PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Nat Neurosci. Author manuscript; available in PMC Sep 27, 2011.
Published in final edited form as:
Published online Dec 12, 2010. doi:  10.1038/nn.2710
PMCID: PMC3180918
NIHMSID: NIHMS251595
An evolving NGF–Hoxd1 signaling pathway mediates development of divergent neural circuits in vertebrates
Ting Guo,1 Kenji Mandai,1 Brian G. Condie,2 S. Rasika Wickramasinghe,1 Mario R. Capecchi,3 and David D. Ginty1,4
1Solomon H. Snyder Department of Neuroscience, Howard Hughes Medical Institute, Johns Hopkins University School of Medicine, Baltimore, Maryland 21205, USA
2Department of Genetics, University of Georgia, Athens, Georgia 30602, USA
3Department of Human Genetics, Howard Hughes Medical Institute, University of Utah School of Medicine, Salt Lake City, Utah 84112, USA
4 To whom correspondence should be addressed: dginty/at/jhmi.edu
Species are endowed with unique sensory capabilities encoded by divergent neural circuits. One potential explanation for how divergent circuits have evolved is that conserved extrinsic signals are differentially interpreted by developing neurons of different species to yield unique patterns of axonal connections. Although NGF controls survival, maturation and axonal projections of nociceptors of different vertebrates, whether the NGF signal is differentially transduced in different species to yield unique features of nociceptor circuits is unclear. We identified a species-specific signaling module induced by NGF and mediated by a rapidly evolving Hox transcription factor, Hoxd1. Mice lacking Hoxd1 display altered nociceptor circuitry which resembles that normally found in chicks. Conversely, ectopic expression of Hoxd1 in developing chick nociceptors promotes a pattern of axonal projections reminiscent of the mouse. We propose that conserved growth factors control divergent neuronal transcriptional events which mediate interspecies differences in neural circuits and the behaviors they control.
The assembly of neural circuits is instructed by phylogenetically conserved families of extracellular cues that control neuronal differentiation, axon and dendrite targeting, survival, and synaptogenesis13. Yet, it is unclear how novel neural circuits arise during evolution to encode unique behaviors among different animal species. In a classic example of extrinsic control of neural development, target-derived nerve growth factor (NGF) promotes survival, maturation, and target innervation of developing nociceptors, which are polymodal sensory neurons that innervate the skin and detect pain, temperature, touch, and itch4. A similar, central role of NGF in nociceptor development is highly conserved in different classes of vertebrates, including mammals and birds57. However, mammalian and avian nociceptor circuits display notable differences that likely represent beneficial evolutionary adaptations89. In mammals, for example, nociceptors form elaborate axonal endings associated with hair follicles and within the epidermis1011. Such epidermal and hair-follicle-associated nociceptor endings are absent in birds and reptiles1214 and may represent adaptive features of mammals since their skin lacks rigid mechanical barriers, such as scales and feathers present in birds and reptiles, and is thus more directly exposed to environmental stressors1517. The molecular driving forces behind the evolution of neural circuits underlying mammalian nociception, as for those mediating novel sensory, motor and cognitive functions, remain poorly understood. Here, we test the idea that the conserved NGF signal triggers species-specific patterns of nociceptor gene transcription which underlie divergent organization of vertebrate nociceptor circuits.
A screen for genes controlled by NGF signaling in mammalian nociceptors
We first searched for evolutionarily dynamic transcriptional targets of NGF signaling pathways that may function in mammals, but not in birds, to control unique aspects of nociceptor development. NGF-dependent genes in developing mouse nociceptors were identified through three separate genome-wide screens: (1) One screen compared gene expression profiles of embryonic day (e)14.5 dorsal root ganglia (DRG) of wild-type (WT) and Ngf−/− mice to identify genes whose transcripts are enriched in nociceptors18; (2) A second screen compared e14.5 DRGs of Bax−/− and Ngf−/−; Bax−/− mice to identify NGF-regulated genes expressed in nociceptors in vivo (Bax−/− prevents nociceptor cell death accompanying genetic deletion of Ngf 19.); (3) The third screen compared mouse DRG explants grown in the presence or absence of NGF for identification of NGF-dependent genes expressed in nociceptors in vitro. These three screens identified a large cohort of NGF-dependent genes in mouse nociceptors, including the well-characterized nociceptor genes Ret, CGRP, and TrkA (table S1–S3). Moreover, a cross-comparison of the three screens revealed a small number of genes that are tightly regulated by NGF both in vivo and in vitro and are potentially important for development of mouse nociceptor circuitry (Fig. 1a, b). We next used parallel cultures of mouse and chick DRGs and quantitative PCR (qPCR) analyses to determine the extent to which the avian orthologs of these identified mammalian genes are also expressed in an NGF-responsive manner in chicken nociceptors (Supplemental Fig. 1). Several observations led us to focus on one gene, which encodes the homeobox transcription factor Hoxd1: (1) All three genome-wide screens identified Hoxd1 as one of the most NGF-responsive genes in mice (Fig. 1b and Table S1–S3); (2) In our cross-species comparison, Hoxd1 was robustly induced by NGF in mouse but not chick nociceptors, in stark contrast to the majority of other NGF-controlled genes, which behaved similarly in mouse and chick nociceptors (Fig. 1c, e and Supplemental Fig. 1); (3) While most Hox genes encode highly conserved transcription factors critical for animal development20, sequence comparisons suggest a high degree of divergence of Hoxd1 between different vertebrate species (Supplemental Fig. 1 and ref. 21). Furthermore, the well-characterized expression of Hoxd1 in the anterior neuroectoderm of lower vertebrates is absent in modern mammals2223, raising the possibility of a newly evolved and yet unknown function of Hoxd1 in the mammalian lineage.
