PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of aemPermissionsJournals.ASM.orgJournalAEM ArticleJournal InfoAuthorsReviewers
 
Appl Environ Microbiol. 2011 November; 77(21): 7850–7852.
PMCID: PMC3209143

Molecular Detection and Identification of Bartonella Species in Xenopsylla cheopis Fleas (Siphonaptera: Pulicidae) Collected from Rattus norvegicus Rats in Los Angeles, California[down-pointing small open triangle]

Abstract

Of 200 individual Xenopsylla cheopis fleas removed from Rattus norvegicus rats trapped in downtown Los Angeles, CA, 190 (95%) were positive for the presence of Bartonella DNA. Ninety-one amplicons were sequenced: Bartonella rochalimae-like DNA was detected in 66 examined fleas, and Bartonella tribocorum-like DNA was identified in 25 fleas. The data obtained from this study demonstrate an extremely high prevalence of Bartonella DNA in rat-associated fleas.

TEXT

Bartonella spp. are small, pleomorphic, Gram-negative bacteria that can invade and replicate in erythrocytes and endothelial cells. Infection often leads to prolonged intraerythrocytic bacteremia within the reservoir host (4). Of the >20 Bartonella spp. characterized to date, more than half are suspected or known to be pathogenic to humans (3), and most are believed to be transmitted by arthropod vectors (1).

Fleas have been suspected vectors of Bartonella spp. for several decades. Bartonella DNA has been detected in flea species on all continents, excluding Antarctica (1). The Oriental rat flea, Xenopsylla cheopis, is believed to transmit several Bartonella spp., including Bartonella tribocorum, Bartonella elizabethae, Bartonella queenslandensis, and Bartonella rochalimae (8), though experimental transmission studies have not been performed to verify this supposition. X. cheopis fleas are distributed worldwide and infest mainly rodents but will bite humans.

The aim of the current study was to determine the prevalence of Bartonella spp. in X. cheopis fleas removed from Rattus norvegicus rats in Los Angeles County, CA. In a separate survey, R. norvegicus rats, infested with fleas examined for this study, were also screened for the presence of Bartonella DNA (A. K. B. Gundi, S. A. Billeter, M. Rood, and M. Y. Kosoy, submitted for publication). Comparison between the results of the two studies will be discussed.

Flea collection and DNA extraction.

R. norvegicus rats were captured in downtown Los Angeles, CA, in 2003 and 2004. Tomahawk live traps (14 by 14 by 41 cm) baited with commercial dog biscuits dipped in peanut butter were set in alleys at large common food sources, such as dumpsters. Fleas were collected from rodents by brushing/combing the bodies and were subsequently placed in microtubes containing 95% ethanol. All fleas were identified as X. cheopis using taxonomic keys (7) and were tested for the presence of Bartonella DNA.

Individual fleas were triturated using a bead beater protocol (5), and DNA was extracted using a Qiagen QIAamp tissue kit (Qiagen, Valencia, CA) according to the manufacturer's instructions. DNA was extracted from 1 to 5 individual fleas per rat; 200 individual fleas in total were examined.

PCR analysis and sequencing.

Fleas were examined for the presence of Bartonella DNA by PCR targeting a 767-bp fragment of the citrate synthase gene (gltA) using primers CS443f (5′ GCTATGTCTGCATTCTATCA 3′ (2) and CS1210r (5′ GATCYTCAATCATTTCTTTCCA 3′). PCR was performed using a Bio-Rad Laboratories iCycler (Hercules, CA) with the following cycling conditions: 94°C for 2 min; 45 cycles of 94°C for 30 s, 48°C for 1 min, and 72°C for 1 min; and one cycle of 72°C for 7 min. The positive control consisted of Bartonella doshiae DNA, and nuclease-free water was used as a negative control.

