antibody production in inflammation.
The Th17 subset is recently recognized as an important pro-inflammatory mediator in RA (30). Neiss et al. showed that CX3CR1+ peptide-pulsed dendritic cells preferentially supported the differentiation of CD4+ Th17 cells in vitro in an inflammatory bowel disease model (40). Our study did not see a difference in the ability of CX3CR1-/- mice to develop Th17 skewing in vitro, albeit there was a trend toward decreased Th1 IFN-γ production, which would support the conclusions of Neiss et al. We also acknowledge that only a small subset of CD4+ T cells express CX3CR1 (Figure 5A) after immunization for CIA, which may have limited our ability to detect a difference in the cytokine production assays.
An additional or alternative mechanism beyond that of impaired Th17 induction in CX3CR1-/- lymph node cells could be the selective impairment of this particular T-helper subset to migrate to the joint. Although we were able to detect a subpopulation of CD4+ T cells that also expressed CX3CR1 above background levels (Figure 5A), the total numbers of IL-17+ CD4+ CX3CR1+ cells are low enough (5% IL-17+ of the 1% CD4+ CX3CR1+ lymphocytes) that this raises questions as to the accuracy and reproducibility of this measurement. The ideal experiment would be to examine CIA responses and CD4+ IL-17+ cells using the CX3CR1GFP reporter mice (4), which have green fluorescent protein knocked into the CX3CR1 gene locus. In this way, a more sensitive and accurate examination of the CX3CR1 expression pattern and migration of small cellular subsets that normally express this receptor (such as Th17 cells) could be more reliably ascertained and studied. Although direct migration and enumeration of CD4+ IL-17+ CX3CR1+ cells in CIA was limited, we were able to show 3-fold decreased numbers of CD4+ IL-17+ cells in the inflamed paws of CX3CR1-/- mice (Figure 4). Although altered migration is suggested in that there are fewer Th17 cells in the CX3CR1-/- inflamed paw, the evidence is indirect, and we cannot exclude the possibility of other mechanisms such as enhanced apoptosis or impaired proliferation of Th17 cells as well.
Based on our findings of decreased IL-23 in the joint, we additionally postulate that within the joint cytokine milieu, there may be environmental differences that affect local T cell cytokine secretion and function. Specifically, IL-23 is secreted by dendritic cells and induces the production of IL-17 by T cells (42). IL-23 is not needed for the de novo generation of Th17 cells but can augment IL-17 production from already generated Th17 memory cells (43). Consequently, decreased IL-23 within the local microenvironment of the joint may additionally affect the function of Th17 cells in CX3CR1-/- mice.
The CIA model is an approximation of human RA and does have limitations. Particularly, the inflammatory reaction is robust, and even in modest disease, extensive damage to the joint is seen at early and chronic time points. Therefore, a reduction, as opposed to elimination of disease, may not achieve statistical significance in histopathology scores in this model. One of our proposed mechanisms of protection is that loss of CX3CR1 impairs cellular trafficking to the joint, particularly of cells involved in the Th17 axis. However, inflammatory cells are not completely inhibited in trafficking to the joint, as seen on the histopathology sections (Figure 1), which may explain why disease is not significantly different at later time points. Additionally, matrix metalloproteinases (MMPs), which implement much of direct tissue destruction in CIA, are not different between CX3CR1-/- and wildtype mice, which could explain why bony erosions and cartilage loss are not significantly different between groups.
Our group has previously published on the importance of CX3CL1/CX3CR1 signaling in atherosclerosis, which is attributed in part to alterations in inflammatory monocyte and dendritic cell trafficking to affected lesions (9-11). Accelerated atherosclerotic disease from longstanding RA is becoming a widely recognized long-term complication (13). In a recent observational study by Pingiotti et al., peripheral blood isolated CD4+ CX3CR1+ T cells from RA patients were expanded when compared to healthy controls (34). Further, this increase in CD4+ CX3CR1+ T cells from the RA patients correlated with increased carotid intima-media thickness (IMT) and the Disease Activity Scoring system (DAS 28) in Rheumatoid Arthritis (34). These data suggest that CX3CL1/CX3CR1 blockade may have long-term benefits that extend beyond inflammatory arthritis and into prevention of early endothelial dysfunction leading to atherosclerotic disease in these patients.