Figure 1
Figure 1
NGF signaling induces Hoxd1 expression in mammalian, but not avian, embryonic nociceptors
Developmental expression of Hoxd1 in different vertebrate species
To begin to characterize potential roles of Hoxd1 in development and evolution of vertebrate nociceptor circuits, we first examined its pattern of expression in mouse and chick embryos. Hoxd1 expression was readily detected in ~80% of developing nociceptors of WT mouse embryos (Fig. 1g, h) where its time of onset and peak expression are coincident with that of NGF signaling (Supplemental Fig. 2). Moreover, expression of Hoxd1 was eliminated in genetically modified mice lacking either nociceptive neurons (Ngf−/−) or NGF/TrkA signaling (Ngf−/−; Bax−/−), indicating the presence of an NGF–Hoxd1 signaling module in developing mouse nociceptors (Fig. 1d, f). Furthermore, in WT mouse embryos, nociceptors in DRGs located throughout the rostrocaudal axis express Hoxd1 at comparable levels, a pattern that is atypical for a Hox gene and yet consistent with the aforementioned NGF-dependent expression of Hoxd1 (Supplemental Fig. 2). In contrast and reflecting a lack of transcriptional activation of avian Hoxd1 in response to NGF (Fig. 1e), Hoxd1 mRNA was undetectable in developing chick nociceptors both before and after the onset of NGF signaling in chick embryos (Fig. 1g, h). To determine whether the NGF–Hoxd1 signaling module is present in other non-mammalian vertebrates, we examined Hoxd1 expression in developing DRGs of the reptile green anole lizard (Anolis carolinesis) and the amphibian clawed frog (Xenopus tropicalis). Few, if any, developing nociceptors of these animals express Hoxd1, resembling the lack of expression in chicks (Supplemental Fig. 3). Moreover, an alignment of vertebrate genomes revealed clusters of densely packed sequence motifs surrounding the Hoxd1 transcription unit that are highly conserved in different mammals but absent in non-mammalian genomes (Supplemental Fig. 3). Thus, while peripheral target-derived NGF supports nociceptor survival and axon extension in rodents, birds and perhaps other vertebrate species47, it promotes robust expression of Hoxd1 in mouse but not chicken nociceptors.
Nociceptive circuitry in the skin of Hoxd1−/− mice resembles that of non-mammalian vertebrates
To determine whether Hoxd1 mediates development of divergent nociceptor circuits in vivo, we next generated mice harboring a targeted deletion of Hoxd1 (Supplemental Fig. 4). Hoxd1−/−mice are viable, fertile and, unlike mice harboring mutations in other anterior group Hox genes, exhibit normal hindbrain patterning (data not shown). Intriguingly, however, the pattern of nociceptor innervation of the skin of Hoxd1−/− mice is abnormal and reminiscent of that which is normally observed in non-mammalian vertebrates, including birds. Our initial focus was on sensory innervation of hair follicles because hair is a distinguishing feature of mammals that represents a cold adaptation feature necessary for the prevention of heat loss16. Moreover, in mammalian skin, hair follicles serve as organizing centers for axons of DRG somatosensory neurons, including nociceptors10. In WT mice, nociceptor endings, which are strongly labeled by anti-Peripherin staining, encircle most if not all down hair follicles (Fig. 2a, b). Birds, on the other hand, have evolved feathers, and feather follicles do not possess such circular sensory endings (Fig. 2a and ref. 12). Interestingly, Hoxd1 mutant mice exhibit a marked deficit of the Peripherin+ axonal endings associated with hair follicles (Fig. 2b, e). A key role of Hoxd1 in nociceptor hair afferent development is further supported by the observation that it is required for specification of Mrgprb4+ neurons, which constitute a unique population of mammalian nociceptors that exclusively innervate hair follicles24. In mice, Mrgprb4+ neurons represent ~15% of non-peptidergic nociceptors, and their peripheral axons branch exclusively in hairy skin and encircle the neck of hair follicles24. In Hoxd1−/− mice, there are ~3 times more DRG sensory neurons expressing Mrgprb4 (Fig. 2d, g). Moreover, all Mrgprb4+ neurons in Hoxd1−/− mice abnormally express markers of peptidergic nociceptors, CGRP and TrkA, indicating impaired specification of these hair follicle-associated nociceptors (Fig. 2d, f). This nociceptor specification deficit appears to be restricted to hairy skin nociceptors as expression of molecular markers for the major subclasses of nociceptors is largely normal in Hoxd1−/− mice (Supplemental Fig. 5). Lastly, in mammals, the epidermis of non-hairy (glabrous) skin is innervated by a dense array of nociceptor endings that convey noxious chemical, mechanical, and temperature stimuli1011. Such epidermal free nerve endings are absent in birds and reptiles despite the presence of dermal fibers1314,25, as the epidermis of these species is directly protected by mechanical barriers (scales and feathers) composed of a unique tough keratin protein that is not produced by mammals1517. Strikingly, in Hoxd1−/− mice, while neuronal number and dermal fibers are present in normal abundance, there is a reduction of epidermal endings of peptidergic nociceptors (Fig. 2c, h), reminiscent of that which is normally found in the skin of non-mammalian vertebrates. Thus, NGF-dependent expression of Hoxd1 in mammalian nociceptors controls mammal-specific features of nociceptor development, including specification and target innervation of subsets of hair-follicle-associated nociceptors and penetration of the epidermis by peptidergic nociceptors.
