PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Tuberculosis (Edinb). Author manuscript; available in PMC 2011 December 8.
Published in final edited form as:
PMCID: PMC3233906
NIHMSID: NIHMS339577

Mycobacterium tuberculosis ftsH expression in response to stress and viability

SUMMARY

FtsH is an essential membrane bound protease that degrades integral membrane proteins as well as cytoplasmic proteins. We show that Mycobacterium tuberculosis (Mtb) ftsH expression levels are upregulated upon exposure to agents that produce reactive oxygen and nitrogen intermediates (ROI and RNI) and growth in macrophages. In partial support of this result is our observation that the Mtb merodiploid overexpressing ftsH shows increased resistance to ROI. ftsH transcripts levels are downregulated during stationary phase and starvation. Overexpression of ftsH delayed growth and reduced the viability of Mtb in vitro and ex vivo. Finally, we show that the intracellular levels of FtsZ, an essential cell division protein, are reduced in ftsH overexpressing strain. Together, our results suggest that Mtb FtsH is a stress response protein that promotes the pathogen’s ability to deal with ROI stress and is possibly involved in the regulation of FtsZ levels.

1. Introduction

FtsH is a member of AAA-family ATPases and plays an important role in the protein quality control mechanisms. FtsH mediated degradation of misassembled membrane and cytoplasmic proteins is thought to be responsible for its role in the control of cellular functions including the heat shock response (reviewed in 1, 2). FtsH is also required for the proper functioning of σ54 under nitrogen limitation conditions 3. FtsH expression is upregulated in response to heat shock in several bacteria, e.g., Escherichia coli, Bacillus subtilis, Lactococcus lactis, Caulobacter cresentus and Helicobacter pylori 47. The FtsH protease is essential for growth in E. coli 8, 9 whereas it is dispensable in B. subtilis and C. cresentus 4, 10. However, ftsH mutants are hypersensitive to heat, salt, and defective for sporulation and possibly cell division 4,10.

Saturated transposon mutagenesis studies indicated that Mtb ftsH (ftsHTB) is an essential gene 11 that encodes a 85 kD protein, which is 15kD larger than the 70 kD E. coli counterpart. The ftsHTB can complement the E. coli ftsH phenotype and degrade heterologous substrates σ32, SecY and bacteriophage λCII protein when expressed in E. coli ftsH null mutant 12. The expression of M. smegmatis ftsH in E. coli results in growth arrest and filamentation 13. In vitro, the FtsHEC efficiently degrades FtsZ of E. coli (FtsZEC) and Mtb (FtsZTB) 14. FtsZTB, like its E. coli counterpart, is an essential cell division protein and initiates the process by localizing at the midcell sites in the form of Z-rings 15, 16. Experiments designed to test whether FtsHEC affects the stability and turnover of FtsZEC in vivo, however, failed to support the in vitro data 17. Related experiments with Mtb have not been carried out. Consequently, it is unknown if ftsHTB activity contributes to the reduction in the intracellular levels of FtsZTB in vivo. Furthermore, it is unknown if ftsHTB expression in vivo is responsive to stress. The current study addresses these issues.

2. Materials and Methods

2.1. Bacterial growth and culture conditions

Escherichia coli Top10 was used to propagate recombinant plasmids as described 15, 18. Mtb H37Rv was grown in Middlebrook 7H9 broth supplemented with oleic acid, albumin, dextrose, and sodium chloride (OADC). Transformants were selected in the same medium supplemented with agar containing Hyg (50 μg ml−1) 16. Growth conditions such as hypoxia, starvation and exposure to agents that produce ROI and NO, are essentially as described earlier 18. Mtb cultures were exposed to 500 μM DETA/NO for 16 h, 70 μM menadione or 5 mM H2O2 for 48 h. Growth was monitored by measuring the absorbance at 600 nm and viability by determining the CFU.