Amplicons were purified using the QIAquick PCR purification kit (Qiagen) and sequenced using an Applied Biosystems Model 3130 genetic analyzer (Applied Biosystems, Foster City, CA); up to 3 positive fleas per rat were analyzed. DNA sequences were analyzed using the Lasergene version 8 sequence analysis software (DNASTAR, Madison, WI) to determine a consensus sequence for each flea sample. As most Bartonella gltA sequences available in GenBank are ~327 bp in length, all sequences from this study were subsequently shortened to allow for further phylogenetic analysis (6). Sequences obtained in this study were considered similar to validated Bartonella spp. if similarity over the 327-bp gltA fragment was ≥96% (6).

The Clustal W program in Megalign (Lasergene) was used to compare sequences obtained from this study to Bartonella sequences available in GenBank. The neighbor-joining (NJ) method by Kimura's two-parameter distance method and bootstrap calculation was carried out with 1,000 resamplings.

Prevalence differences were analyzed using a chi-square analysis. A P value of <0.05 was considered significant.

Comparison between Bartonella spp. detected in fleas versus those detected in their respective rat hosts.

Collection of rodent blood and methods used to examine blood samples for the presence of Bartonella DNA are described elsewhere (Gundi et al., submitted).

Prevalence and genetic heterogeneity of Bartonella in X. cheopis fleas.

A total of 200 individual X. cheopis fleas, collected from 55 R. norvegicus rats, were examined for the presence of Bartonella DNA. Of those, 95% were PCR positive using gltA-specific primers. Sequencing and further phylogenetic analysis of 91 fleas revealed that 72.5% (66/91) harbored B. rochalimae-like DNA versus 27.5% (25/91) that contained DNA most closely related to B. tribocorum2 = 14, P [double less-than sign] 0.01).

Of the 91 sequences examined, 8 genotypes with 86.8 to 99.7% similarity were found. The 8 genotypes were clustered around either B. rochalimae BMGH (DQ683195) (genotypes 1 to 3, GenBank accession numbers JF522364 to JF522366) or B. tribocorum IBS506T (AJ005494) (genotypes 4 to 8, GenBank accession numbers JF522367 to JF522371) with sequence identities ranging from 98.5 to 98.8% and 97.9 to 99.7%, respectively. The B. rochalimae group (genotypes 1 to 3), detected in fleas recovered from 40 R. norvegicus rats, contained gltA sequences that were 99.4 to 99.7% homologous. Genotype 1 contained 64 identical sequences and genotypes 2 and 3 were both single sequences. The B. tribocorum group (genotypes 4 to 8), found in fleas removed from 20 rats, harbored sequences that were 98.1 to 99.7% homologous. Genotype 4 consisted of 2 sequences, genotype 5 contained 20 identical sequences, and genotypes 6 to 8 represented single sequences (Fig. 1).

Fig. 1.
Tree topology displaying similarity of 8 Bartonella genotypes detected in Xenopsylla cheopis from Los Angeles (91 sequences total) with known Bartonella sequences based upon the partial citrate synthase gene, gltA. The topology was constructed by the ...

Comparison between Bartonella spp. detected in fleas and those detected in their respective rat hosts.

As depicted in Table 1, 27 B. rochalimae-positive fleas and 8 B. tribocorum-positive fleas were collected from 23 rats that were PCR positive for the presence of B. tribocorum only. Eight B. rochalimae-positive fleas and 1 B. tribocorum-positive flea were collected from 6 rats that harbored only detectable B. rochalimae DNA. Twenty B. rochalimae-positive fleas and 7 B. tribocorum-positive fleas were collected from 12 rats that had detectable DNA of both Bartonella spp. Eleven B. rochalimae-positive fleas and 9 B. tribocorum-positive fleas were found on 14 R. norvegicus rats that were PCR negative for the presence of Bartonella DNA.

