RWPE-1 and RWPE-2 cells were cultured for 24 h and then treated with 0, 20, or 50 μM lunasin for 3 and 24 h. Cells were fixed with 4% paraformaldehyde and permeabilized with 0.4% saponin after lunasin treatment. Cells were stained with an affinity-purified lunasin antibody (1:500 dilution) (5) followed by an Alexa 488-conjugated goat anti-rabbit antibody (1:250 dilution, Invitrogen). Nuclei were visualized by DAPI staining (Vector Laboratories, Burlingame, CA). Photomicrographs were obtained using a Nikon Eclipse 800 microscope equipped with a digital camera. All images were acquired using the same integration parameters.

Lunasin (89 pmoles, Soy Labs, Fairfield, CA) was incubated with recombinant H4 (rH4) (89 pmoles, New England BioLabs, Ipswich, MA) in 500 μl of histone binding buffer (1X = 20 mM Tris-HCl pH 7.6, 150 mM KCl, 5 mM MgCl₂, 10 μg/mL BSA, 0.5% NP-40) at 4°C for 1 h. The peptide binding mixture (lunasin/rH4) was immunoprecipitated by adding a deacetylated H4 (Millipore, Temecula, CA) polyclonal antibody at l:300 dilution or a lunasin polyclonal antibody (Soy Labs) at 1:1000 dilution and incubating at 4°C for 1 h with gentle rocking. For non-specific binding controls, lunasin or rH4 was also incubated with an affinity-purified GST protein (89 pmoles) at 4°C for 1 h and immunoprecipitated with a GST antibody (1:500 dilution, Stressgen, Ann Arbor, MI). A negative control with no antibody added to the peptide binding mixture was also performed. After incubation, 40 μl of Protein-A/G PLUS-agarose slurry (Santa Cruz Biotechnology, Santa Cruz, CA) was added to the reaction mixture and allowed to incubate at 4°C overnight with gentle rocking. Immunoprecipitates were collected by centrifugation at 1000 g at 4°C for 5 min and washed 4 times with 1 ml 1xPBS, pH 7.4. After final wash, the pellet was resuspended in 40 μl of 1x Laemmli sample buffer containing 1 mM β-mercaptoethanol (Bio-Rad, Hercules, CA), boiled for 1 min and centrifuged at 1000 g at room temperature for 5 min. Supernatant was collected and loaded onto 4–20% Tris-HCl gels (Bio-Rad). The pulled-down peptide was detected using western blot analysis with either the lunasin (1:15,000) or the H4 (1:10,000) primary antibody followed by an HRP-conjugated secondary antibody (1:15,000, Pierce, Rockford, IL) and visualized using a SuperSignal West Femto kit (Pierce) and a ChemiDoc XRS+ Imaging System (Bio-Rad).

Recombinant H4 and GST proteins (8 μg) were separated in a 4–20% Tris-HCl gel. Proteins were stained by submerging the gel in a staining buffer containing: 0.2% (wt/vol) Brilliant Blue G250, 20% ethanol (vol/vol), and 0.5% (vol/vol) methanol, at room temperature for 1 h. The gel was rinsed with water and destained with 30% methanol at 4°C overnight.

