PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
J Immunol. Author manuscript; available in PMC Oct 1, 2012.
Published in final edited form as:
PMCID: PMC3178710
NIHMSID: NIHMS315450
Low dose antigen promotes induction of FOXP3 in human CD4+ T cells
S. Alice Long,* Mary Rieck,* Megan Tatum,* Paul L. Bollyky,* Rebecca P. Wu,* Isabelle Muller,* Jhon-Chun Ho,* Heather G. Shilling,* and Jane H. Buckner*1
*Benaroya Research Institute at Virginia Mason, 1201 Ninth Avenue, Seattle Washington 98101 USA
1Correspondence should be addressed to Jane Buckner: Benaroya Research Institute at Virginia Mason, 1201 Ninth Avenue, Seattle Washington 98101: jbuckner/at/benaroyaresearch.org
Low antigen dose promotes induction and persistence of Treg in mice, yet few studies have addressed the role of antigen dose in the induction of adaptive CD4+FOXP3+ Treg in humans. To this end, we examined the level of FOXP3 expression in human CD4+CD25 T cells upon activation with autologous antigen presenting cells and varying doses of peptide. Antigen specific T cells expressing FOXP3 were identified by flow cytometry using MHC Class II tetramer (Tmr). We found an inverse relationship between antigen dose and the frequency of FOXP3+ cells for both foreign and self antigen specific T cells. Through studies of FOXP3 locus demethylation and helios expression, we determined that variation in the frequency of Tmr+FOXP3+ T cells was not due to expansion of natural Treg, but instead, we found that induction, proliferation and persistence of FOXP3+ cells was similar in high and low dose cultures whereas proliferation of FOXP3 T cells was favored in high antigen dose cultures. The frequency of FOXP3+ cells positively correlated with suppressive function, indicative of adaptive Treg generation. The frequency of FOXP3+ cells were maintained with IL-2, but not upon re-stimulation with antigen. Together, these data suggest that low antigen dose favors the transient generation of human antigen specific adaptive Treg over the proliferation of antigen specific FOXP3- effector T cells. These adaptive Treg could function to reduce ongoing inflammatory responses and promote low dose tolerance in humans, especially when antigen exposure and tolerance is transient.
Keywords: Human, FOXP3, Low dose, Tolerance/Suppression/Anergy, T cells
FOXP3+ regulatory T cells play a key role in peripheral tolerance to self antigens and control the magnitude of immune responses to foreign antigens. There are two major types of CD4+FOXP3+ regulatory T cells: those that are derived in the thymus (natural Treg, nTreg) and others that are generated in the periphery from CD25-FOXP3 T cells (adaptive Treg, aTreg)(1,2). nTreg and aTreg are phenotypically and functionally similar in that they express CD25hi, GITR, and CTLA-4 and function in a contact-dependent manner. However, they differ in the T cell receptor (TCR) signal strength, co-stimulatory and cytokine requirements for generation and expansion (3). Moreover, nTreg are thought to be a more stable cell subset (4) while aTreg have been described as a transient and/or less stable regulatory T cell subset. Stable nTreg are an IL-2-dependent cell type generated through relatively high affinity interactions with MHC and antigen in the thymus that requires CD28 co-stimulation. In contrast, TCR signaling and co-stimulatory requirements for IL-2- and TGFβ–dependent peripherally derived aTreg are not as well understood. Some reports suggest that activation in the presence of sub-optimal concentrations of antigen (511) or decreased Akt/mTOR signaling (1214) may promote aTreg generation. Two very recent reports demonstrated that sub-immunogenic activation determines aTreg generation through autonomous production of TGFβ following low TCR activation, not exposure to exogenous TGFβ from other cells suggesting a dominant role for TCR signal strength (15,16). Using a murine TCR Tg system, Gottschalk et.al. (11) demonstrated that generation of a persistent FoxP3+ aTreg population resulted when low doses of an agonist peptide were used to stimulate cells. Likewise, graded activation of murine OVA-specific T cells with antigen or anti-CD3 resulted in FoxP3 expression when antigen dose and Akt activation were limited (17). Overall, these studies suggest that the quality of TCR activation, in part, instructs generation of aTreg.
Immunization or exposure to tumor antigens in human subjects results in synchronous proliferation of memory T cells that contain subpopulations of memory FOXP3+ and FOXP3 T cells of similar antigen specificity (1820). Likewise, parallel proliferation of FOXP3+ and FOXP3 T cells occurs when mice are challenged with foreign antigen (21). These in vivo data suggest that both activated FOXP3 effector T cells and FOXP3+ aTreg may be generated upon antigenic exposure. Thus, it is important to understand the mechanisms that control this fate decision, specifically, the type of stimulation that results in the induction and persistence of FOXP3 expression. Sources of variation in TCR stimulation may include (1) level of TCR engagement that is influenced by both potency and density of the MHC-peptide-TCR interaction, (2) cytokine milieu (i.e. TGFβ and IL-6) and (3) antigen presenting cell (APC) maturation (2225). In fact, using altered peptide ligands and murine TCR Tg T cells it was found that both decreased potency and density of peptide favored FoxP3 expression upon activation (11). Understanding the factors that shift the ratio of effector and aTreg upon antigenic exposure in both mice and humans will be important for developing therapies that promote tolerance or immunity.
Low antigen dose promotes the induction and persistence of Treg in mice. Here, we address whether antigen dose influences the in vitro induction and persistence of FOXP3 in foreign and self antigen specific CD4 T cell populations using HLA Class II tetramers. We found that antigen dose, as opposed to TGFβ or bystander activation, had a dominant impact on the generation of functional human antigen specific aTreg. However, the frequency of FOXP3+ cells was reduced upon re-stimulation. This dose effect was observed with both foreign antigen and self antigen specific T cells. Together, these data suggest that low antigen dose favors the induction and proliferation of human antigen-specific FOXP3+ aTreg as opposed to FOXP3- effector T cells. Determining factors that promote the generation and persistence of self antigen specific FOXP3+ aTreg while reducing FOXP3 T cell proliferation may lead to development of antigen specific therapies that result in reduced immunogenicity and/or tolerance induction.
Human Subjects and mice
PBMC were derived from subjects participating in studies under the auspices of the BRI-JDRF Center for Translational Research registry. Informed consent was obtained from all subjects according to IRB approved protocols at Benaroya Research Institute, Seattle. Control participants were selected based on lack of personal or family history of autoimmunity or asthma. FoxP3-GFP C57BL/6 mice were a gift from Dr. A. Rudensky. All mice were maintained in a specific pathogen-free American Association for the Accreditation of Laboratory Animal Care-accredited animal facility at the Benaroya Research Institute and handled in accordance with institutional guidelines.