2.2. Construction of ftsH overexpression plasmid pACR6 and ftsH anti-sense plasmid pACR33

The 2.3 kb ftsH coding region was amplified using oligonucleotide primer pairs FtsH8 (5′ – GGAATTCCATATGAACCGGAAAAACGTGACTCG – 3′) and FtsH9 (5′ – CTAGTCTAGACTAT-CAGCCGTGGGCCGGCTTGGTC – 3′) or Fts H-A-XbaI (5′-CTAGTCTAGACTAATGAACCGGAA-AAACGTGACT -3′) and Fts H-A-NdeI (5′-GGAATTCCATATGTCAGCCGTGGGCCGGTTGG -3′). The PCR products were cloned downstream of the amidase promoter in an integrating vector, pJFR19 15 to create the sense plasmid, pACR6, and the antisense plasmid pACR33, respectively. Following confirmation of sequences, Mtb was electrotransformed with these plasmids to create ftsH overexpression strain Mtb-6 and antisense expression strain Mtb-33.

2.3 Macrophage infection and viability determination

Monocyte derived macrophage cell line THP-1 cells were infected with various Mtb strains and bacterial viability was determined as described previously 15, 19. For some experiments, RNA was isolated from macrophage-grown Mtb 19.

2.4. RNA extraction and QRT-PCR

Extraction of total RNA in RNAzol from Mtb cultures exposed to different conditions and synthesis of complementary strand DNA from mRNA specific to 16S rRNA and ftsH using reverse transcription primers and Superscript II reverse transcriptase (Invitrogen) were as described 19. Quantitative real time PCR (Taqman chemistry) was carried out in a BioRad ICycler using Taq DNA polymerase (NEB). The calculated threshold cycle (Ct) value for ftsH was normalized to the Ct value for 16S rRNA and the fold expression was calculated using the formula: Fold change = 2Δ(ΔCt) 20. No RT RNA samples were included as negative controls. Expression data are average from 3 independent RNA preparations, each reverse transcribed and quantitated by real time PCR in triplicate. Real-time PCR conditions: initial activation at 95°C for 3minutes; followed by 45 cycles of denaturation at 95°C for 20 seconds, annealing at 60°C for 30 seconds and extension at 72°C for 30 seconds.

2.5. Immunodetection

Mtb cellular lysates were prepared by bead-beating actively growing cultures. Approximately 2 μg protein lysate per lane was loaded, resolved by SDS-PAGE and immunoblotting was carried out to detect FtsZTB, FtsHTB and SigATB using the previously described protocols 16, 21. Anti-FtsHEC antibodies were a kind gift from Dr. Teru Ogura, Kumamoto University, Japan and were used at 1:2000 dilution, whereas anti-FtsZTB and anti-SigAEcoli were used at 1: 1000 dilution 15.

3. Results and Discussion

3.1. Mtb ftsH expression is modulated in response to stress

Considering the roles of FtsH on the protein quality control mechanisms in other bacteria, we first evaluated by quantitative RT-PCR whether the Mtb ftsH transcript levels relative to 16S rRNA are modulated under the conditions that are relevant for Mtb survival in vivo, i.e. growth in macrophages, exposure to reactive oxygen and nitrogen intermediates, hypoxia and nutrient starvation 22, 23. The ftsH transcript levels were found to be sharply elevated during intramacrophage growth and when exposed to DETA-NO, a nitric oxide (NO) producer, but were downregulated during starvation and stationary phase and remained relatively unchanged during hypoxia (Fig. 1). A small, but consistent, upregulation of ftsH transcript levels was also observed in cultures exposed to menadione and hydrogen peroxide, both of which produce reactive oxygen intermediates (ROI) (Fig. 1). Presumably, altered expression levels of ftsH are necessary for the optimal survival of Mtb under the above growth conditions.

Figure 1
ftsH expression levels under different growth conditions. ftsH expression levels in Mtb grown under various indicated conditions were quantitated by QRT-PCR. cDNA was synthesized for ftsH along with 16S rRNA and QRT-PCR was carried out as described under ...