Figure 2
Figure 2
Hoxd1 instructs development of mammal-specific features of nociceptor axonal connections in the skin
Hoxd1 instructs nociceptor central axonal projections within the mammalian spinal cord
Mirroring species-specific differences in innervation of the skin, the patterns of nociceptive axonal projections within the spinal cords of mammals and birds are also distinct89. In mice, the majority of central axonal branches of nociceptors penetrate the dorsal spinal cord in the dorsal region, project ventrally, and terminate in lamina I and II of the dorsal horn (Supplemental Fig. 6). In contrast, avian (chick) nociceptors penetrate the spinal cord from a more lateral position and, in addition to those nociceptors that terminate in lamina I and II of the dorsal horn, many nociceptor axons extend horizontally into deep layers of the spinal cord9 to innervate integrative regions that receive a convergence of sensory inputs of multiple modalities2627 (Supplemental Fig. 7). Remarkably, in Hoxd1−/− mice, we detected a large number of aberrant nociceptor axonal projections within the spinal cord that bear intriguing similarity to the horizontally-extending deep projections normally observed in birds (Fig. 3a, b). The aberrant nociceptor axons enter the spinal cord of Hoxd1−/− mice from a lateral position, project horizontally across the spinal cord, and enter deep regions near the central canal (Fig. 3a). These misrouted fibers are detected at all axial levels (Fig. 3c, d) and terminate in and around lamina X, an area purported to integrate somatic and visceral sensory information of multiple modalities2627. Although such deep fibers were rarely observed in WT mice, the few that were seen were largely restricted to lumbrosacral levels (L4-S1; Supplemental Fig. 6) and are likely to be visceral organ afferents2829. In further support of a role of NGF-dependent Hoxd1 expression in directing nociceptor connections within the mouse spinal cord, mutant mice deficient for NGF signaling (Ngf−/−; Bax−/−) similarly exhibit excessive nociceptor axons within deep spinal cord layers (Fig. 4). Moreover, consistent with this, lizards, which do not express Hoxd1 in nociceptors (Supplemental Fig. 3), exhibit deep-projecting nociceptor fibers similar to those in chicks and Hoxd1−/− mice30. These observations suggest that Hoxd1 mediates NGF-dependent suppression of nociceptor projections into deep layers of the spinal cord.
Figure 3
Figure 3
Hoxd1 controls a species-specific pattern of nociceptor axonal connectivity within the spinal cord
Figure 4
Figure 4
NGF signaling controls a subset of central axonal projections of mammalian nociceptors in the spinal cord
Ectopic Hoxd1 expression in chick nociceptors induces mammal-like traits
If NGF-dependent expression of Hoxd1 is indeed a determinant of the mammal-specific pattern of nociceptor circuits, then ectopic expression of Hoxd1 in non-mammalian nociceptors may alter their axonal projections to adopt mammal-like features. Therefore, we asked whether ectopic Hoxd1 expression in nociceptors of the chick is sufficient to alter their pattern of axonal projections within the spinal cord. Using a neural crest-specific driver31, Hoxd1 was ectopically expressed in chick DRGs on one side of the animal, leaving the other side as a control (Fig. 5a, b), an approach that enables a direct comparison of sensory afferent projections between the electroporated and unelectroporated sides of the spinal cord32. Remarkably, ectopic expression of chick Hoxd1 affected the pattern of chick nociceptor central projections (Fig. 5c–e). In control embryos, at stage 35, TrkA+ nociceptor central axons have penetrated the superficial dorsal horn at a lateral position and have projected into deep layers of the dorsal horn. Many of these axons that initially project horizontally then turn in a ventral direction and form prominent bundles of horizontally-projecting axons (Fig. 5c and Supplemental Fig. 8). Following ectopic expression of Hoxd1 in chick DRGs, however, the prominent deep nociceptor projections, which under normal conditions extend horizontally toward the central canal, are suppressed (Fig. 5c). Importantly, electroporation of a Hoxd1 construct lacking the DNA-binding homeobox motif (Hoxd1Δh) had no effect on nociceptor projections (Fig. 5d). Moreover, the central projections of proprioceptive neurons appear normal following ectopic Hoxd1 expression (Supplemental Fig. 8). Thus, ectopic expression of Hoxd1 alters the central projection programs of chick nociceptors, forcing them to adopt murine nociceptor features (Fig. 5e).
Figure 5
Figure 5
Ectopic expression of Hoxd1 in chick nociceptors impairs their axonal ingrowth into the lateral spinal cord
Hoxd1−/− mice have deficits in pain sensitivity
To assess the behavioral consequences that may result from aberrant nociceptor circuits in Hoxd1−/− mice, we examined the Hoxd1−/− mutants for potential defects in somatosensation. Adaptation to cold climates is a central theme of mammalian evolution33, and many evolutionarily novel features of mammals are related to cold adaptation34. Indeed, the ancestors of modern mammals survived and flourished during extended geological periods of cold temperatures when many terrestrial heterothermic species became extinct3536. Remarkably, using measurements of avoidance of extreme hot and cold temperatures, we found that Hoxd1−/− mice exhibit markedly longer latencies of avoidance to an extremely cold (0°C) surface (Fig. 6a), representing a defective self-protection behavior essential for the survival of animals that explore cold environments37. Hoxd1−/− mice are otherwise comparable to littermate controls in their responses to hot temperature and light mechanical stimulation (Fig. 6b–e), although they do show abnormally prolonged carrageenan-induced thermal allodynia (Fig. 6f), suggesting a role of Hoxd1 in inflammatory pain. The causes of the behavioral deficits of Hoxd1−/− mice are uncertain; Such deficits may arise from defects in axonal wiring in the skin, the spinal cord, or in defective specification of nociceptive neurons in the mutant mice. These results indicate that Hoxd1 is essential for the development of behavioral responses to cold temperatures in mice.
Figure 6
Figure 6
Behavioral responses of Hoxd1−/− mice to somatosensory stimuli
Here, we report that Hoxd1 is a rapidly evolving NGF/TrkA signaling pathway component whose differential expression in developing nociceptors across vertebrate species contributes to species-specific features of nociceptor circuits. We identified Hoxd1 from a genome-wide screen for genes expressed in response to NGF signaling in mice but not chickens. Moreover, genetic manipulations in mammals and birds showed that Hoxd1 instructs development of mammal-specific features of nociceptive neural circuitry. Finally, behavioral sensitivity to extreme cold is markedly compromised in Hoxd1 mutant mice, supporting functional significance of acquisition of Hoxd1 by mammalian nociceptors.