Cell preparation, culture and phenotyping
Fresh PBMC were prepared by centrifugation over Ficoll-Hyplaque gradients. CD4+ T cells were purified with a CD4+ no-touch T cell isolation kit (Miltenyi) followed by negative selection with Miltenyi CD25 microbeads. Autologous antigen presenting cells (APC) were obtained from the positive fraction of the CD4+ no-touch selection. FOXP3 expression in CD4+CD25 cells was 0.1–1.2%.
CD4+CD25 T cells were activated with peptide in the presence of irradiated (5000 rad) APC at a 1:2 ratio with 6 × 106 total cells/well in a 24 well plate. In some experiments, CD4 T cell subsets were sorted based on CCR7 and CD45RA expression from negatively isolated total CD4 cells prior to culture with irradiated APC and peptide. HLA DRB*0401 samples were activated with influenza hemagglutinin antigen (HA) (306–318), islet-specific glutamic acid decarboxylase (GAD)(555–567), glucose-6-phosphate catalytic subunit-related protein (IGRP)(247–259), Preproinsulin (PPI)(76–92(88K→S)) and tetanus toxin (TT)(674–693) peptides (2630). IL-2 (Chiron)(200 IU/ml) was added at day 7. Cells were cultured for 14 days, unless stated otherwise, and stained for expression of CD4, Tmr, FITC CD25 and Alexa®647 FOXP3 (BioLegend) as described previously (28). In some experiments, cells were co-stained with FITC helios (BioLegend) and in other experiments cells were co-stained with PE GITR or PerCP-Cy5.5 LAP from R&D Systems, PerCP-Cy5.5 PD-1 from BioLegend, or APC CTLA-4 or FITC CD103 from BD Biosciences. HLA DRB 0401 Tmr used for staining matched the specificity of the peptide used to stimulate the culture with the exception of GAD Tmr+ T cells where a Tmr loaded with 555–567I was used for detection as described previously (31). Positive Tmr staining was determined to be responses at least 0.2% and 4-fold greater than irrelevant control Tmr stains. FOXP3 isotype in conjunction with CD25 expression on activated T cells was used as FOXP3 staining controls as described previously (32) and shown in Supplemental Figure 1.
Co-staining for BrdU and FOXP3 was performed as described previously (14). Briefly, following over-night incubation with BrdU cells were fixed and permeabilized using the Biolegend FOXP3 fixation buffer and then the BD Cytofix/Cytoperm and BD Cytoperm Plus buffers. Permeabilized cells were treated with DNase for 1 hr at 37°C prior to staining with FITC anti-BrdU antibody. Co-staining for intracellular IL-10 was performed with BD CytoFix/Perm reagents per manufacturer’s instructions following 5 hours stimulation with PMA (50ng/ml) and ionomycin (1µg/ml) in the presence of 1nM GolgiStop. All phenotype data was acquired on a FACS Caliber and analyzed using FloJo 7.6 software.
Methylation analysis
All methylation analysis was performed on cells isolated from male donors. Genomic DNA was isolated by DNeasy Blood and Tissue Kit (Qiagen) and bisulfite converted using the EpiTect Bisulfite Kit (Qiagen) according to the manufacturers’ instructions. The TSDR (Treg cell-specific demethylated region) was amplified using bisulfite forward and reverse primers: Amp5A1F–TTTGGGGGTAGAGGATTTAGAG and Amp5A1R–CCACCTAAACCAAACCTACTACAA (modified from Baron, et al. (33)). The region of the FOXP3 promoter immediately upstream of the transcription start site was amplified using bisulfite forward and reverse primers: PROMF-GTGAAGTGGATTGATAGAAAAGGATTA and PROMR-CATTTAAATCTCATAATCAAAAAAAA. PCR was performed in 25µL containing 1 X PCR buffer, 1U ZymoTaq DNA polymerase (Zymo Research), bisulfite-converted genomic DNA, dNTP at a final concentration of 1mM, and forward and reverse primers at 1mM each. PCR conditions were: 95 C for 10 minutes, 35–40 cycles of 95 C for 30 sec, 55 C for 30 sec, and 72 C for 1 min, with a final extension at 72 C for 7 minutes. TSDR and promoter region PCR products were Exo-SAP purified (USB Corp) and subcloned using a TOPO TA Cloning Kit (Invitrogen), and the DNA from individual bacterial colonies were sequenced with M13 forward primer using Big Dye Terminator v1.1 chemistry (Applied Biosystems).
Functional Assays
For polyclonal assays, experiments were performed as described previously (34). In brief, autologous CD4+CD25 responder T cells were thawed, CFSE labelled and cultured in a round-bottom 96-well plate with or without CD25+ sorted Treg at a 1:4 ratio (Treg:responders) Cells were stimulated with M-280 Tosylactivated Dynabeads (Invitrogen), which were preincubated with anti-CD3 (5 µg/mL) and anti-CD28 (5 µg/mL). Beads were used at a ratio of 2:1 (beads:responder cells). Analysis was performed on day 4 by flow cytometry.
For antigen-specific assays, sorted Tmr+CD25hi cells (2.5 × 104), thawed CD4+CD25 cells (2.5 × 104) isolated from autologous PBMC, or both were incubated with irradiated APC (2.5 × 104), tetanus toxin (TT) and 5 µg/ml peptide antigen in a 96-well round-bottom plate as described previously (32,35). 1 µCi 3H thymidine was added during the final 16 hrs of a 6–7 day assay and proliferation was measured by a scintillation counter. All culture conditions were performed in triplicate. Percent inhibition was determined based on the percentage of dividing responders in the co-culture as compared to when cultured alone.
Statistics
For analysis of experiments comparing a single variable, statistical significance was analyzed using a two-sample student’s t-test unless otherwise noted. For analysis of multiple variables, a one way ANOVA was performed or linear regression as noted in the figure legends. Comparisons required a p value of <0.05 for the data to be significantly different.
Both level of TCR stimulation and TGFβ contribute to induction of FOXP3 expression
To dissect the relative contribution of antigen dose and cytokines on FOXP3 induction, we measured FoxP3 expression upon activation in the presence or absence of cytokines that promote FoxP3 expression in a well defined murine system where FoxP3 and GFP are genetically linked. As shown here and by others (36), in the absence of co-stimulation, TGFβ and IL-2 are required for FoxP3 expression in mice regardless of the level of TCR activation (Figure 1A). In the presence of TGFβ and IL-2, a greater percentage of murine GFP+FOXP3+ aTreg were generated from GFP FOXP3 T cells when stimulated with low concentrations of anti-CD3 antibody. Thus, both cytokines and the level of TCR engagement contribute to the expression of FOXP3 in mice and the impact of antigen dose can be observed in the presence of cytokines that promote FOXP3 expression suggesting a dominant effect of antigen dose, consistent with two very recent reports (15,16).