3.2. Altered FtsH levels and resistance to Reactive Oxygen Intermediates

The above results are consistent with a notion that elevated levels of FtsH are required for the optimal survival of Mtb under the conditions that produce NO and ROI. To further evaluate the correlation between altered ftsH expression and ROI and NO stress, we created and characterized merodiploid strains overexpressing ftsH mRNA (Mtb-6) and antisense RNA (Mtb-33) (see below). As can be seen, growth in the presence of acetamide for 72 hrs led to an ~3-fold increase in the FtsH protein levels in Mtb-6 and an ~ 60% decrease in Mtb-33, relative to that of H37Rv (Fig. 2A and inset). Elevated levels of FtsH slowed the growth in broth (Fig. 2B) and reduced viability by 50% (Fig. 2B insert). However, the reduction in FtsH levels did not affect the growth and viability of Mtb (Fig. 2B).

Figure 2Figure 2
FtsH protein levels and growth of ftsH strains. A. FtsH protein levels in Mtb strains were quantitated by immunoblotting. Protein lysates from ftsH strains were resolved on SDS-PA gels, transferred to nitrocellulose membrane and probed with α-FtsH ...

Next, we examined the growth and viability of Mtb ftsH merodiploid strains exposed to select stress conditions, i.e. hydrogen peroxide and menadione. A significant reduction in the viability of Mtb wild type and Mtb-33 was noted at the concentrations of the agents used (Fig. 3) indicating that the activity of FtsH protein is required for survival upon exposure to agents that produce ROI. Mtb-6 strain, producing elevated levels of FtsH (Fig. 2A), showed enhanced viability under the same growth conditions indicating that increased intracellular levels of FtsH promote the ability of Mtb to resist ROI (Fig. 3). Exposure to RNI intermediates and starvation had only a marginal effect on the viability of all three strains (data not shown). These results reveal that Mtb producing elevated levels of FtsH would weather the ROI stress better than that producing the normal or reduced levels of FtsH.

Figure 3
FtsH protein levels and resistance to ROI. Exponential cultures of Mtb-6, Mtb-33 and wild type strains were grown in the presence of menadione (70μM) or H2O2 (5mM) for 48 hrs and plated on 7H10-OADC plates. CFU were counted and percent survival ...

3.3. Optimal FtsH levels are needed for intramacrophage growth of Mtb

We next examined the consequences of altered ftsH expression on Mtb growth and viability upon infection. As can be seen, Mtb-6 strain expressing elevated levels of ftsH showed reduced viability in THP-1, a human macrophage cell line, as compared to the wild type parent (Fig. 4). The Mtb-33 showed delayed growth during the earlier time points of infection, but reached to the same final levels as the WT indicating a defect in replication. Macrophage growth environment is rather hostile and Mtb likely encounters stresses other than the ones tested in the present study, i.e. acidic pH, limiting nutrients, host secreted cytokines and antimicrobial peptides 24. Presumably, elevated expression of ftsH resulting in excessive levels of FtsH could trigger unregulated proteolytic activity upon infection. Similarly, decreased expression of ftsH resulting in the reduced in vivo pools of FtsH could lead to the accumulation of undesirable proteins. Both scenarios could compromise the ability of Mtb to replicate in macrophages optimally. These results are consistent with a notion that optimal FtsH levels are essential for survival of Mtb in vivo (Fig. 4).

Figure 4
Growth of ftsH strains in THP-I macrophages. Monolayers of human macrophage cell line, THP-1, were infected with wild type (H37Rv, squares) or merodiploids overexpressing ftsH (Mtb-6, diamonds) or ftsH antisense (Mtb-33, triangles) at a moi of 1:1. At ...

3.4. Intracellular FtsZ protein levels are altered in ftsH merodiploids

Optimal intracellular levels of the essential cell division protein FtsZ are critical for cell division and viability 16. FtsZ levels are growth-phase dependent 16, 25. To evaluate the correlation, if any, between the decreased growth of ftsH merodiploids and FtsZ levels, we determined the intracellular FtsZ levels in Mtb-6 and Mtb-33 strains by immunoblotting. Since SigA levels are known to remain unchanged under several conditions that have been tested 15, 26, we normalized the data to SigA (Fig. 5). These analyses revealed that FtsZ levels were reduced by approximately 34% in Mtb-6, but remained unaffected in Mtb-33 (Fig. 5). These results, however, do not provide direct evidence that FtsHTB protease degrades FtsZTB protein. Our earlier data showed that the FtsZ levels are similar in broth and macrophage grown bacteria 15, although the ftsH expression is shown to be upregulated during intramacrophage growth (Fig. 1). Thus, it is possible that FtsH could directly regulate the FtsZ levels by its proteolytic activity or indirectly influence its levels by degrading hitherto unidentified proteins that stabilize FtsZTB, thereby facilitating the action of other proteases on FtsZ. Nonetheless, reduction in the FtsZ levels under FtsH overproduction conditions leads to a speculation that proliferation of Mtb depends, in part, on the optimal ratio of FtsH to FtsZ proteins. Tipping that balance by elevating the FtsH levels could influence the intracellular FtsZ pools and compromise growth and viability.