The Hox genes have undergone extraordinary evolutionary selection to delineate variations of body and limb plans in divergent lineages across the animal kingdom20. The present study presents a particularly fascinating feature of Hox gene divergence such that in the mammalian lineage the conserved axial patterning functions of Hoxd1 are lost and replaced by a role in mediating development of nociceptor circuits. Redundancy between Hoxa1, Hoxb1 and Hoxd1 may have allowed for relaxation of Hoxd1 from conserved roles and to evolve novel functions in mammals. Loss of Hoxd1 in mice results in compromised responses to extremely cold temperatures, an environmental stress that has challenged terrestrial animals throughout recent geological history3536. Repeated, dramatic, and long-term global cooling in the Cenozoic Era may thus represent selective pressure for mammalian evolution of Hoxd1. More generally, our analysis indicates that altered expression of a single, evolutionarily dynamic transcription factor during the course of vertebrate evolution can instruct unique features of sensory circuits and the behaviors they subserve.
We show that mammalian features in nociceptor circuits are subject to coordinated developmental control by mammal-specific expression of Hoxd1. Remarkably, Hoxd1 stands out as one gene that is robustly induced by NGF/TrkA signaling in rodents but not in birds amid a largely conserved genomic transcriptional response to NGF. We propose a model in which divergent expression of one or a small number of genes in embryos of different species, induced by conserved growth factor signaling pathways, results in macroscopic interspecies differences in adult neural circuits. Thus, identification and characterization of differentially expressed effectors of conserved growth factor signaling pathways will likely reveal key determinants of anatomical features, behaviors, and diseases unique to divergent vertebrate organ systems.
Generation of Mice and Mouse Genetics
Hoxd1−/− mice were generated by a targeting strategy similar to those described for several other Hox genes67. A polII-Neo-HPRT-pA cassette was inserted into the second exon of the Hoxd1 locus disrupting most of the homeobox domain including the DNA recognition helix and sequences downstream (Supplemental Fig. 4a). Positive 129/Sv ES cell clones confirmed by Southern hybridization (Supplemental Fig. 4b) were used to generate Hoxd1+/− founders that were confirmed by Southern blot, in situ hybridization, and PCR of genomic DNA extracted from the tails (Supplemental Fig. 4b–d). Hoxd1−/− mice were genotyped using a multiplex PCR reaction with the following primers: 5′-TCAGAAAATGCCCCAGGAGC (forward), 5′-TAGCCGTTATTAGTGGAGAGG (mutant reverse) and 5′-TGGAACCAGATTTTGACCTGG (WT reverse). The Ngf+/− and Bax+/− alleles have been described previously89. For all of our analyses, the morning after coitus was designated as embryonic day (e)0.5 and the day of birth as postnatal day (P)0.
All experimental procedures involving animals have been approved by the IACUC of Johns Hopkins University.
Microarray Analyses
DRGs were dissected out from e14.5 (1) Ngf−/−; Bax−/−, (2) Bax−/− and (3) Ngf−/− mouse embryos and (4) their control WT littermates from multiple litters and were stored in RNAlater (Ambion) at −20°C until use. DRG explants that were cultured either with NGF or with NT3 were also collected (see below). Two independent replicates, each consisting of DRGs pooled from multiple embryos of like genotypes from different litters, were separately prepared. At least 5 μg of total RNA was isolated from each group of pooled DRGs using an RNeasy Micro Kit (Qiagen). RNA was then hybridized to Affymetrix GeneChip Mouse Genome 430 2.0 arrays by the JHMI Microarray Core Facility. Statistical analyses were performed essentially as previously described18,39.
A loose cutoff at a posterior probability > 0.5 (ref. 39) and an estimated mRNA fold change > 1.5 was used to generate the Venn diagram (Fig. 1a). The 14 unique genes identified in all three independent microarray screens are: Aldoc, Crtac1, Dgkh, Hoxd1, Idi1, Klf7, Nrxn1, Pou4f2, Ppp1r, Prkca, Ret, Rgs4, Rgs7 and Tle4. These 14 genes and other select candidate genes were tested by qPCR for NGF-responsiveness in mouse and chick DRG cultures unless the sequences for chicken orthologs were not available.
DRG Neuron Explant Culture
For microarray analysis, DRGs were dissected out from 4 litters of e13.5 mouse embryos, placed on plates coated with poly-D-lysine and laminin, and maintained for 48 hrs with 50 ng/ml of either NGF or NT3. DRGs were then collected, and total RNA was extracted for two independent sets of cultures and processed for microarray analysis.
For expression comparisons, DRG explant culture conditions and protocols were previously described40. Briefly, DRGs were dissected from e13.5 mouse embryos and e7.25 chick embryos, placed on coverslips coated with collagen, and cultured with media containing 25 ng/ml NGF for 36 hours. DRG explants were then washed, deprived of NGF by culturing with BAF and anti-NGF antibody for 24 hrs, re-washed, and further cultured with BAF and either with or without NGF for an additional 24 hrs.
Chick, Frog and Reptile Embryos and cDNAs
Chicken (Gallus gallus), clawed frog (Xenopus tropicalis), and green anole lizard (Anolis carolinesis) embryos were collected and staged1,1314. Total RNA was extracted from stage 21~22 chicken and stage 52 frog embryos and first-strand cDNA synthesis was performed from the RNA using oligo(dT) primers and SuperScript III system (Invitrogen). A cDNA library of stage 7 Anolis carolinesis embryos was a generous gift from Dr. Thomas Sanger (Harvard University). Lizard and frog TrkA genes are identified based on homology searches using the highly conserved kinase domain, and lizard Hoxd1 was identified by homology and the genomic structure of the HoxD cluster and is in agreement with previous reports41. PCR products were blunt-end cloned into a pSC-B vector (Stratagene) and used as templates for synthesis of in situ hybridization probes. The following primers were used to amplify fragments of the TrkA and Hoxd1 genes from the cDNA.