Figure 1
Figure 1
TGFβ and TCR both contribute to FOXP3 expression upon activation of CD4 T cells
In humans, addition of IL-2 and TGFβ augmented induction of polyclonal FOXP3+ cells through stimulation with anti-CD3/anti-CD28 coated beads in the absence of APC ((37) and data not shown). However, in cultures containing APC and soluble anti-CD3, addition of exogenous TGFβ did not alter the frequency of aTreg (Figure 1B) most likely due to TGFβ produced by or bound to the APC (38). To determine whether the FOXP3+ T cell populations induced in these cultures resemble aTreg or nTreg, we measured methylation of the FOXP3 locus and function of the sorted CD25+ populations. Demethylation at the promoter and Treg-cell specific demethylated region (TSDR) of the FOXP3 locus marks stable FOXP3+ nTreg, while human TGFβ- induced aTreg are only demethylated at the promoter region (33,39,40). Culture of CD4+CD25 T cells using anti-CD3 anti-CD28 beads resulted in effector cells that expressed little FOXP3 protein, while culture of the same cells with irradiated APC and soluble anti-CD3 antibody increased FOXP3 expression with a concomitant decrease in promoter methylation (Figure 1C). This pattern of FOXP3 protein expression and promoter demethylation are characteristic of aTreg (39). In fact, CD25+ cells sorted from the APC plus soluble anti-CD3 cultures were functionally suppressive while CD25+ cells from bead activated cultures were not (Figure 1D). Thus, we established an in vitro culture system using APC in which we can generate functional human CD4+CD25+FOXP3+ T cells and address the effects of antigen dose on the generation of this population.
Low antigen dose promotes an increased frequency of FOXP3+ cells in human influenza-specific CD4 T cells
CD4+CD25 T cells were stimulated with autologous irradiated APC and varying doses of peptide antigen of known affinity (28,29) as shown in Figure 2A. IL-2 was added on day 7 of culture to support T cell survival and proliferation. Induction of antigen specific FOXP3+ T cells was measured by flow cytometry for Tetramer (Tmr), CD25 and FOXP3 expression on day 14. When analyzing the frequency of FOXP3+ T cells within the HLA DRB*0401 hemagluttanin (HA) Tmr+ population on day14, the highest frequency of influenza antigen specific FOXP3+ cells was observed in the low HA antigen dose (0.1 µg/ml) culture as opposed to the high HA antigen dose (10 µg/ml) culture (Figure 2B). This increased frequency in FOXP3+ cells at lower antigen doses was consistently observed in multiple HLA DRB*0401 subjects stimulated with HA peptide (n=8)(Figure 2C). Comparable results were observed in HLA DRB*0301 and DRB*0404 subjects with influenza specific peptide stimulation (data not shown) demonstrating that the percent of FOXP3 expressing cells 14 days following activation is enhanced with low antigen dose. These data show that antigen dose can influence the relative frequency of in vitro induction and the persistence of FOXP3+ cells within the HA specific human CD4 T cell population.
Figure 2
Figure 2
Lower doses of antigen promote an increased frequency of FOXP3+ cells in influenza specific T cell populations
nTreg expansion does not contribute to the increased frequency of Tmr+FOXP3+ cells in low dose cultures
Both nTreg and aTreg are characterized by expression of FOXP3, yet differ in their affinity, expression of helios and demethylation (1,2). We used independent measures to determine whether low antigen dose promoted selective expansion of nTreg that cross-react and bind HLA DRB 0401 HA Tmr with a high affinity. Using Tmr MFI, a surrogate marker of TCR affinity, we found that FOXP3+ and FOXP3 T cells from low antigen dose cultures express similar levels of Tmr (Figure 3A) suggesting that the FOXP3+ T cells are not contained within a high affinity Treg sub-population. In addition, the frequency of bystander FOXP3+ Tmr T cells, a population likely to contain self-reactive nTreg, did not differ between cultures (Figure 3B). Last, we used molecular signatures of nTreg to confirm whether low antigen dose promoted selective expansion of nTreg in our culture system. Where enough cells could be obtained, we observed greater than 75% methylation of the TSDR in Tmr+CD25hi sorted populations regardless of antigen dose (n=2, data not shown), suggesting an absence of nTreg that are demethylated at the TSDR. Recently, helios expression was shown to be selectively expressed in FOXP3+ nTreg, but not aTreg or effector CD4+ T cells (41). CD4+CD25 T cells were cultured as shown in Figure 2A and single cell analysis was performed by flow cytometry for Tmr, FOXP3 and Helios expression on day 14. Consistent with data in Figure 2, activation of CD4+CD25 T cells with low dose peptide resulted in a higher frequency of FOXP3+ cells in the Tmr+ population as compared to high dose cultures (Figure 3C). The level of FOXP3 expression in the low antigen dose aTreg was less than that of nTreg in freshly isolated PBMC but higher than that of Tmr+FOXP3+ cells from high dose cultures (Supplemental Figure 2). However, helios expression was detected in neither the low nor high dose cultures while FOXP3hihelios+ cells were detected in CD4+ T cells of PBMC prior to activation and when CD25+ enriched T cells were activated in a similar manner with peptide and irradiated APC (Figure 3D), as shown previously by others (41,42). Together, these data support the hypothesis that activation with low antigen dose leads to induction of aTreg via do novo expression of FOXP3 in this in vitro culture system and not selective outgrowth of nTreg.
Figure 3
Figure 3
Low antigen dose does not preferentially expand human nTreg from CD4+CD25 T cells in vitro
Tmr+FOXP3+ cells arise upon activation of naïve and memory cells with high and low doses of antigen while high antigen dose selectively promotes FOXP3 T cell expansion
To address whether differences in the kinetics of activation explain dose-related variation in the frequency of FOXP3 expression in our culture system, we measured the frequency of FOXP3 in the Tmr+ population at earlier time-points in cultures where Tmr could be detected. Similar to analysis at day14, we observed a decrease in the frequency of FOXP3+ T cells within the Tmr+ population (Figure 4A). This is consistent with our previous observation that the frequency of FOXP3+ cells in the Tmr+ population for a single antigen dose was similar between day 10 and day 14 (32). We directly assessed the proliferation rate of FOXP3+ cells, a population containing Tmr+ cells, by measuring BrdU incorporation. Comparing the rate of proliferation of FOXP3+ T cells in low and high antigen dose cultures, we found no difference in the kinetics of FOXP3+ T cell proliferation (Figure 4B). Thus, increased frequency of FOXP3+ cells with low antigen dose was not due to delayed kinetics of FOXP3 expression upon activation.