Table 1.
Comparison between Bartonella spp. detected in rats and in their respective fleasa

From 91 fleas, B. tribocorum was detected in 27.5% and B. rochalimae was identified in 72.5% of these samples. A separate report (Gundi et al., submitted) also examined R. norvegicus rats, which served as hosts for fleas in this study, for the presence of Bartonella by culture and PCR analysis. Bartonella tribocorum was isolated from the blood of over half (56.4% of 55 rats) of R. norvegicus rats, while only 2 harbored viable B. rochalimae organisms. By PCR analysis, 41.8% (23 of 55) of rats harbored B. tribocorum only, 10.9% (6 of 55) had only detectable B. rochalimae DNA, and 21.8% (12 of 55) of rats had detectable DNA from both agents when screened using gltA-specific PCR primers (Gundi et al., submitted). In contrast, the majority of X. cheopis fleas examined in this study harbored B. rochalimae-like DNA. The reason for the disparity in Bartonella sp. composition between rats and their respective fleas remains unclear. As speculated by Tsai et al. (8), it is possible that selective pressure or competition allows certain species to adapt to the mammalian host, while others dominate in the potential arthropod vector. Because PCR products were not cloned and sequenced, it cannot be ruled out that fleas harbored both B. rochalimae and B. tribocorum DNA. Furthermore, detection of DNA in the flea does not demonstrate viability of organisms or infection, and the Bartonella spp. may have been acquired during a previous blood meal.

From a public health standpoint, it is important to ascertain whether R. norvegicus rats serve as reservoirs for B. rochalimae due to their close contact with humans and their pets. Furthermore, R. norvegicus rats are infested with ectoparasites, such as X. cheopis fleas, that will feed on humans and can transmit potentially deadly zoonotic pathogens. Further investigation is warranted to identify if X. cheopis fleas are competent vectors of Bartonella spp. and if R. norvegicus rats serve as reservoir hosts for these organisms.

Nucleotide sequence accession numbers.

Sequences, representative of genotypes obtained from this study, were deposited in GenBank under accession numbers JF522364 to JF522371.

Acknowledgments

We thank Ying Bai for her assistance with the statistical analysis and Robert Flores for his assistance in rat trapping and processing.

Sarah A. Billeter is supported by the ASM/CDC Postdoctoral Research Fellowship Program in Infectious Disease and Public Health Microbiology.

Footnotes

[down-pointing small open triangle]Published ahead of print on 9 September 2011.

REFERENCES

1. Billeter S. A., Levy M. G., Chomel B. B., Breitschwerdt E. B. 2008. Vector transmission of Bartonella species with emphasis on the potential for tick transmission. Med. Vet. Entomol. 22:1–15 [PubMed]
2. Birtles R. J., Raoult D. 1996. Comparison of partial citrate synthase gene (gltA) sequences for phylogenetic analysis of Bartonella species. Int. J. Syst. Bacteriol. 46:891–897 [PubMed]
3. Chomel B. B., Kasten R. W. 2010. Bartonellosis, an increasingly recognized zoonosis. J. Appl. Microbiol. 109:743–750 [PubMed]
4. Dehio C. 2004. Molecular and cellular basis of Bartonella pathogenesis. Annu. Rev. Microbiol. 58:365–390 [PubMed]
5. Halos L., et al. 2004. Determination of an efficient and reliable method for DNA extraction from ticks. Vet. Res. 35:709–713 [PubMed]
6. La Scola B., Zeaiter Z., Khamis A., Raoult D. 2003. Gene-sequence-based criteria for species definition in bacteriology: the Bartonella paradigm. Trends Microbiol. 11:318–321 [PubMed]
7. Stark H. E., Hudson B. W., Pittman B. 1966. Plague epidemiology. U.S. Department of Health and Human Services, Centers for Disease Control and Prevention, Atlanta, GA
8. Tsai Y. L., Chuang S. T., Chang C. C., Kass P. H., Chomel B. B. 2010. Bartonella species in small mammals and their ectoparasites in Taiwan. Am. J. Trop. Med. Hyg. 83:917–923 [PMC free article] [PubMed]

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)