  • Frog TrkA: 5′-GATAATCCCTTCAGCTTTAACC and 5′-ATCTTGACCACCAGATTATTGC
  • Frog Hoxd1: 5′-GAAAGATTGAGGGATCATCAGG and 5′-TCGAGTTCAGTCAGTTGTTTGG
  • Lizard TrkA: 5′-CACCGAAGAGAAGATGCTGGT and 5′-TAAATACACCGGGGGAGCTTT
  • Lizard Hoxd1: 5′-AAGCAGAAGAAAAGGGAGAGAGA and 5′-TGTAAGTGAAGTTGGGGAGAGAA
Immunohistochemistry and In Situ Hybridization
Protocols for immunohistochemistry and in situ hybridization were essentially as described38. For immunohistochemistry, mouse tissues were either preserved directly in OCT (Tissue Tek), fixed or transcardially perfused with either 4% ice-cold paraformylaldehyde (PFA) or Zamboni’s fixative then cryoprotected in 30% sucrose/phosphate-buffered saline (PBS). Immunofluorescent stainings were performed with cryosections either on glass slides or as floating sections. Primary antibodies used include: rabbit anti-mouse TrkA (Millipore, 1:1000), rabbit anti-chicken TrkA and TrkC (gifts from Dr. Frances Lefcort, Montana State University, 1:1000), rabbit (Millipore, 1:1000) or mouse anti-peripherin (Millipore, 1:500), rabbit anti-CGRP (Millipore, 1:1000), rabbit anti-PGP9.5 (Millipore, 1:1000), rabbit anti-Parvalbumin (Swant, 1:2000), rabbit anti-GFP (1:2000, Invitrogen), chicken anti-LacZ (Promega, 1:500), rabbit anti-Ret (Immuno-Biological Laboratories, 1:1000), mouse anti-chick Neurofilament 160kD (Zymed, 1:500) and rabbit anti-Neurofilament 200 (Millipore, 1:1000). Secondary antibody incubations were performed with Alexa Fluor-conjugated secondary antibodies (Molecular Probes, 1:500).
Probes used for in situ hybridization were: mouse Hoxd1 (nucleotides 946–1386 of NM_010467.2), mouse CRD-Nrg1 (nucleotides 1–598 of NM_178591.2), rat Nrp1 (nucleotides 2515–3799 of NM_145098), chick Hoxd1 (BU269116, (clone ChEST816c12, GeneServices) digested by PstI and transcribed with T3) and frog Hoxd1 (nucleotides 7–701 of NM_001016678.2). Sequences of in situ probes for lizard Hoxd1 and lizard TrkA are described above in the “Chick, Frog and Reptile Embryos and cDNAs” section.
Imaging, Quantification and Statistical Analyses
Confocal fluorescent images were taken on a Zeiss Axioskop 2 microscope with an LSM 510 confocal scanning module. Whole-mount fluorescent images were taken from a Zeiss SteREO Lumar.V12 fluorescent dissecting microscope. To quantify hairy skin innervation, an approximately 4 mm X 4 mm piece of the back thigh hairy skin was dissected from young adult animals (P20 – P30), and serial cryosection was performed at a thickness of 25 μm. Every third or fifth section was collected, and the total number of circular hair follicle endings was counted in each of the collected sections. The number was then normalized to the area of the skin measured in ImageJ. The same skin region was taken from each animal. Quantification of epidermal free nerve endings was performed as described38. Fluorescent intensities were measured using ImageJ (NIH), and a rectangular measuring window with the same size was applied to all images that were compared. The statistical analyses of significance, including p value cutoffs, are specified in Figure Legends.
Quantitative RT-PCR
First-strand cDNA was synthesized from 1 μg of total tissue RNA using oligo(dT) primers and SuperScript III First Strand Synthesis System (Invitrogen). Real-time PCR (qPCR) was performed using an Applied Biosystems 7300 Real-Time PCR System using Quantitect SYBR Green PCR Kit (Qiagen). Expression levels for each gene from each sample were normalized to control PCR products of Gapdh or Actb for non-neuronal tissues, or Pgp9.5 (alias Uchl1) specifically for neurons18. Primers for qPCR were:
  • Mouse Hoxd1: 5′-CCCCAAGAAAAGCAAACTGTCC and 5′-AAACAGTTGGCTATCTCGATGC;
  • Chicken Hoxd1: 5′-AGAGGAGGAGCAGAAACCCCAG and 5′-TTTGCACAGGAAGGGAGGAAGAC;
  • Mouse Ret: 5′-AGAAAAGCAAGGGCCGGATTC and 5′-GTCGTTCAGGAGGAATTCCAGG;
  • Chicken Ret: 5′-AAAGTGATGTGTGGTCGTTTGG and 5′-CACTGCAGTTTTCTGGTCTCTCC;