Figure 4
Figure 4
FOXP3+ T cells generated in high and low dose cultures proliferate at equivalent rates
Equivalent proliferation rates of FOXP3+ cells in low and high antigen dose cultures suggest that differences in the frequency of FOXP3+ cells may occur through variation in FOXP3- T cell proliferation or death. To address this hypothesis, equal numbers of sorted naïve (CCR7+, CD45RO), central memory (CCR7+, CD45RO+) and effector memory (CCR7, CD45RO+) cells were stimulated with low (0.1 µg/ml) and high (10 µg/ml) doses of HA peptide. Universally, high dose cultures resulted in a greater absolute number of Tmr+ cells (Figure 4C) reflecting both the relative frequency and proliferative capacity of antigen-specific cells in each sorted population. When stratified by FOXP3 expression, the absolute number of FOXP3+ cells did not increase with antigen dose consistent with equivalent rates of proliferation observed with BrdU incorporation (Figure 4D). In contrast, the absolute number of FOXP3− T cells increased in high antigen dose cultures resulting in a lower frequency of Tmr+FOXP3+ T cells. Together, these data suggest that FOXP3+ cells originate primarily from memory cells following activation with all doses of antigen tested and a decreased frequency of HA-specific FOXP3+ T cells with high antigen dose results from increased proliferation of FOXP3− T cells.
Increased frequency of influenza specific FOXP3hi T cells in low antigen dose cultures correlates with suppressive function
Transient FOXP3 expression occurs upon activation of human CD4+CD25 T cells. Following transient activation, a subset of T cells retain FOXP3 expression and function as regulatory T cells (43). Previously, we demonstrated that stimulation of CD4+CD25 T cells for 14 days with a single dose of antigen resulted in an antigen-specific Tmr+CD25hi population that stably expressed FOXP3, while not co-expressing IFNγ. These cells functioned in an antigen specific manner and the potency of suppression correlated directly with the frequency of FOXP3+ T cells in the sorted Tmr+CD25hi population (32). Here, we tested whether FOXP3+ cells induced by stimulation with either low or high antigen dose function as regulatory T cells. We activated CD4+CD25 T cells isolated from the same subject with different doses of antigen, assessed FOXP3 and Tmr content on day14, sorted Tmr+CD25hi T cells and then measured inhibition of proliferation in an antigen specific manner as done previously (32,35). HA specific Tmr+CD25+ T cells were isolated from low (0.1 µg/ml) and high (10 µg/ml) antigen dose cultures and assessed for FOXP3 content as shown in Figure 5A. Sorted Tmr+CD25hi T cells were co-incubated with thawed, autologous CD4+CD25 T cells and activated with tetanus toxoid (TT) alone or in combination with HA, the antigen for which the CD25+Tmr+ cells were specific. In the absence of HA (TT alone cultures), addition of CD25+Tmr+ cells had no significant effect on proliferation, regardless of the dose of HA used to generated the sorted cells (Figure 5B). Addition of HA specific Tmr+CD25+ cells generated from both doses of antigen led to suppression of CD4+CD25 T cell proliferation in response to TT when HA was also present (TT+HA). As has been observed previously (32,35), TmrCD25 T cells sorted from the same cultures failed to suppress proliferation of autologous CD4+CD25 T cells stimulated with either TT alone or TT+HA while TmrCD25+ cells suppressed proliferation in response to both TT and TT+HA responses (data not shown). By titrating the concentration of aTreg relative to responders, we found that sorted CD25hi Tmr+ T cells generated with low antigen dose were more potent at all ratios tested (Figure 5C).
Figure 5
Figure 5
Increased frequency and expression of FOXP3 in low dose cultures correlates with increased suppressive function
Variation in function may be due to differences in the phenotype of Tmr+FOXP3+ cells generated with high and low doses of antigen and/or the FOXP3 content of CD25+Tmr+ cells. Comparing expression of known Treg markers in the Tmr+FOXP3+ population generated by stimulating CD4+CD25 T cells from the same subject with either high or low antigen dose, we found a subtle yet significant increase in FOXP3 expression and increased CTLA-4 expression in 3 of the 4 subjects studied in the low antigen dose cultures (Figure 5D). However, we found no difference in the expression levels of PD-1, CD39 or CD95 (Supplemental Figure 3A). We also found no difference between antigen doses in TGFβ (as measured by LAP expression) and IL-10 secretion (Figure 5D) consistent with the observation that sorted low dose aTreg function was contact dependent and was not inhibited by blocking antibodies against IL-10 and TGFβ (Supplemental Figure 4) as was found previously with high antigen dose aTreg (32). To examine whether the composition of the CD25+Tmr+ population contributed to function, we correlated FOXP3 content with suppression. Similar to previous studies in humans with both polyclonal and antigen specific stimulation of CD25+FOXP3+ T cells (14,32), the frequency of FOXP3+ cells in the sorted population directly correlated with the degree of inhibition of proliferation (Figure 5E). To determine whether culture with high and low antigen dose also altered the composition of cells as measured by cytokine profiles of Tmr+ cells as has been reported by others (44,45), we measured cytokine secretion upon re-stimulation in the Tmr+ cells but found no significant differences in the frequency of IFNγ, IL-17 or IL-5 secretion, representative cytokines secreted by Th1, Th17 and Th2 cells, respectively (Supplemental Figure 3B). Thus, antigen dose influences the frequency of FOXP3+ cells in the CD25 T cell population and expression of FOXP3. Both of these measures correlate with suppressive function of these antigen-specific aTreg.
FOXP3 expression in human islet antigen specific CD4 T cells is enhanced through stimulation with lower antigen dose
Variation in the induction of FOXP3 may be due to intrinsic factors, but also due to T cell extrinsic factors. To test whether the generation of antigen specific aTreg was influenced by cytokines induced through bystander activation, we performed mixed cultures with multiple different peptides known to stimulate Tmr+ populations. We found no difference in the frequency of HA-specific FOXP3+ cells when comparing cultures in which cells of other specificities were activated (as monitored by Tmr+ cells) to cultures stimulated only with HA peptide (data not shown). To test whether intrinsic factors may influence the frequency of FOXP3+ cells, we analyzed responses to well defined self antigen specific peptides (27,29). Self antigen specific T cells are generally low affinity cells and are less frequent in peripheral blood than foreign antigen specific cells (46,47). Thus, induction of FOXP3 expression with low doses of self antigen may differ from that of foreign antigen specific T cells. On average, 1.13 % (range 0.14 – 6.6 %) islet antigen specific T cells were detected in the CD4 T cell cultures (data not shown). Two representative HLA DRB*0404 islet specific Tmr and FOXP3 stains are shown in Figure 6A. When assessing multiple subjects (n=12) with two islet antigens, we observed a significant increase in the frequency of islet-specific FOXP3+Tmr+ T cells in low antigen dose (1 µg/ml) cultures as compared to higher antigen dose (50 µg/ml) cultures (Figure 6B). Together, these data suggest that lower antigen dose may promote an increased frequency of human antigen specific FOXP3+ T cells regardless of TCR specificity.
