PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Stem Cells. Author manuscript; available in PMC 2011 September 15.
Published in final edited form as:
PMCID: PMC3174105
NIHMSID: NIHMS185367
Human Amniotic Fluid Stem Cells Can Integrate and Differentiate into Epithelial Lung Lineages
Gianni Carraro,a Laura Perin,a Sargis Sedrakyan,a Stefano Giuliani,a Caterina Tiozzo,b Jooeun Lee,a Gianluca Turcatel,a Stijn P. De Langhe,a Barbara Driscoll,a Saverio Bellusci,a Parviz Minoo,b Anthony Atala,c Roger Edward De Filippo,a and David Warburtona
aDevelopmental Biology, Regenerative Medicine and Surgery Program, Saban Research Institute, Children's Hospital Los Angeles, Keck School of Medicine and School of Dentistry, Los Angeles, California, USA
bWomen's & Children's Hospital, Keck School of Medicine, University of Southern California, Los Angeles, California
cWake Forest Institute for Regenerative Medicine, Wake Forest University School of Medicine, Winston-Salem, North Carolina
Correspondence: David Warburton, DSc, M.D., FRCP, FRCS, Developmental Biology, Regenerative Medicine and Surgery Program, Saban Research Institute, Children's Hospital Los Angeles, Keck School of Medicine and School of Dentistry, 4661 Sunset Boulevard MS 35, Los Angeles, California 90027, USA. Telephone: 323-669-5422; Fax: 323-671-3613; dwarburton/at/chla.usc.edu
A new source of stem cells has recently been isolated from amniotic fluid; these amniotic fluid stem cells have significant potential for regenerative medicine. These cells are multipotent, showing the ability to differentiate into cell types from each embryonic germ layer. We investigated the ability of human amniotic fluid stem cells (hAFSC) to integrate into murine lung and to differentiate into pulmonary lineages after injury. Using microinjection into cultured mouse embryonic lungs, hAFSC can integrate into the epithelium and express the early human differentiation marker thyroid transcription factor 1 (TTF1). In adult nude mice, following hyperoxia injury, tail vein-injected hAFSC localized in the distal lung and expressed both TTF1 and the type II pneumocyte marker surfactant protein C. Specific damage of Clara cells through naphthalene injury produced integration and differentiation of hAFSC at the bronchioalveolar and bronchial positions with expression of the specific Clara cell 10-kDa protein. These results illustrate the plasticity of hAFSC to respond in different ways to different types of lung damage by expressing specific alveolar versus bronchiolar epithelial cell lineage markers, depending on the type of injury to recipient lung.
Keywords: Amniotic fluid stem cells, Lung injury, Tissue repair, Regenerative medicine
Stem cells have the potential to contribute to the self-renewal and repair of the lung [1]. The existence of endogenous adult stem/progenitor cells has been reported in various key regions of the lung. Proximal airways contain basal cells capable of maintaining cellular turnover [2]. In contrast, the distal bronchioalveolar compartment does not contain basal cells, but at least two different kinds of progenitor cells have been identified: a variant of Clara cells [3] that lie adjacent to neuroendocrine bodies, and bronchioalveolar stem cells [4] located at the bronchioalveolar duct junction [5]. However, the potential ability of these endogenous stem/progenitor cells to repair injured lung is clearly limited when the injury is severe enough to cause irreversible respiratory failure.
Exogenous stem cells have a feasible potential to be used as cellular therapy to contribute to or supplement endogenous lung repair mechanisms. Bone marrow-derived stem cells expressing green fluorescence protein can populate both proximal and distal lung airway in an irradiated mouse [6]. Embryonic stem cells have also been used to produce epithelial lung lineages in vivo and in culture [7, 8].
Recently, a new source of human amniotic fluid stem cells (hAFSC) has been isolated [9]. These cells represent 1% of the population of cells obtained from amniocentesis and are characterized by the expression of the receptor for stem cell factor c-Kit. hAFSC are multipotent, showing the ability to differentiate into lineages belonging to all three germ layers, and can be propagated easily in vitro without the need of a feeder layer. hAFSC express the markers OCT4 and SSEA-4, both of which are typical of the undifferentiated state of embryonic stem cells (ESC). However, hAFSC do not express some of the other typical markers of ESC, such as SSEA-3, and instead express mesenchymal and neuronal stem cell markers (CD29, CD44, CD73, CD90, and CD105) that are normally not expressed in ESC. Amniotic fluid stem cells (AFSC) are also negative for hematopoietic stem cell markers (CD45, CD34, and CD133). Therefore, hAFSC can be considered as an intermediate type of stem or progenitor cell between ESC and adult stem cells resident in differentiated organs. De Coppi et al. [19] reported that hAFSC can be encouraged to differentiate into specialized functional populations, such as neural, hepatic, and osteogenic lineages. However, it is not known whether hAFSC have the ability to participate in lung development or repair after injury. Herein we show that hAFSC can integrate into developing as well as injured lung tissues and differentiate therein into lung epithelial lineages.