  • Mouse CGRP: 5′-AGGGCTCTAGTGTCACTGCTCAG and 5′-CACATTGGTGGGAACAAAGTTG;
  • Chicken CGRP: 5′-CAGTCAGACCTGGCTTGGAGTC and 5′-TGTTCCCCTCAGAGGCTTGCTC;
  • Mouse Klf7: 5′ - GAGCTCGGGGGAGGGTTTCTCC and 5′ - GCCGGTGTCGTGGACAAGTTGT
  • Chicken Klf7: 5′ – TGGCAGCAGACATGCCTCGAGT and 5′ - GGGGTCCAGCCGTCGGATACTG
  • Mouse Ldb2: 5′ - GCACGTCCAATAGCAGTGCCGG and 5′ - TCCTACCACCATCACATCAGGTACCT
  • Chicken Ldb2: 5′ - TCCAGCGCACCACATGACCCTT and 5′ - GTTGTCACTGTCCTCGCTCCGC
  • Mouse Diras2: 5′ - GGACCGTGAGCCTCCAGATCGA and 5′ - TCCTGCACGAAGGCCTCTCACA
  • Chicken Diras2: 5′ - GTGGTTGTGTTTGGGGCTGGAGG and 5′ - TGCCGGTAGGTGTCTTCAATGGTG
  • Mouse Ncam2: 5′ - GCAAAGTAGAGCTTAGTGTGGGTGAG and 5′ - GTCGTGACCTGACACCCTCCTT
  • Chicken Ncam2: 5′ - AGCAAAGTCGAACTCAGTGTGGGT and 5′ - ACGTGACCGAACACCTTCTTTTTGA
  • Mouse Nrxn1: 5′ - AGAAGGAAGCCGTGTTGGTGCG and 5′ - CGATGGCGATGTCATCTGTCCCA
  • Chicken Nrxn1: 5′ - TCGTACAACTGAGCCAAATGGTTTGA and 5′ – ACAGCAGGTAGAGGTGGCCATCA
  • Mouse Runx1: 5′ - CTCCAGCCTCCAGCTACTGCCC and 5′ - CCTGAGCCTGACAGTGCCCCTT
  • Chicken Runx1: 5′ - TGGAAGAGGGAAAAGCTTCACAC and 5′ – CTTGCCTCGTGTTTCTGGGTTC
  • Mouse Rgs7: 5′ - ACGGAGCCATCGCCCATACCTT and 5′ - ACAGCGTCCCTTGGCAAGTGTG
  • Chicken Rgs7: 5′ - GCTGGTGTACAGAAAGATGGAAGACG and 5′ -TGTCTGAACCAGAAAAGACACTGGGG
  • Mouse PlxnC1: 5′ – TGCCTGGCCCATCTAGACTGCA and 5′ - ACAAGATTGGGAGGGCGTCTGT
  • Chicken PlxnC1: 5′ – TGCAGTGTCCAAAATGCTTCCAAGG and 5′ -TGCCCAACGTAGAAATCCACAAAGGC
  • Mouse Ppp1r: 5′ - AGCATGCTTCTGTGGACTCCCCA and 5′ - AGGTTTAGCACCCACCTCCATGGT
  • Chicken Ppp1r: 5′ – GAGTGCCTGTGCTACTCGCACC and 5′ - CCCCAAGTGAGCAGATCACCAGC
  • Mouse Prkca: 5′ - CCCACAGCGGGATTTTCCCGTG and 5′ - CCGTCATCCCCACAGTTGAGCG
  • Chicken Prkca: 5′ – GGGACAGTTGGTGAGCGAACCG and 5′ - AAATCCCAGGCGCCAAAGGACG
  • Mouse Crtac1: 5′ – TGATGGGGGTTCCGGCTACCTG and 5′ -GGCCACACTTCGGCTCACCATC
  • Chicken Crtac1: 5′ - CGAGAACGGACGCTGCGTAGAC and 5′ - AGCGGTACCCGCCATAGGTGTT
  • Mouse Etv4: 5′ – ATGCAGAAGGTGGCTGGCGAAC and 5′ - TGTCCTCCTCACTGACTGGCCG
  • Chicken Etv4: 5′ - GCTGTGCCATGTGGCTGCAAAC and 5′ - CAGGCAAGGAGGTGGCAATGCA
  • Mouse Rgs4: 5′ - GCCAATGTACCGGGCTGCAAAA and 5′ - GATGGGGGAGCTCTGGGGACAT
  • Chicken Rgs4: 5′ – CTCGTTCCTGCTCCTGGGCTCT and 5′ - TGCCGTGTCAGAACCCCTGTGA
  • Mouse Tle4: 5′ - AGGACTGCTTGCCTACCGCTGT and 5′ - TAAAGCAAGCCACCATCCCGGG
  • Chicken Tle4: 5′ - AGTACATTGTCACTGGCTCTGGGG and 5′ - AGTGCTAGGAGAAGGAGTTCTGCCT
  • Mouse Dgkh: 5′ - AGCCATCAACGTCAAGGCGCTC and 5′ - TGTAAGGCACTGGACACCCGCT
  • Chicken Dgkh: 5′ – ACTGCAGCACCACCGGATAGCT and 5′ - CTCCTGGGGGCTGGATCCATGC
  • Mouse Pou4f2: 5′ - CGGCACACGTGCTCTCTCACTC and 5′ - TGGAGACTGCACCTAAGGCTGGG
  • Chicken Pou4f2: 5′ - ACTCTTGGAGCACCTGACGCCG and 5′ - ATGGGGTTCATGCCGGCCATG
  • Chicken Gapdh: 5′-GAAGGCTGGGGCTCATCTGAAG and 5′-CACGATGCATTGCTGACAATTTTC;
  • Mouse Gapdh: 5′-ACTGTGGTCATGAGCCCTTC and 5′-CATGTTTGTGATGGGTGTGAAC;
  • Mouse Pgp9.5: 5′-ACGGCCCAGCATGAAAACT and 5′-GACGGATCCATCCTCAAATTCC;
  • Mouse Actb: 5′-CCACTGCCGCATCCTCTTCC and 5′-CTCGTTGCCAATAGTGATGACCTG.
Chick In Ovo Electroporation
Chick in ovo electroporation was performed as described4243. Briefly, DNA was injected into the neural tube of Hamburger & Hamilton (HH) stage 12~13 chick embryos using a glass pipette. Electrical field was then applied with a pair of needle electrodes (Genetrodes; Harvard Apparatus) and a square pulse electroporator (BTX) at 30 V (pulse length: 50 ms; number of pulses: 5; intervals: 1 s). Successfully electroporated eggs, visually confirmed by endogenous GFP signal under a Zeiss SteREO Lumar.V12 fluorescent dissecting microscope 2 or 3 days after electroporation, were incubated until stage 34~35 for analysis. Chicken Hoxd1 coding sequence was amplified from a chicken cDNA library with: 5′-ATGGACTTGGGTTTTTTCCC (Forward) and 5′-TCAATACAAAGGGAGTAAAGCAGC (Reverse). Truncated chick Hoxd1 lacking homeobox was amplified with the same forward primer and 5′-CTGCCGGGTGCTGAAACTG (Reverse).