Figure 6
Figure 6
Lower doses of antigen favor an increased frequency of FOXP3+ cells in islet antigen specific T cells
Tmr+FOXP3+ aTreg frequencies were maintained with IL-2, but not upon re-stimulation with antigen
Recently, there has been greater appreciation for the plasticity of FOXP3+ populations which is influenced, in part, by the source of the FOXP3+ cells and the inflammatory milieu (48). To address the stability of antigen specific aTreg populations, we assessed the change in FOXP3 content of sorted aTreg following re-stimulation with low and high doses of antigen and with anti-CD3/anti-CD28 stimulation in a functional assay. Sorted low dose Tmr+CD25+ aTreg cultured with IL-2 alone maintained FOXP3 expression (Figure 7A). However, FOXP3 expression was not maintained upon re-stimulation of the same sorted cells with irradiated autologous APC and HA peptide, regardless of the dose of antigen used in the re-stimulation cultures. Polyclonal activation with anti-CD3/anti-CD28 coated beads also resulted in a loss of FOXP3+ cells (data not shown). Similarly, aTreg generated with either low (0.1 µg/ml) or high (10 µg/ml) doses of HA peptide lost FOXP3 expression when placed in a functional assay with autologous responder cells (Figure 7B). This suggests that higher frequencies of aTreg are not maintained upon in vitro re-stimulation with antigen while IL-2 alone maintains aTregs.
Figure 7
Figure 7
The frequency of FOXP3+ cells in aTreg is not maintained upon re-stimulation
Both effector T cells and FOXP3+ aTreg may be generated upon antigenic exposure. Thus, it is important to understand the mechanisms that promote aTreg generation as opposed to effector cells. We observed an inverse relationship between antigen dose and FOXP3 expression in human CD4 T cells activated with either foreign or self antigen, as has been shown recently in mice with foreign antigen (11,15,16). Using demethylation and helios expression, we established that low antigen dose did not preferentially expand nTreg in vitro from CD4+CD25 T cells, but instead, induced generation of functional FOXP3+ aTreg in which the frequency of FOXP3 expressing cells positively correlated with suppressive function. These Tmr+FOXP3+ cells proliferated equivalently with both low and high antigen dose. Yet, with high antigen dose stimulation, FOXP3 T cells proliferated to a greater extent resulting in a decreased frequency of FOXP3+ cells. Of note, the frequency of sorted HA-specific aTreg was maintained with IL-2 alone but not upon re-stimulation with antigen. Thus, the frequency of human aTreg may be one consequence of exposure to low doses of antigen thereby promoting poor immunogenicity and transient tolerance.
The potency and duration of peptide/MHC/TCR interaction can influence the nature of the CD4 T cell response, as is well documented with high and low dose antigen driving Th1 and Th2 responses, respectively (reviewed in (44,45)) and low antigen dose promoting Th17 cells (49) from naïve T cells. Less is known about the role of antigen dose on the induction, persistence and stability of FOXP3 expression in human aTreg. In mice, it has been shown that TCR engagement, co-stimulation, and cytokines may impact the induction and persistence of FOXP3 expression, required for generation of aTreg (8,11,13,1517). Here, we established a culture system in which we limit the impact of co-stimulation and non-T cell derived cytokines by holding the APC population constant for all doses of antigen tested for each subject. In addition, exogenous TGFβ was not required for FOXP3 expression, and thus, was not added to our cultures, as was also found by Turner et.al. using murine BDC2.5 TCR Tg T cells activated in the presence of dendritic cells (17). This lack of a requirement for TGFβ may be due to sufficient amounts of biologically active TGFβ produced by or bound to the APC (38,50). In comparison, stimulation with anti-CD3 anti-CD28 beads (Figure 1) induced far less FOXP3 expression. Whether this is due to the quality of the stimulation through the TCR or the absence of additional signals provided by the irradiated APC is not yet known. However, increasing frequencies of FOXP3+ cells occur in both murine (Figure 1 and (17)) and human CD4 T cells (51) early upon activation when low levels of anti-CD3 are used to activate the cells. Likewise, in our antigen specific culture system, we found that the rate of proliferation of FOXP3+ cells did not differ between antigen doses suggesting that aTreg are a population of cells in which FOXP3 expression is induced upon activation with high and low antigen dose and this population persists. Decreased frequency of FOXP3+ cells in high antigen dose cultures occurred due to preferential activation and proliferation of FOXP3− T cells with high antigen dose. Together, these data suggest that the quality of the TCR signal may contribute to the frequency of antigen specific aTreg.
We and others (32,52) have demonstrated that functional self antigen-specific aTreg can be generated from CD4+CD25 T cells in vitro. Here, we further demonstrate that an increased frequency of islet specific FOXP3+ T cells was generated in vitro with low antigen dose (1 µg/ml) as compared to high antigen dose (50 µg/ml). This suggests that generation of a greater frequency of FOXP3+Tmr+ cells is an inherent consequence of all human CD4 T cells activated with lower concentrations of antigen, not just high affinity foreign antigen specific T cells. Interestingly, higher concentrations of self peptide as compared to foreign peptide were required to detect low affinity self antigen specific aTreg (1 µg/ml GAD vs 0.1 µg/ml HA) consistent with both potency and density of peptide impacting the percentage of FOXP3+ cells in a population as has been shown by others in a mouse model (11). Together, these data demonstrate that exposure to limited, but detectable, foreign or self antigen may influence the frequency of FOXP3+ cells in human CD4 T cells.