Figure 5
FtsZ levels in ftsH strains. Exponential cultures of ftsH strains were grown in the presence of 0.2% acetamide for 3 days and examined for FtsZ levels by immunoblotting as described above in Fig. 2. Symbols: WT – wild type Mtb, Mtb-6 – ...

4. Conclusions

  1. Upregulation of ftsH transcription in response to ROI induced stress and increased survival of Mtb merodiploids producing elevated levels of FtsH suggests a potential role for FtsH protease in dealing with ROI stress.
  2. Reduced intracellular levels of FtsZ in Mtb merodiploids producing elevated levels of FtsH suggest that an optimal ratio of FtsH to FtsZ is one of the contributing factors necessary for Mtb proliferation.

Acknowledgments

This work was supported by NIH grants, AI48417, AI41406 and AI073966. We thank Dr. Teru Ogura, Kumamoto University, Japan for antibodies to FtsHEC.

References

1. Gottesman S. Proteolysis in bacterial regulatory circuits. Annu Rev Cell Dev Biol. 2003;19:565–87. [PubMed]
2. Ito K, Akiyama Y. Cellular functions, mechanism of action, and regulation of FtsH protease. Annu Rev Microbiol. 2005;59:211–31. [PubMed]
3. Carmona M, de Lorenzo V. Involvement of the FtsH (HflB) protease in the activity of sigma 54 promoters. Mol Microbiol. 1999;31:261–70. [PubMed]
4. Deuerling E, Mogk A, Richter C, Purucker M, Schumann W. The ftsH gene of Bacillus subtilis is involved in major cellular processes such as sporulation, stress adaptation and secretion. Mol Microbiol. 1997;23:921–33. [PubMed]
5. Duwat P, de Oliveira R, Ehrlich SD, Boiteux S. Repair of oxidative DNA damage in gram-positive bacteria: the Lactococcus lactis Fpg protein. Microbiology. 1995;141 ( Pt 2):411–7. [PubMed]
6. Herman C, Thevenet D, D’Ari R, Bouloc P. Degradation of sigma 32, the heat shock regulator in Escherichia coli, is governed by HflB. Proc Natl Acad Sci U S A. 1995;92:3516–20. [PubMed]
7. Melchers K, Wiegert T, Buhmann A, Postius S, Schafer KP, Schumann W. The Helicobacter felis ftsH gene encoding an ATP-dependent metalloprotease can replace the Escherichia coli homologue for growth and phage lambda lysogenization. Arch Microbiol. 1998;169:393–6. [PubMed]
8. Akiyama Y, Ogura T, Ito K. Involvement of FtsH in protein assembly into and through the membrane. I. Mutations that reduce retention efficiency of a cytoplasmic reporter. J Biol Chem. 1994;269:5218–24. [PubMed]
9. Tomoyasu T, Yuki T, Morimura S, Mori H, Yamanaka K, Niki H, Hiraga S, Ogura T. The Escherichia coli FtsH protein is a prokaryotic member of a protein family of putative ATPases involved in membrane functions, cell cycle control, and gene expression. J Bacteriol. 1993;175:1344–51. [PMC free article] [PubMed]
10. Fischer B, Rummel G, Aldridge P, Jenal U. The FtsH protease is involved in development, stress response and heat shock control in Caulobacter crescentus. Mol Microbiol. 2002;44:461–78. [PubMed]
11. Sassetti CM, Boyd DH, Rubin EJ. Genes required for mycobacterial growth defined by high density mutagenesis. Mol Microbiol. 2003;48:77–84. [PubMed]
12. Srinivasan R, Anilkumar G, Rajeswari H, Ajitkumar P. Functional characterization of AAA family FtsH protease of Mycobacterium tuberculosis. FEMS Microbiol Lett. 2006;259:97–105. [PubMed]