To achieve selective expression in the DRGs, we used a strategy similar to what has been demonstrated for motor neuron-specific electroporation18 but instead searched for enhancers that direct DRG-specificity. Briefly, two constructs were co-electroporated: the first was electroporated at a lower concentration (0.2 μg/μl) and uses an enhancer connected to a weak basal promoter (CMV) to drive Cre recombinase expression. The second construct, electroporated at a high concentration (1~2 μg/μl), uses a strong promoter (CAGGS) to drive a loxP-STOP-loxP-GeneX-IRES-eGFPf cassette. Over 10 enhancer fragments that direct DRG-specific expression in transgenic mice were tested, and one fragment of the Sox10 enhancer (“D6”, described in ref. 31) was used. Primers used to clone this fragment from mouse genomic DNA were: 5′-ATGACCGTAAGCCTTAGGAGATGG (Forward) and 5′-GCACTGGCATAGTTGGAAGAATGG (Reverse).
Pain Behavioral Tests
Pain behavioral tests were done essentially as described44. Briefly, for the Hargreaves’ test (radiant heat), mice were placed in plexiglas restrainers and a light beam was directed to the footpads of hindpaws using an IITC Plantar Analgesia Meter. For tail immersion, mice were gently restrained in a specially machined 50 ml conical tube that permits ventilation, and the distal halves of their tails were immersed in a 50 °C water bath. For the hot plate test, mice were placed in an IITC Hot Plate Analgesia Meter, and the onset of brisk paw lifts and/or flicking/licking of the paw was assessed. For cold plate, a clear Plexiglas cylinder was placed on a metallic plate equilibrated to 0 °C, and mice were placed inside the cylinder. The latency to the onset of brisk and persistent paw withdrawal and/or licking of the paw was measured. For the von Frey assay, mice were placed within Plexiglas restrainers on a fine metallic grid, and their hindpaws were stimulated using a set of von Frey filaments (Bioseb) starting with the lowest force. For carrageenan-induced inflammation, 10 μl of 1 % carrageenan (Sigma 22049) dissolved in sterile saline was injected subcutaneously into right hindpaws using a Hamilton syringe, and thermal hyperalgesia was measured using a Hargreaves’ apparatus before, 6 hrs, and 24 hrs after the injection. All mice used for behavioral studies were 2~3 month old and were backcrossed to the 129/Sv mouse strain for at least 4 generations.
Supplementary Material
Acknowledgments
We thank T. Sanger for green anole embryos, cDNA, and assistance with staging, N. Marsh-Armstrong for frog embryos, F. Lefcort for antibodies, S. Sockanathan, B. Zhuang, and C. Lee for reagents and technical assistance with chick electroporation, A. Kolodkin, M. Li, X. Dong and H. Song for helpful discussions, and members of the Ginty lab for comments on the manuscript, discussions, and assistance throughout the course of the project. This work is supported by NIH grant NS34814 (DDG). M.R.C. and D.D.G are investigators of the Howard Hughes Medical Institute.
Footnotes
Author Contributions
T. G., K. M. and S. R. W. performed the experiments. B. G. C. and M. R. C. generated the Hoxd1−/− mice. T.G. and D. D. G. conceived of the project, analyzed the data and wrote the manuscript.
1. Dodd J, Jessell TM. Axon guidance and the patterning of neuronal projections in vertebrates. Science (New York, NY) 1988;242:692–699. [PubMed]
2. Tessier-Lavigne M, Goodman CS. The molecular biology of axon guidance. Science (New York, NY) 1996;274:1123–1133. [PubMed]
3. Huber AB, Kolodkin AL, Ginty DD, Cloutier JF. Signaling at the growth cone: ligand-receptor complexes and the control of axon growth and guidance. Annual Review of Neuroscience. 2003;26:509–563. [PubMed]
4. Snider WD. Functions of the neurotrophins during nervous system development: what the knockouts are teaching us. Cell. 1994;77:627–638. [PubMed]
5. Huang EJ, Reichardt LF. Neurotrophins: roles in neuronal development and function. Annual Review of Neuroscience. 2001;24:677–736. [PMC free article] [PubMed]
6. Levi-Montalcini R. The nerve growth factor 35 years later. Science (New York, NY) 1987;237:1154–1162. [PubMed]
7. Gundersen RW, Barrett JN. Neuronal chemotaxis: chick dorsal-root axons turn toward high concentrations of nerve growth factor. Science (New York, NY) 1979;206:1079–1080. [PubMed]
8. Mirnics K, Koerber HR. Prenatal development of rat primary afferent fibers: II. Central projections. The Journal of comparative neurology. 1995;355:601–614. [PubMed]
9. Eide AL, Glover JC. Developmental dynamics of functionally specific primary sensory afferent projections in the chicken embryo. Anatomy and Embryology. 1997;195:237–250. [PubMed]
10. Rice FL, Albrecht PJ. In: The Senses: A Comprehensive Reference. 6. Basbaum AI, Kaneko A, Shepherd GM, Westheimer G, editors. Academic Press; 2008. pp. 1–32.