In humans, the plasticity of some FOXP3+ populations is highlighted by the kinetics of FOXP3 expression in different cell subsets: FOXP3 expression is constitutively expressed in nTreg cells, is induced in aTreg and is transiently expressed in activated T cells (2,53). In our antigen specific cultures, FOXP3 expression was induced and maintained with similar kinetics in low and high dose cultures indicative of an aTreg subset and the frequency of FOXP3+ cells remained stable upon further exposure to IL-2 (Figure 7) – both characteristics of aTreg. However, upon re-stimulation through the TCR the frequency of aTreg decreased. While some of the loss in FOXP3 content may occur through activation induced cell death of FOXP3+ cells, in all experiments the number of cells recovered following activation far exceeded the number of FOXP3− cells in the sorted populations (data not shown) suggesting that some FOXP3+ cells may have lost FOXP3 expression and represent a plastic cell population. In this experiment, FOXP3 T cells could have preferentially proliferated upon re-stimulation, thereby resulting in a decreased frequency of FOXP3+ cells on a population level. However, the frequency of FOXP3+ cells was similar following re-stimulation with low and high antigen doses. Whether re-stimulation in vitro with low dose antigen is a potent enough stimuli to result in enhanced proliferation of FOXP3 cells observed upon primary stimulation exclusively in the high antigen dose culture or other mechanisms are involved, to date, is not known. Lastly, addition of IL-2 to these re-stimulation cultures or on-going production of high levels of IL-2 in vivo may result in maintenance of these aTreg cells even following TCR ligation, as shown in a murine adoptive transfer model (54). We clearly demonstrated that nTreg were not expanded in our culture system. Thus, while our data does not exclude the involvement of nTreg in low dose tolerance in vivo, it does strongly suggest that antigen dose influences the frequency of aTreg generation in vitro and human antigen specific aTreg could play an effective role in low dose tolerance. This may especially be evident clinically when low dose tolerance is transient.
Persistent expression of FOXP3 is associated with suppressive function and increased demethylation of the FOXP3 promotor region (4,10,32,55,56), while transient and lower expression of FOXP3 upon activation is not (53). In our cultures, we found that the frequency of FOXP3+ cells in the Tmr+ population positively correlated with suppressive function, resulting in greater suppression by CD25hi Tmr+ cells sorted from low antigen dose cultures where FOXP3 content and level of expression was increased. Interestingly, the frequency of FOXP3+ cells correlated with function for both low and high dose aTreg even though the level of expression of FOXP3 was higher in the low antigen dose aTreg, a phenotype typical of more potent Treg. Moreover, even though high antigen dose aTreg expressed lower levels of FOXP3, a phenotype associated with unstable FOXP3 expression in activated effector cells, cytokine production was similar between high and low antigen dose aTreg. Together, these data suggest that the level of expression of FOXP3 in antigen specific human aTreg does not significantly impinge upon their suppressive function. This is in contrast to others’ culture systems in which cells were activated with anti-CD3 and anti-CD28 antibodies and/or assayed earlier in culture for suppressive function and a lack of suppression was observed (51,57,58). Together, these data suggest that stimulation with low antigen dose in APC/peptide cultures results in an increased frequency of functional Tmr+ aTreg in which FOXP3 expression persists and is associated with suppression.
Differentiation of FOXP3+ T cells from naïve T cell subsets is well-established. Here, we demonstrate that FOXP3+Tmr+ T cells can arise from naïve, central memory and effector memory CD4 T cell subsets. This may be particularly important in providing a mechanism to control the magnitude of memory responses when antigen is limited. We propose a model in which a high frequency of FOXP3+ cells induced with low antigen limits perpetuation of immune responses by transiently suppressing proliferation of other cells responding to the same antigen. In contrast, activation with high antigen dose results in a greater frequency of FOXP3 cells which could overwhelm the suppressive effects of the FOXP3+ cells resulting in immunogenic responses to antigen. Hence, FOXP3 expression upon activation may function to place a transient brake on low antigen dose immune responses while not limiting the magnitude of future immune responses to higher doses of the same antigen. These studies further suggest that aTreg could play a role in low dose tolerance in vivo.
Supplementary Material
ACKNOWLEDGEMENTS
We wish to thank Dr. John Gebe and Dr. Michael Turner for insightful discussions and critical reading of the manuscript and the investigators and staff of the BRI-JDRF Center for Translational Research, the Children’s Hospital and Regional Medical Center, Seattle and the BRI Diabetes Clinical Research Program for subject recruitment as well as the BRI Translational Research Clinical Core for sample processing and handling.
This work was supported by grants from the NIH (DK07245 to JHB, DK080178 to PLB) and the JDRF (The Center for Translational Research at BRI and the Center for Collaborative Cellular Therapy).
Abbreviations
aTregadaptive regulatory T cell
nTregnatural regulatory T cell
GADGlutamic acid decarboxylase
IGRPislet-specific glucose-6-phosphate catalytic subunit-related protein
HAHemagglutinin
TmrTetramer
TSDRTreg cell-specific demethylated region

Footnotes
The authors have no financial or commercial conflicts of interest.
1. Bluestone JA, Abbas AK. Natural versus adaptive regulatory T cells. Nat. Rev. Immunol. 2003;3:253–257. [PubMed]