13. Anilkumar G, Srinivasan R, Ajitkumar P. Genomic organization and in vivo characterization of proteolytic activity of FtsH of Mycobacterium smegmatis SN2. Microbiology. 2004;150:2629–39. [PubMed]
14. Anilkumar G, Srinivasan R, Anand SP, Ajitkumar P. Bacterial cell division protein FtsZ is a specific substrate for the AAA family protease FtsH. Microbiology. 2001;147:516–7. [PubMed]
15. Chauhan A, Madiraju MV, Fol M, Lofton H, Maloney E, Reynolds R, Rajagopalan M. Mycobacterium tuberculosis cells growing in macrophages are filamentous and deficient in FtsZ rings. J Bacteriol. 2006;188:1856–65. [PMC free article] [PubMed]
16. Dziadek J, Rutherford SA, Madiraju MV, Atkinson MA, Rajagopalan M. Conditional expression of Mycobacterium smegmatis ftsZ, an essential cell division gene. Microbiology. 2003;149:1593–603. [PubMed]
17. Srinivasan R, Ajitkumar P. Bacterial cell division protein FtsZ is stable against degradation by AAA family protease FtsH in Escherichia coli cells. J Basic Microbiol. 2007;47:251–9. [PubMed]
18. Chauhan A, Lofton H, Maloney E, Moore J, Fol M, Madiraju MV, Rajagopalan M. Interference of Mycobacterium tuberculosis cell division by Rv2719c, a cell wall hydrolase. Mol Microbiol. 2006;62:132–47. [PubMed]
19. Fol M, Chauhan A, Nair NK, Maloney E, Moomey M, Jagannath C, Madiraju MV, Rajagopalan M. Modulation of Mycobacterium tuberculosis proliferation by MtrA, an essential two-component response regulator. Mol Microbiol. 2006;60:643–57. [PubMed]
20. Danelishvili L, Poort MJ, Bermudez LE. Identification of Mycobacterium avium genes up-regulated in cultured macrophages and in mice. FEMS Microbiol Lett. 2004;239:41–9. [PubMed]
21. Nair N, Dziedzic R, Greendyke R, Muniruzzaman S, Rajagopalan M, Madiraju MV. Synchronous replication initiation in novel Mycobacterium tuberculosis dnaA cold-sensitive mutants. Mol Microbiol. 2009;71:291–304. [PMC free article] [PubMed]
22. Schnappinger D, Ehrt S, Voskuil MI, Liu Y, Mangan JA, Monahan IM, Dolganov G, Efron B, Butcher PD, Nathan C, Schoolnik GK. Transcriptional Adaptation of Mycobacterium tuberculosis within Macrophages: Insights into the Phagosomal Environment. J Exp Med. 2003;198:693–704. [PMC free article] [PubMed]
23. Shi L, Sohaskey CD, Kana BD, Dawes S, North RJ, Mizrahi V, Gennaro ML. Changes in energy metabolism of Mycobacterium tuberculosis in mouse lung and under in vitro conditions affecting aerobic respiration. Proc Natl Acad Sci U S A. 2005;102:15629–34. [PubMed]
24. Smith I. Mycobacterium tuberculosis pathogenesis and molecular determinants of virulence. Clin Microbiol Rev. 2003;16:463–96. [PMC free article] [PubMed]
25. Dziadek J, Madiraju MV, Rutherford SA, Atkinson MA, Rajagopalan M. Physiological consequences associated with overproduction of Mycobacterium tuberculosis FtsZ in mycobacterial hosts. Microbiology. 2002;148:961–71. [PubMed]
26. Wu S, Howard ST, Lakey DL, Kipnis A, Samten B, Safi H, Gruppo V, Wizel B, Shams H, Basaraba RJ, Orme IM, Barnes PF. The principal sigma factor sigA mediates enhanced growth of Mycobacterium tuberculosis in vivo. Mol Microbiol. 2004;51:1551–62. [PubMed]