Acknowledgments
The authors would like to thank James Ellinger for technical assistance in the arthritis disease models and Dr. David Siderovski for critical review of the manuscript. These experiments were generously supported by the Thurston Arthritis Research Center at UNC, the American College of Rheumatology Research Education Foundation Physician Scientist Award, and the National Institutes of Health (grants R01 HL077406 and K08 AI070684).
Footnotes
There is no conflict of interest or financial support from commercial interests that funded this work.
1. Tarrant TK, Patel DD. Chemokines and leukocyte trafficking in rheumatoid arthritis. Pathophysiology. 2006;13(1):1–14. [PubMed]
2. Haringman JJ, Gerlag DM, Smeets TJ, Baeten D, van den Bosch F, Bresnihan B, et al. A randomized controlled trial with an anti-CCL2 (anti-monocyte chemotactic protein 1) monoclonal antibody in patients with rheumatoid arthritis. Arthritis Rheum. 2006;54(8):2387–92. [PubMed]
3. Vergunst CE, Gerlag DM, Lopatinskaya L, Klareskog L, Smith MD, van den Bosch F, et al. Modulation of CCR2 in rheumatoid arthritis: a double-blind, randomized, placebo-controlled clinical trial. Arthritis Rheum. 2008;58(7):1931–9. [PubMed]
4. Jung S, Aliberti J, Graemmel P, Sunshine MJ, Kreutzberg GW, Sher A, et al. Analysis of fractalkine receptor CX(3)CR1 function by targeted deletion and green fluorescent protein reporter gene insertion. Mol Cell Biol. 2000;20(11):4106–14. [PMC free article] [PubMed]
5. D’Haese JG, Demir IE, Friess H, Ceyhan GO. Fractalkine/CX3CR1: why a single chemokine-receptor duo bears a major and unique therapeutic potential. Expert Opin Ther Targets. 14(2):207–19. [PubMed]
6. Ruth JH, Volin MV, Haines GK, 3rd, Woodruff DC, Katschke KJ, Jr, Woods JM, et al. Fractalkine, a novel chemokine in rheumatoid arthritis and in rat adjuvant-induced arthritis. Arthritis Rheum. 2001;44(7):1568–81. [PubMed]
7. Sawai H, Park YW, He X, Goronzy JJ, Weyand CM. Fractalkine mediates T cell-dependent proliferation of synovial fibroblasts in rheumatoid arthritis. Arthritis Rheum. 2007;56(10):3215–25. [PubMed]
8. Nanki T, Urasaki Y, Imai T, Nishimura M, Muramoto K, Kubota T, et al. Inhibition of fractalkine ameliorates murine collagen-induced arthritis. J Immunol. 2004;173(11):7010–6. [PubMed]
9. Liu P, Patil S, Rojas M, Fong AM, Smyth SS, Patel DD. CX3CR1 deficiency confers protection from intimal hyperplasia after arterial injury. Arterioscler Thromb Vasc Biol. 2006;26(9):2056–62. [PubMed]
10. McDermott DH, Fong AM, Yang Q, Sechler JM, Cupples LA, Merrell MN, et al. Chemokine receptor mutant CX3CR1-M280 has impaired adhesive function and correlates with protection from cardiovascular disease in humans. J Clin Invest. 2003;111(8):1241–50. [PMC free article] [PubMed]
11. Liu P, Yu YR, Spencer JA, Johnson AE, Vallanat CT, Fong AM, et al. CX3CR1 deficiency impairs dendritic cell accumulation in arterial intima and reduces atherosclerotic burden. Arterioscler Thromb Vasc Biol. 2008;28(2):243–50. [PubMed]