TwoμL lunasin (100 μM) in double distilled sterilized water was mixed with either 10 μg acid-extracted histones from HeLa cells or 1 μg rH4 in a total 25μl volume. Samples were incubated at room temperature for 5 min, on ice for 5 min, and again at room temperature for 5 min. HAT reactions were initiated by adding 10 μl 5x HAT buffer (Millipore), 2 μg acetyl CoA, HAT enzymes (0.5 μg PCAF, 2 μg p300, or 2 μg HAT1A) into the mixtures (50 μl final reaction volume). HAT reaction mixtures were incubated at 30°C with gentle shaking for 10 min (p300 and HAT1A reactions) or 1 h (PCAF reactions). Reactions were stopped by adding 50 μl Laemmli sample buffer (Bio-Rad), boiling for 5 min, and quenching on ice. Twenty-five μl reaction mixture was loaded in each lane of 10–20% Tricine-HCl gels (Bio-Rad), and electroblotted onto nitrocellulose membranes (Bio-Rad). Blots were immunostained with a primary antibody specific to H4 acetylated at K4 (H4K4), K8 (H4K8), K12 (H4K12), or K16 (H4K16) (Millipore) using manufacturer recommended dilutions. An HRP-conjugated goat anti-rabbit secondary antibody (Amersham Biosciences, Piscataway, NJ) was used at 1:10,000 dilution. Chemiluminescence from an ECL Western detection kit (Amersham) was quantified using an Alpha Innotech digital imaging system (Alpha Innotech San Leandro, CA).

RWPE-1 and RWPE-2 cells were grown to 70% confluency in 150 mm plates. Lunasin was added into the medium to a final concentration of 2 μM. For the controls, 1x PBS, pH 7.4, was added to the plates. Cells were incubated for 24 h and lysed with Trizol reagent (Invitrogen) for total RNA purification. cDNA was synthesized from 10 μg of total RNA using a SuperScript Choice system (Invitrogen), then transcribed into cRNA in the presence of biotin-labeled nucleotide triphosphate using T7 RNA polymerase (New England BioLabs). cRNA was purified using an RNeasy mini kit (Qiagen, Valencia, CA) and fragmented at 94°C for 30 min in a buffer containing 0.2 M Tris-acetate, pH 8.1, 0.5 M potassium acetate, and 0.15 M magnesium acetate. Fragmented cRNA was hybridized to HGU133A GeneChip microarrays (Affymetrix, Santa Clara, CA) at 45°C overnight. Hybridization was detected using a confocal laser scanner (Affymetrix). Gene expression levels were normalized and analyzed using robust multichip average (RMA) (13).

cDNA was synthesized from 3 μg of total RNA using a SuperScript First-Strand Synthesis (Invitrogen). Two μl of cDNA, diluted 4 fold, was added to the PCR reactions containing TaqMan probes (Applied Biosystems, Foster City, CA). Quantitative RT-PCR (qRT-PCR) was performed in triplicate using an ABI 7900HT (Applied Biosystems) and ACTB expression was used for normalization. Changes in transcript levels were calculated using relative quantification of gene expression following Applied Biosystems’ protocol.

RWPE-1 and RWPE-2 were grown to 70% confluency in 100 mm plates. Four hours after seeding, lunasin was added into the medium to a final concentration of 2 μM. For the controls, 1x PBS, pH 7.4 was added to the plates. After 24 h lunasin treatment, cells were lysed with M-PER protein extraction reagent containing 1x Halt Protease Inhibitor cocktail (Pierce). Protein concentrations were determined using Dc protein assay reagents (Bio-Rad). From 25 to 37 μg protein lysate was loaded in each lane of 10–20% Tris-HCl gels with Kaleidoscope markers (Bio-Rad) and electroblotted onto nitrocellulose membranes (Bio-Rad). Blots were immunostained with primary antibodies against THBS1 (1:350) (Abcam, Cambridge, MA), HIF1A (1:500) (Abcam), TOB1 (1:200) (Santa Cruz Biotechnology), PRKAR1A (1:200) (Santa Cruz Biotechnology) and acetylated H4K8 and H4K16 (1:1000) (Millipore) at room temperature for 1 h (THBS1 and HIF1A) or at 4°C overnight (TOB1, PRKAR1A, acetylated H4K8 and H4K16). Blots were also immunostained with a β-ACTIN antibody (1:1000) (Imgenex, San Diego, CA) at room temperature for 1 h for normalization. A HRP-conjugated goat anti-rabbit (Pierce) or a donkey anti-goat secondary antibody (Santa Cruz Biotechnology) at 1:10,000 dilution was incubated with blots at room temperature for 1 h. Chemiluminescence from an ECL western detection kit (Amersham) or a SuperSignal West Femto kit (Pierce) was quantified by using an Alpha Innotech digital imaging system (Alpha Innotech San Leandro, CA).