Isolation, Culture, and Labeling of hAFSC
Samples of human amniotic fluid from male fetuses (12–18-week gestation) were provided by Genzyme Genetics Corporation (Monrovia, CA, http://www.genzymegenetics.com). The stem cell population was isolated using magnetic-activated cell sorting (Miltenyi Biotec, Auburn, CA, http://www.miltenyibiotec.com) against the cell surface marker c-kit. Pluripotential characteristics of the clonal and subclonal groups were tested according to published protocols [9]. Clones were cultured in Petri dishes in medium containing α-minimal essential medium supplemented with 20% Chang B and 2% Chang C solutions, 20% fetal bovine serum (FBS), 1% L-glutamine, and 1% antibiotics (Gibco-BRL, Rockville, MD, http://www.gibcobrl.com). Clonal hAFSC populations were labeled with the fluorescent cell surface marker chloromethylbenzamide-1,1′-diactaolecyl-3,3,3′,3′-tetramethylindocarbocyanine perchlorate (CM-Dil) (Invitrogen, Carlsbad, CA, http://probes.invitrogen.com) to track the cells during and after injection. Briefly, the cells were incubated with a working solution of CM-Dil at 1 mg/ml for 5 minutes at 37°C, followed by incubation for 15 minutes at 4°C, followed by three washes with phosphate-buffered saline (PBS).
Organ Culture and Microinjection
hAFSC were trypsinized, and 104 cells were loaded into a 15-μm diameter transfer tip (Eppendorf AG, Hamburg, Germany, http://www.eppendorf.com), guided by a micromanipulator (TransferMan NK2; Eppendorf) and a CellTram Oil injector (Eppendorf). Embryonic mouse lungs were explanted at day 11.5 of gestation (E11.5). Immediately before injection, lungs were placed on a polyethylene-terephthalate track-etched membrane (Sterlitech Corp., Kent, WA, http://www.sterlitech.com) and microinjected through the trachea. Directly after microinjection, the lungs were placed on 8-μm pore filters (VWR, Marietta, GA, http://www.vwrsp.com); laid on the surface of 800 μl of Dulbecco's modified Eagle's medium (DMEM)/Ham's F-12 medium (F12) containing 10% FBS, 50 units/ml penicillin, and 50 μg/ml streptomycin; placed in a 37°C incubator; humidified; and kept at 7% CO2 for 2–10 days. For each time point, four embryonic lungs were injected and placed on the same filter. Each time point was repeated al least in triplicate.
Injuries and Cell Administration
A sex-mismatched model was used for all of our experiments in which hAFSC derived from male donors were administered to female nude mice. For the hyperoxia treatment, mice were exposed to short-term hyperoxia, as described previously. Briefly, mice were placed in a 90 × 42 × 38-cm Plexiglas chamber and exposed to humidified ≥99% oxygen for 72 hours (Terra Universal, Fullerton, CA, http://www.terrauniversal.com). Control mice were kept in room air during the treatment period. For the tail vein injection, ~106 hAFSC were prepared in sterile PBS, and the injection was performed with a sterile 28-G½ insulin syringe. Six mice were used to generate data for each time point and each experimental condition. Mice exposed to hyperoxia were sacrificed after 1 week, 15 days, or 40 days, respectively. Control mice were also sacrificed after 1 week, 15 days, or 40 days.
Naphthalene (Sigma-Aldrich, St. Louis, http://www.sigmaaldrich.com) was dissolved to 30 mg/ml in corn oil (Sigma-Aldrich) and administered at 275 mg/kg. Nude mice, 3 months old (Jackson Laboratories), were given naphthalene or corn oil alone by intraperitoneal injection. Mice were housed in plastic cages on a 12-hour light/12-hour dark cycle with food and water ad libitum. Four mice were used to generate data for each time point and each experimental condition. Mice exposed to naphthalene were sacrificed after 1 week, 15 days, or 40 days. Control mice were also sacrificed after 1 week, 15 days, or 40 days.
For intratracheal instillation of hAFSC, mice were anesthetized with 5% isoflurane. After incision with a scalpel, trachea was visualized by depressing muscle tissue, and 2.5 × 105 hAFSC were injected. Mice were left in a prewarmed cage for recovery. Motrin (McNeil CHI, Fort Washington, PA, http://www.motrin.com) was added to drinking water. Three mice were used to generate data for each time point and each experimental condition. Mice exposed to naphthalene were sacrificed after 1 week, 15 days, or 40 days. Control mice were also sacrificed after 1 week, 15 days, or 40 days. For both naphthalene and oxygen injury experiments, mice were sacrificed, and lung tissue was either processed for the isolation of genomic DNA or total RNA or fixed and embedded in paraffin.