12. Kimouli M, Miyakis S, Georgakopoulos P, Neofytou E, Achimastos AD, Spandidos DA. Polymorphisms of fractalkine receptor CX3CR1 gene in patients with symptomatic and asymptomatic carotid artery stenosis. J Atheroscler Thromb. 2009;16(5):604–10. [PubMed]
13. Full LE, Ruisanchez C, Monaco C. The inextricable link between atherosclerosis and prototypical inflammatory diseases rheumatoid arthritis and systemic lupus erythematosus. Arthritis Res Ther. 2009;11(2):217. [PMC free article] [PubMed]
14. Combadiere C, Salzwedel K, Smith ED, Tiffany HL, Berger EA, Murphy PM. Identification of CX3CR1. A chemotactic receptor for the human CX3C chemokine fractalkine and a fusion coreceptor for HIV-1. J Biol Chem. 1998;273(37):23799–804. [PubMed]
15. Imai T, Hieshima K, Haskell C, Baba M, Nagira M, Nishimura M, et al. Identification and molecular characterization of fractalkine receptor CX3CR1, which mediates both leukocyte migration and adhesion. Cell. 1997;91(4):521–30. [PubMed]
16. Wooley PH, Luthra HS, Stuart JM, David CS. Type II collagen-induced arthritis in mice. I. Major histocompatibility complex (I region) linkage and antibody correlates. J Exp Med. 1981;154(3):688–700. [PMC free article] [PubMed]
17. Rampersad RR, Esserman D, McGinnis MW, Lee DM, Patel DD, Tarrant TK. S100A9 is not essential for disease expression in an acute (K/BxN) or chronic (CIA) model of inflammatory arthritis. Scand J Rheumatol. 2009;38(6):445–9. [PMC free article] [PubMed]
18. Rampersad RR, Tarrant TK, Vallanat CT, Quintero-Matthews T, Weeks MF, Esserman DA, et al. Enhanced Th17-Cell Responses Render CCR2-Deficient Mice More Susceptible for Autoimmune Arthritis. PLoS One. 6(10):e25833. [PMC free article] [PubMed]
19. Holmdahl R, Klareskog L, Andersson M, Hansen C. High antibody response to autologous type II collagen is restricted to H-2q. Immunogenetics. 1986;24(2):84–9. [PubMed]
20. Wooley PH, Luthra HS, Krco CJ, Stuart JM, David CS. Type II collagen-induced arthritis in mice. II. Passive transfer and suppression by intravenous injection of anti-type II collagen antibody or free native type II collagen. Arthritis Rheum. 1984;27(9):1010–7. [PubMed]
21. Quinones MP, Ahuja SK, Jimenez F, Schaefer J, Garavito E, Rao A, et al. Experimental arthritis in CC chemokine receptor 2-null mice closely mimics severe human rheumatoid arthritis. J Clin Invest. 2004;113(6):856–66. [PMC free article] [PubMed]
22. Bouaziz JD, Yanaba K, Venturi GM, Wang Y, Tisch RM, Poe JC, et al. Therapeutic B cell depletion impairs adaptive and autoreactive CD4+ T cell activation in mice. Proc Natl Acad Sci U S A. 2007;104(52):20878–83. [PubMed]
23. Kolls JK, Linden A. Interleukin-17 family members and inflammation. Immunity. 2004;21(4):467–76. [PubMed]
24. Diggle PJHP, Liang KY, Zerger SL. Analysis of Longitudinal Data. Second Edition. Oxford: Oxford University Press; 2002.