2. Curotto de Lafaille MA, Lafaille JJ. Natural and adaptive foxp3+ regulatory T cells: more of the same or a division of labor? Immunity. 2009;30:626–635. [PubMed]
3. Horwitz DA, Zheng SG, Gray JD. Natural and TGF-beta-induced Foxp3(+)CD4(+) CD25(+) regulatory T cells are not mirror images of each other. Trends Immunol. 2008;29:429–435. [PubMed]
4. Rubtsov YP, Niec RE, Josefowicz S, Li L, Darce J, Mathis D, Benoist C, Rudensky AY. Stability of the regulatory T cell lineage in vivo. Science. 2010;329:1667–1671. [PubMed]
5. Kang HK, Michaels MA, Berner BR, Datta SK. Very low-dose tolerance with nucleosomal peptides controls lupus and induces potent regulatory T cell subsets. J. Immunol. 2005;174:3247–3255. [PubMed]
6. Kretschmer K, Apostolou I, Hawiger D, Khazaie K, Nussenzweig MC, Von Boehmer H. Inducing and expanding regulatory T cell populations by foreign antigen. Nat. Immunol. 2005;6:1219–1227. [PubMed]
7. Chen TC, Cobbold SP, Fairchild PJ, Waldmann H. Generation of anergic and regulatory T cells following prolonged exposure to a harmless antigen. J. Immunol. 2004;172:5900–5907. [PubMed]
8. Graca L, Chen TC, Le Moine A, Cobbold SP, Howie D, Waldmann H. Dominant tolerance: activation thresholds for peripheral generation of regulatory T cells. Trends Immunol. 2005;26:130–135. [PubMed]
9. Kang J, Huddleston SJ, Fraser JM, Khoruts A. De novo induction of antigen-specific CD4+CD25+Foxp3+ regulatory T cells in vivo following systemic antigen administration accompanied by blockade of mTOR. J. Leukoc. Biol. 2008;83:1230–1239. [PubMed]
10. Mahic M, Yaqub S, Bryn T, Henjum K, Eide DM, Torgersen KM, Aandahl EM, Tasken K. Differentiation of naive CD4+ T cells into CD4+CD25+FOXP3+ regulatory T cells by continuous antigen stimulation. J. Leukoc. Biol. 2008;83:1111–1117. [PubMed]
11. Gottschalk RA, Corse E, Allison JP. TCR ligand density and affinity determine peripheral induction of Foxp3 in vivo. J. Exp. Med. 2010;207:1701–1711. [PMC free article] [PubMed]
12. Haxhinasto S, Mathis D, Benoist C. The AKT-mTOR axis regulates de novo differentiation of CD4+Foxp3+ cells. J. Exp. Med. 2008;205:565–574. [PMC free article] [PubMed]
13. Sauer S, Bruno L, Hertweck A, Finlay D, Leleu M, Spivakov M, Knight ZA, Cobb BS, Cantrell D, O'Connor E, Shokat KM, Fisher AG, Merkenschlager M. T cell receptor signaling controls Foxp3 expression via PI3K, Akt, and mTOR. Proc. Natl. Acad. Sci. U. S. A. 2008;105:7797–7802. [PubMed]
14. Long SA, Buckner JH. Combination of rapamycin and IL-2 increases de novo induction of human CD4(+)CD25(+)FOXP3(+) T cells. J. Autoimmun. 2008;30:293–302. [PMC free article] [PubMed]
15. Gabrysova L, Christensen JR, Wu X, Kissenpfennig A, Malissen B, O'Garra A. Integrated T-cell receptor and costimulatory signals determine TGF-beta-dependent differentiation and maintenance of Foxp3(+) regulatory T cells. Eur. J. Immunol. 2011;41:1242–1248. [PubMed]
16. Oliveira VG, Caridade M, Paiva RS, Demengeot J, Graca L. Sub-optimal CD4(+) T-cell activation triggers autonomous TGF-beta-dependent conversion to Foxp3(+) regulatory T cells. Eur. J. Immunol. 2011;41:1249–1255. [PubMed]
17. Turner MS, Kane LP, Morel PA. Dominant role of antigen dose in CD4+Foxp3+ regulatory T cell induction and expansion. J. Immunol. 2009;183:4895–4903. [PMC free article] [PubMed]
18. Fourcade J, Sun Z, Kudela P, Janjic B, Kirkwood JM, El-Hafnawy T, Zarour HM. Human tumor antigen-specific helper and regulatory T cells share common epitope specificity but exhibit distinct T cell repertoire. J. Immunol. 2010;184:6709–6718. [PubMed]
19. Vukmanovic-Stejic M, Zhang Y, Cook JE, Fletcher JM, McQuaid A, Masters JE, Rustin MH, Taams LS, Beverley PC, Macallan DC, Akbar AN. Human CD4+ CD25hi Foxp3+ regulatory T cells are derived by rapid turnover of memory populations in vivo. J. Clin. Invest. 2006;116:2423–2433. [PMC free article] [PubMed]
20. Mittag D, Scholzen A, Varese N, Baxter L, Paukovics G, Harrison LC, Rolland JM, O'Hehir RE. The effector T cell response to ryegrass pollen is counterregulated by simultaneous induction of regulatory T cells. J. Immunol. 2010;184:4708–4716. [PubMed]
21. Taylor JJ, Mohrs M, Pearce EJ. Regulatory T cell responses develop in parallel to Th responses and control the magnitude and phenotype of the Th effector population. J. Immunol. 2006;176:5839–5847. [PubMed]
22. Roncarolo MG, Levings MK, Traversari C. Differentiation of T regulatory cells by immature dendritic cells. J. Exp. Med. 2001;193:F5–F9. [PMC free article] [PubMed]
23. Tarbell KV, Petit L, Zuo X, Toy P, Luo X, Mqadmi A, Yang H, Suthanthiran M, Mojsov S, Steinman RM. Dendritic cell-expanded, islet-specific CD4+ CD25+ CD62L+ regulatory T cells restore normoglycemia in diabetic NOD mice. J. Exp. Med. 2007;204:191–201. [PMC free article] [PubMed]
24. Zheng SG, Wang J, Wang P, Gray JD, Horwitz DA. IL-2 is essential for TGF-beta to convert naive CD4+ J. Immunol. 2007;178:2018–2027. [PubMed]
25. Huang H, Dawicki W, Zhang X, Town J, Gordon JR. Tolerogenic Dendritic Cells Induce CD4+CD25hiFoxp3+ Regulatory T Cell Differentiation from CD4+CD25−/loFoxp3- Effector T Cells. J. Immunol. 2010;185:5003–5010. [PubMed]
26. James EA, Bui J, Berger D, Huston L, Roti M, Kwok WW. Tetramer-guided epitope mapping reveals broad, individualized repertoires of tetanus toxin-specific CD4+ T cells and suggests HLA-based differences in epitope recognition. Int. Immunol. 2007;19:1291–1301. [PubMed]
27. Masewicz SA, Papadopoulos GK, Swanson E, Moriarity L, Moustakas AK, Nepom GT. Modulation of T cell response to hGAD65 peptide epitopes. Tissue Antigens. 2002;59:101–112. [PubMed]
28. Novak EJ, Liu AW, Nepom GT, Kwok WW. MHC class II tetramers identify peptide-specific human CD4(+) T cells proliferating in response to influenza A antigen. J. Clin. Invest. 1999;104:R63–R67. [PMC free article] [PubMed]
29. Yang J, James EA, Huston L, Danke NA, Liu AW, Kwok WW. Multiplex mapping of CD4 T cell epitopes using class II tetramers. Clin. Immunol. 2006;120:21–32. [PubMed]