RWPE-1 and RWPE-2 cells (2x10⁷ cells per assay), treated or mock-treated with 2 μM lunasin for 24 h, were incubated with 1% formaldehyde at room temperature for 8 min to crosslink chromatin and quenched with 1 ml 10x glycine (EZ ChIP, Millipore). After washing with ice cold 1x PBS, pH 7.4, cells were collected by centrifugation at 700 g for 4 min and lysed in 1 ml SDS lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris, pH 8.1) containing freshly added protease inhibitor cocktail at 1:5 dilution (Millipore). Lysates were sonicated to generate 300–600 bp DNA fragments and divided into two fractions. The first fraction was incubated with an acetylated H4K16 antibody (1μg/reaction; Millipore) at 4°C overnight and the second fraction was incubated with 1x TE buffer as the negative control. Protein A-Sepharose beads were added, incubated at 4°C for 1 h, centrifuged at 3000 g for 1 min before washing for 5 min with ice cold buffers (EZ ChIP, Millipore): 1) low salt wash buffer once, 2) high-salt wash buffer once, 3) LiCl wash buffer once, and 4) TE buffer twice. After washing, beads were treated with RNase and then proteinase K at 55°C overnight. DNA was released from crosslinking by heating the samples at 65°C for 6 h, extracted by phenol/chloroform, precipitated by ethanol, and resuspended in water. DNA from fraction 1 and 2 (10–15 ng) were amplified with a THBS1 CpG island primer set (5′CTTTTCGGATGCTTGCTG3′ and 5′CAGTCTGGGCTCCTCTCTCC3′) and exon 11 primer set (5′CTGAGGCTTCAGTCCCTCTG3′ and 5′AGAGTAAGGAAATCTTGGGGTGTC3′) designed with the Primer 3 software (14).

Genomic DNA was isolated from RWPE-1 and RWPE-2 cells with a PureLink Genomic DNA Isolation kit (Invitrogen) and subjected to bisulfite conversion (EZ DNA-Methylation-Direct, Zymo Research, Orange, CA). Bisulfite converted unmethylated cytosines to thymines while methylated cytosines remained intact. Bisulfite-converted genomic DNA was subjected to bisulfite-specific PCR (BSP) using primers specific to the 5′ end of THBS1. The BSP primers, designed using Methyl-Primer Express v1.0 (Life technologies, Carlsbad, CA), were: methylated primer pair (M), 5′TTATTTTTCGTTTTTTCTTCGGTCGTCG3′ and 5′GCGCGCTTTTAAAAAAACGCTCG3′; unmethylated primer pair (UM), 5′TGTTTTTTGTTTGGTTGTTGTTT3′ and 5′CTCACAAACCAACTCAAACACAA3′. PCR was carried out in a 25 μl reaction volume using a Taq PCR Kit (New England BioLabs). PCR products were run on 1.5% ethidium bromide-stained agarose gels, excised, purified using a Gel Extraction Kit (Qiagen), ligated to pCR4-TOPO vector (Invitrogen), and transformed into DH5α E. coli (Zymo Research). Insert-containing plasmids were identified by PCR and EcoRI (New England BioLabs) digestion before sequencing (Davis Sequencing, Davis, CA).