25. Ruth JH, Rottman JB, Katschke KJ, Jr, Qin S, Wu L, LaRosa G, et al. Selective lymphocyte chemokine receptor expression in the rheumatoid joint. Arthritis Rheum. 2001;44(12):2750–60. [PubMed]
26. Corcione A, Ferretti E, Bertolotto M, Fais F, Raffaghello L, Gregorio A, et al. CX3CR1 is expressed by human B lymphocytes and mediates [corrected] CX3CL1 driven chemotaxis of tonsil centrocytes. PLoS One. 2009;4(12):e8485. [PMC free article] [PubMed]
27. Bar-On L, Birnberg T, Lewis KL, Edelson BT, Bruder D, Hildner K, et al. CX3CR1+ CD8alpha+ dendritic cells are a steady-state population related to plasmacytoid dendritic cells. Proc Natl Acad Sci U S A. 107(33):14745–50. [PubMed]
28. van de Loo FA, Joosten LA, van Lent PL, Arntz OJ, van den Berg WB. Role of interleukin-1, tumor necrosis factor alpha, and interleukin-6 in cartilage proteoglycan metabolism and destruction. Effect of in situ blocking in murine antigen- and zymosan-induced arthritis. Arthritis Rheum. 1995;38(2):164–72. [PubMed]
29. Mima T, Nishimoto N. Clinical value of blocking IL-6 receptor. Curr Opin Rheumatol. 2009;21(3):224–30. [PubMed]
30. Koenders MI, van den Berg WB. Translational mini-review series on Th17 cells: are T helper 17 cells really pathogenic in autoimmunity? Clin Exp Immunol. 159(2):131–6. [PubMed]
31. Mus AM, Cornelissen F, Asmawidjaja PS, van Hamburg JP, Boon L, Hendriks RW, et al. Interleukin-23 promotes Th17 differentiation by inhibiting T-bet and FoxP3 and is required for elevation of interleukin-22, but not interleukin-21, in autoimmune experimental arthritis. Arthritis Rheum. 62(4):1043–50. [PubMed]
32. Rengel Y, Ospelt C, Gay S. Proteinases in the joint: clinical relevance of proteinases in joint destruction. Arthritis Res Ther. 2007;9(5):221. [PMC free article] [PubMed]
33. Jacobs JP, Ortiz-Lopez A, Campbell JJ, Gerard CJ, Mathis D, Benoist C. Deficiency of CXCR2, but not other chemokine receptors, attenuates autoantibody-mediated arthritis in a murine model. Arthritis Rheum. 62(7):1921–32. [PMC free article] [PubMed]
34. Pingiotti E, Cipriani P, Marrelli A, Liakouli V, Fratini S, Penco M, et al. Surface expression of fractalkine receptor (CX3CR1) on CD4+/CD28 T cells in RA patients and correlation with atherosclerotic damage. Ann N Y Acad Sci. 2007;1107:32–41. [PubMed]
35. Matsunawa M, Isozaki T, Odai T, Yajima N, Takeuchi HT, Negishi M, et al. Increased serum levels of soluble fractalkine (CX3CL1) correlate with disease activity in rheumatoid vasculitis. Arthritis Rheum. 2006;54(11):3408–16. [PubMed]
36. Bazan JF, Bacon KB, Hardiman G, Wang W, Soo K, Rossi D, et al. A new class of membrane-bound chemokine with a CX3C motif. Nature. 1997;385(6617):640–4. [PubMed]
37. Papadopoulos EJ, Sassetti C, Saeki H, Yamada N, Kawamura T, Fitzhugh DJ, et al. Fractalkine, a CX3C chemokine, is expressed by dendritic cells and is up-regulated upon dendritic cell maturation. Eur J Immunol. 1999;29(8):2551–9. [PubMed]
38. Muehlhoefer A, Saubermann LJ, Gu X, Luedtke-Heckenkamp K, Xavier R, Blumberg RS, et al. Fractalkine is an epithelial and endothelial cell-derived chemoattractant for intraepithelial lymphocytes in the small intestinal mucosa. J Immunol. 2000;164(6):3368–76. [PubMed]
39. Brand S, Sakaguchi T, Gu X, Colgan SP, Reinecker HC. Fractalkine-mediated signals regulate cell-survival and immune-modulatory responses in intestinal epithelial cells. Gastroenterology. 2002;122(1):166–77. [PubMed]
40. Niess JH, Adler G. Enteric flora expands gut lamina propria CX3CR1+ dendritic cells supporting inflammatory immune responses under normal and inflammatory conditions. J Immunol. 184(4):2026–37. [PubMed]
41. Poeck H, Wagner M, Battiany J, Rothenfusser S, Wellisch D, Hornung V, et al. Plasmacytoid dendritic cells, antigen, and CpG-C license human B cells for plasma cell differentiation and immunoglobulin production in the absence of T-cell help. Blood. 2004;103(8):3058–64. [PubMed]
42. Langrish CL, Chen Y, Blumenschein WM, Mattson J, Basham B, Sedgwick JD, et al. IL-23 drives a pathogenic T cell population that induces autoimmune inflammation. J Exp Med. 2005;201(2):233–40. [PMC free article] [PubMed]
43. Aggarwal S, Ghilardi N, Xie MH, de Sauvage FJ, Gurney AL. Interleukin-23 promotes a distinct CD4 T cell activation state characterized by the production of interleukin-17. J Biol Chem. 2003;278(3):1910–4. [PubMed]