30. Yang J, Danke NA, Berger D, Reichstetter S, Reijonen H, Greenbaum C, Pihoker C, James EA, Kwok WW. Islet-specific glucose-6-phosphatase catalytic subunit-related protein-reactive CD4+ T cells in human subjects. J. Immunol. 2006;176:2781–2789. [PubMed]
31. Danke NA, Koelle DM, Yee C, Beheray S, Kwok WW. Autoreactive T cells in healthy individuals. J. Immunol. 2004;172:5967–5972. [PubMed]
32. Long SA, Walker MR, Rieck M, James E, Kwok WW, Sanda S, Pihoker C, Greenbaum C, Nepom GT, Buckner JH. Functional islet-specific Treg can be generated from CD4(+)CD25(−) T cells of healthy and type 1 diabetic subjects. Eur. J. Immunol. 2009;39:612–620. [PMC free article] [PubMed]
33. Baron U, Floess S, Wieczorek G, Baumann K, Grutzkau A, Dong J, Thiel A, Boeld TJ, Hoffmann P, Edinger M, Turbachova I, Hamann A, Olek S, Huehn J. DNA demethylation in the human FOXP3 locus discriminates regulatory T cells from activated FOXP3(+) conventional T cells. Eur. J. Immunol. 2007;37:2378–2389. [PubMed]
34. Schneider A, Rieck M, Sanda S, Pihoker C, Greenbaum C, Buckner JH. The effector T cells of diabetic subjects are resistant to regulation via CD4+ FOXP3+ regulatory T cells. J. Immunol. 2008;181:7350–7355. [PMC free article] [PubMed]
35. Walker MR, Carson BD, Nepom GT, Ziegler SF, Buckner JH. De novo generation of antigen-specific CD4+CD25+ regulatory T cells from human CD4+CD25− T cells. Proc. Natl. Acad. Sci. U. S. A. 2005;102:4103–4108. [PubMed]
36. Davidson TS, DiPaolo RJ, Andersson J, Shevach EM. Cutting Edge: IL-2 is essential for TGF-beta-mediated induction of Foxp3+ T regulatory cells. J. Immunol. 2007;178:4022–4026. [PubMed]
37. Horwitz DA, Zheng SG, Wang J, Gray JD. Critical role of IL-2 and TGF-beta in generation, function and stabilization of Foxp3+CD4+ Treg. Eur. J. Immunol. 2008;38:912–915. [PubMed]
38. Li MO, Flavell RA. Contextual regulation of inflammation: a duet by transforming growth factor-beta and interleukin-10. Immunity. 2008;28:468–476. [PubMed]
39. Janson PC, Winerdal ME, Marits P, Thorn M, Ohlsson R, Winqvist O. FOXP3 Promoter Demethylation Reveals the Committed Treg Population in Humans. PLoS. ONE. 2008;3:e1612. [PMC free article] [PubMed]
40. Huehn J, Polansky JK, Hamann A. Epigenetic control of FOXP3 expression: the key to a stable regulatory T-cell lineage? Nat. Rev. Immunol. 2009;9:83–89. [PubMed]
41. Thornton AM, Korty PE, Tran DQ, Wohlfert EA, Murray PE, Belkaid Y, Shevach EM. Expression of Helios, an Ikaros transcription factor family member, differentiates thymic-derived from peripherally induced Foxp3+ T regulatory cells. J. Immunol. 2010;184:3433–3441. [PubMed]
42. McClymont SA, Putnam AL, Lee MR, Esensten JH, Liu W, Hulme MA, Hoffmuller U, Baron U, Olek S, Bluestone JA, Brusko TM. Plasticity of human regulatory T cells in healthy subjects and patients with type 1 diabetes. J. Immunol. 2011;186:3918–3926. [PMC free article] [PubMed]
43. Buckner JH, Ziegler SF. Functional analysis of FOXP3. Ann. N. Y. Acad. Sci. 2008;1143:151–169. [PubMed]
44. Constant SL, Bottomly K. Induction of Th1 and Th2 CD4+ T cell responses: the alternative approaches. Annu. Rev. Immunol. 1997;15:297–322. [PubMed]
45. Sundrud MS, Nolan MA. Synergistic and combinatorial control of T cell activation and differentiation by transcription factors. Curr. Opin. Immunol. 2010;22:286–292. [PubMed]
46. Gebe JA, Falk BA, Rock KA, Kochik SA, Heninger AK, Reijonen H, Kwok WW, Nepom GT. Low-avidity recognition by CD4+ T cells directed to self-antigens. Eur. J. Immunol. 2003;33:1409–1417. [PubMed]
47. Mallone R, Kochik SA, Laughlin EM, Gersuk VH, Reijonen H, Kwok WW, Nepom GT. Differential recognition and activation thresholds in human autoreactive GAD-specific T-cells. Diabetes. 2004;53:971–977. [PubMed]
48. Hori S. Regulatory T cell plasticity: beyond the controversies. Trends Immunol. 2011 [PubMed]
49. Purvis HA, Stoop JN, Mann J, Woods S, Kozijn AE, Hambleton S, Robinson JH, Isaacs JD, Anderson AE, Hilkens CM. Low-strength T-cell activation promotes Th17 responses. Blood. 2010;116:4829–4837. [PubMed]
50. Li MO, Wan YY, Sanjabi S, Robertson AK, Flavell RA. Transforming growth factor-beta regulation of immune responses. Annu. Rev. Immunol. 2006;24:99–146. [PubMed]
51. Noel G, Brinster C, Semana G, Bruniquel D. Modulation of the TCR stimulation strength can render human activated CD4+ T cells suppressive. Int. Immunol. 2009;21:1025–1036. [PubMed]
52. Zhang XL, Peng J, Sun JZ, Liu JJ, Guo CS, Wang ZG, Yu Y, Shi Y, Qin P, Li SG, Zhang LN, Hou M. De novo induction of platelet-specific CD4(+)CD25(+) regulatory T cells from CD4(+)CD25(−) cells in patients with idiopathic thrombocytopenic purpura. Blood. 2009;113:2568–2577. [PubMed]
53. Ziegler SF. FOXP3: not just for regulatory T cells anymore. Eur. J. Immunol. 2007;37:21–23. [PubMed]
54. Chen Q, Kim YC, Laurence A, Punkosdy GA, Shevach EM. IL-2 Controls the Stability of Foxp3 Expression in TGF-{beta}-Induced Foxp3+ T Cells In Vivo. J. Immunol. 2011;186:6329–6337. [PMC free article] [PubMed]
55. Josefowicz SZ, Wilson CB, Rudensky AY. Cutting edge: TCR stimulation is sufficient for induction of Foxp3 expression in the absence of DNA methyltransferase 1. J. Immunol. 2009;182:6648–6652. [PubMed]
56. Zheng Y, Josefowicz S, Chaudhry A, Peng XP, Forbush K, Rudensky AY. Role of conserved non-coding DNA elements in the Foxp3 gene in regulatory T-cell fate. Nature. 2010;463:808–812. [PMC free article] [PubMed]
57. Allan SE, Crome SQ, Crellin NK, Passerini L, Steiner TS, Bacchetta R, Roncarolo MG, Levings MK. Activation-induced FOXP3 in human T effector cells does not suppress proliferation or cytokine production. Int. Immunol. 2007;19:345–354. [PubMed]
58. Wang J, Ioan-Facsinay A, van der Voort EI, Huizinga TW, Toes RE. Transient expression of FOXP3 in human activated nonregulatory CD4(+) T cells. Eur. J. Immunol. 2007;37:129–138. [PubMed]