To rule out the possibility that the differential effects of lunasin treatment on gene expression in RWPE-1 and RWPE-2 cells were simply due to differences in lunasin uptake, lunasin immunofluorescence experiments were conducted. At a concentration of 20 μM, lunasin was localized in the perinuclear region of both RWPE-1 and RWPE-2 cells (as identified by nuclear DAPI staining) after 3 h and 24 h lunasin treatments compared to the mock-treated controls (Fig. 2a). However, when RWPE-2 cells were treated with 50 μM lunasin for 24 h, lunasin immunofluorescent signals could be visualized in both the cytoplasm and the nucleus (Fig. 2b). In the nucleus, lunasin was seen at the edge of the nucleus indicating that lunasin was colocalized to the transcriptionally active territories in chromatin (20). Previous lunasin immunofluorescence studies using NIH3T3 cells showed that lunasin colocalized with chromatin in the nucleus after one cycle of cell division, but was only observed in actively dividing metaphase cells when chromatin was highly condensed (15). Taken together, these results suggest that RWPE-2 cells can take up lunasin from the extracellular space and that the differential effects of lunasin on gene expression (Fig. 1a,b) is not due to the inability of RWPE-2 cells to take up lunasin.

In addition to its chemopreventive properties, lunasin is known to bind to hypoacetylated chromatin (4, 5). To investigate the ability of lunasin to bind specifically to deacetylated H4, immunoprecipitation (IP) experiments were performed (Fig. 3). The results demonstrated that lunasin interacted with rH4 (Fig. 3a). The interactions between lunasin and rH4 were specific as both lunasin and rH4 could not be immunoprecipitated by a GST antibody when lunasin or rH4 was incubated with an affinity purified GST protein (Fig. 3a). Interestingly, both lunasin and H4 antibodies pulled-down the same two protein complexes migrating at ~23 and ~50 kDa. Compared to the monomer size of lunasin (migrating at ~8 kDa, Fig. 3b) on the western blot and rH4 (migrating at ~15 kDa, Fig. 3b) on the Coomassie Blue stained gel, we believed that the 23 kDa protein complex contained a monomer of both lunasin and rH4 and that the 50 kDa protein complex contained a dimer of lunasin and a dimer of rH4. While this interpretation must be confirmed by more rigorous testing, the results, nonetheless, suggest that lunasin binds tightly to rH4 under these reaction conditions.

As shown in Fig. 6a, lunasin treatment did not significantly change H4K8 acetylation but resulted in an increase in H4K16 acetylation in both RWPE-1 and RWPE-2 cells compared to the mock-treated controls. This increase in H4K16 acetylation was statistically significant in RWPE-1 (p<0.005) and in both cell types combined (p<0.01) (Fig. 6b). If lunasin upregulates genes in RWPE-1 cells by promoting acetylation of H4K16, then chromatin in or around these genes should be enriched for hyperacetylated H4K16. Conversely, corresponding chromatin in tumorigenic RWPE-2 cells should be hypoacetylated at H4K16. To investigate these possibilities, ChIP was performed on chromatin isolated from lunasin-treated and mock-treated RWPE-1 and RWPE-2 cells using an antibody against acetylated H4K16. The resulting ChIP DNA was then used in PCR to detect genomic regions enriched in acetylated H4K16. Primer sets were derived from 5 regions of representative upregulated genes, HIF1A, THBS1, PRKCL2, ANP32A and SP3 (Table 1). Primer combinations were designed to recognize up to 200–300 bp fragments of the upregulated genes in and around the following genomic regions: promoter (including transcription start site), 5′ untranslated region, first exon, carboxyl end, and 3′ untranslated region. Among the genes interrogated, only the primer set derived from the 5′ promoter region of THBS1 produced an amplicon from ChIP DNA that was significantly higher in RWPE-1 than in RWPE-2 cells (Fig. 6c). Fig. 6c also shows that a primer pair flanking a CpG island located at the 5′ end of THBS1 produced more amplicons with ChIP DNA from lunasin-treated than mock-treated RWPE-1 cells. However, the same primer pair generated little or no amplicon with ChIP DNA from lunasin-treated or mock-treated RWPE-2 cells. It should be noted that H4K16 acetylation could also be detected in exon 11 of THBS1 as evidenced by a strong amplicon signal with a primer pair flanking this region (Fig. 6c). However, this primer pair produced strong amplicon signals with ChIP DNA from both lunasin-treated and mock-treated RWPE-2 (Fig. 6c).