11. Zylka MJ, Rice FL, Anderson DJ. Topographically distinct epidermal nociceptive circuits revealed by axonal tracers targeted to Mrgprd. Neuron. 2005;45:17–25. [PubMed]
12. Lucas AM, Stettenheim PR. Avian anatomy - Integument. Vol. 2. United States Department of Agriculture; 1972. p. 361.
13. Hemming FJ, Pays L, Soubeyran A, Larruat C, Saxod R. Development of sensory innervation in chick skin: comparison of nerve fibre and chondroitin sulphate distributions in vivo and in vitro. Cell and tissue research. 1994;277:519–529. [PubMed]
14. Von During M, Miller ML. In: Biology of the Reptilia. 9. Gans Carl., editor. Academic Press; 1979. pp. 407–441.
15. Chuong CM, Chodankar R, Widelitz RB, Jiang TX. Evo-devo of feathers and scales: building complex epithelial appendages. Curr Opin Genet Dev. 2000;10:449–456. [PubMed]
16. Wu P, et al. Evo-Devo of amniote integuments and appendages. Int J Dev Biol. 2004;48:249–270. [PubMed]
17. Chang C, et al. Reptile scale paradigm: Evo-Devo, pattern formation and regeneration. Int J Dev Biol. 2009;53:813–826. [PMC free article] [PubMed]
18. Mandai K, et al. LIG family receptor tyrosine kinase-associated proteins modulate growth factor signals during neural development. Neuron. 2009;63:614–627. [PMC free article] [PubMed]
19. Patel TD, Jackman A, Rice FL, Kucera J, Snider WD. Development of sensory neurons in the absence of NGF/TrkA signaling in vivo. Neuron. 2000;25:345–357. [PubMed]
20. Pearson JC, Lemons D, McGinnis W. Modulating Hox gene functions during animal body patterning. Nature reviews Genetics. 2005;6:893–904. [PubMed]
21. Tvrdik P, Capecchi MR. Reversal of Hox1 gene subfunctionalization in the mouse. Developmental cell. 2006;11:239–250. [PubMed]
22. Frohman MA, Martin GR. Isolation and analysis of embryonic expression of Hox-4.9, a member of the murine labial-like gene family. Mechanisms of development. 1992;38:55–67. [PubMed]
23. Kolm PJ, Sive HL. Regulation of the Xenopus labial homeodomain genes, HoxA1 and HoxD1: activation by retinoids and peptide growth factors. Developmental biology. 1995;167:34–49. [PubMed]
24. Liu Q, et al. Molecular genetic visualization of a rare subset of unmyelinated sensory neurons that may detect gentle touch. Nat Neurosci. 2007;10:946–948. [PubMed]
25. Saxod R. Handbook of Sensory Physiology. In: Jacobson M, editor. Development of Sensory Systems. IX. Springer-Verlag; 1978. p. 338.
26. Wall PD, Kerr BJ, Ramer MS. Primary afferent input to and receptive field properties of cells in rat lumbar area X. The Journal of comparative neurology. 2002;449:298–306. [PubMed]
27. Honda CN. Visceral and somatic afferent convergence onto neurons near the central canal in the sacral spinal cord of the cat. Journal of neurophysiology. 1985;53:1059–1078. [PubMed]
28. Nadelhaft I, Roppolo J, Morgan C, de Groat WC. Parasympathetic preganglionic neurons and visceral primary afferents in monkey sacral spinal cord revealed following application of horseradish peroxidase to pelvic nerve. The Journal of comparative neurology. 1983;216:36–52. [PubMed]
29. Chung K, Lee WT, Park MJ. Spinal projections of pelvic visceral afferents of the rat: a calcitonin gene-related peptide (CGRP) immunohistochemical study. The Journal of comparative neurology. 1993;337:63–69. [PubMed]
30. Martinez-Garcia F, Novejarque A, Landete JM, Moncho-Bogani J, Lanuza E. Distribution of calcitonin gene-related peptide-like immunoreactivity in the brain of the lizard Podarcis hispanica. J Comp Neurol. 2002;447:99–113. doi: 10.1002/cne.10200. [PubMed] [Cross Ref]
31. Werner T, Hammer A, Wahlbuhl M, Bosl MR, Wegner M. Multiple conserved regulatory elements with overlapping functions determine Sox10 expression in mouse embryogenesis. Nucleic acids research. 2007;35:6526–6538. [PMC free article] [PubMed]
32. Chen AI, de Nooij JC, Jessell TM. Graded activity of transcription factor Runx3 specifies the laminar termination pattern of sensory axons in the developing spinal cord. Neuron. 2006;49:395–408. [PubMed]
33. Kemp TS. The origin and evolution of mammals. Oxford University Press; 2005.
34. Kardong KV. Vertebrates: comparative anatomy, function, evolution. McGraw-Hill Higher Education; 2006.
35. Zanazzi A, Kohn MJ, MacFadden BJ, Terry DO. Large temperature drop across the Eocene-Oligocene transition in central North America. Nature. 2007;445:639–642. [PubMed]
36. Prothero DR, Berggren WA. Eocene-Oligocene Climatic and Biotic Evolution. Princeton Univ. Press; 1992.
37. Kim SJ, Qu Z, Milbrandt J, Zhuo M. A transcription factor for cold sensation! Mol Pain. 2005;1:11. [PMC free article] [PubMed]
38. Luo W, et al. A hierarchical NGF signaling cascade controls Ret-dependent and Ret-independent events during development of nonpeptidergic DRG neurons. Neuron. 2007;54:739–754. [PubMed]
39. Deppmann CD, et al. A model for neuronal competition during development. Science. 2008;320:369–373. [PMC free article] [PubMed]
40. Lonze BE, Riccio A, Cohen S, Ginty DD. Apoptosis, axonal growth defects, and degeneration of peripheral neurons in mice lacking CREB. Neuron. 2002;34:371–385. [PubMed]
41. Di-Poi N, Montoya-Burgos JI, Duboule D. Atypical relaxation of structural constraints in Hox gene clusters of the green anole lizard. Genome research. 2009;19:602–610. [PubMed]
42. Nakamura H, Funahashi J. Introduction of DNA into chick embryos by in ovo electroporation. Methods (San Diego, Calif) 2001;24:43–48. [PubMed]
43. Zhuang B, Su YS, Sockanathan S. FARP1 promotes the dendritic growth of spinal motor neuron subtypes through transmembrane Semaphorin6A and PlexinA4 signaling. Neuron. 2009;61:359–372. [PMC free article] [PubMed]
44. Liu Q, et al. Sensory neuron-specific GPCR Mrgprs are itch receptors mediating chloroquine-induced pruritus. Cell. 2009;139:1353–1365. [PMC free article] [PubMed]