Live Imaging
hAFSC with stable expression of firefly luciferase were used for tail vein injection. Prior to imaging, mice were injected with 125 mg/kg luciferin (Promega, Madison, WI, http://www.promega.com), as described [10]. The animals were anesthetized, and luciferase bioluminescence was monitored under a detector (Saban Research Institute Small Animal Imaging Core facility) 4 hours after injection of the substrate. The animals were also monitored at the following time points after stem cell injection: 1 day, 2 days, 3 days, 1 week, 2 weeks, and 3 weeks. Images with all animals were taken at the same intensity of signal, with the exception of the first 4 hours after injection, when the intensity was reduced to compensate for the stronger signal. Fifteen animals were analyzed at each time point.
Histology and Immunohistochemistry
Lung tissues were fixed in 4% paraformaldehyde at 20 cm water inflation pressure, embedded in paraffin, and cut into 3–5-μm-thick sections. Primary antibodies used for immunohistochemistry included thyroid transcription factor 1 (TTF1), pulmonary pro-surfactant protein C (pro-SPC) (Seven Hills, Cincinnati, http://www.sevenhillsbioreagents.com), Clara cell 10-kDa protein (CC10) (Santa Cruz Biotechnology Inc., Santa Cruz, CA, http://www.scbt.com), pan-cytokeratin (Sigma-Aldrich), podoplanin (PDPN) (Developmental Studies Hybridoma Bank, Iowa City, IA, http://www.uiowa.edu/~dshbwww), and F4/80 (Abcam, Cambridge, MA, http://www.abcam.com). Sections were counterstained with 4′,6-diamidino-2-phenylindole (DAPI) (Vector Laboratories, Burlin-game, CA, http://www.vectorlabs.com) and photographed with a Leica microscope (Leica, Heerbrugg, Switzerland, http://www.leica.com).
In Situ Hybridization and Immunofluorescence
Chromogenic in situ hybridization (CISH) for Y chromosome was performed on formalin-fixed, paraffin-embedded tissue sections according to the manufacturer's instructions (Zymed SPOT-Light CISH; Invitrogen). CISH signals were detected under light microscopy using a ×40 objective lens. Fluorescence in situ hybridization (FISH) for X and Y chromosome was performed using commercially available probes (Vysis, Downers Grove, IL, http://www.vysis.com). For paraffin-embedded lungs, the sections were deparaffinized in Histochoice clearing agent (Sigma-Aldrich) and graded ethanol, incubated in boiling antigen-unmasking solution (Vector Laboratories) for 25 minutes, and equilibrated at room temperature. Slides were then immersed in 0.2 N HCl for 10 minutes, rinsed two times in PBS, and incubated at 78°C in NaSCN for 20 minutes. Slides were then washed in PBS and dehydrated with graded ethanol. Probe was prewarmed at 75°C for 5′, applied to the target area, sealed with coverslips (Grace Bio-Labs, Bend, OR, http://www.gracebio.com), and hybridized overnight at 42°C. The next day, the coverslips were removed, and the slides were incubated in 0.4× standard saline citrate (SSC; Bio-Rad, Hercules, CA, http://www.bio-rad.com)/0.3% Nonidet P40 (Sigma-Aldrich) at 75°C for 10 minutes; then, slides were immersed in 2× SSC/0.1% Nonidet P40 for 2 minutes and rinsed in PBS. Once dried, slides were counterstained with 4′-6-diamidino-2-phenylindole (Vector Laboratories) and visualized with a fluorescence microscope. For FISH on single cells, slides retrieved from −80°C storage were allowed to dry for 5 minutes, and then probe was added as described above and slides were incubated overnight at 42°C. The next day, slides were immersed in 2× SSC at 42°C for 15 minutes, and then coverslips were removed and slides were left in 0.4× SSC/0.3% Nonidet P40 for 2 minutes at 70°C. After a wash in PBS for 5 minutes, slides were counterstained and analyzed as described above. When combined immunostaining was performed, primary antibody was incubated overnight at 4°C, and secondary antibody was incubated for 30 minutes at room temperature.
Tissue Analysis
FISH and immunohistochemistry were analyzed using a Leica fluorescence microscope. The percentage of integration was determined by counting CM-Dil-positive cells on the total number of cells from three different experiments using five randomly chosen areas for each experiment. The percentage of differentiation was determined by counting the cells that were positive for both Y chromosome and the marker for epithelial cell pancytokeratin.
DNA and RNA Isolation and Reverse Transcription-Polymerase Chain Reaction
Genomic DNA was extracted from lung using the DNeasy Blood & Tissue Kit (Qiagen, Hilden, Germany, http://www1.qiagen.com) following the protocol provided. Total RNA was extracted from lung using TRIzol (Invitrogen, Carlsbad, CA, http://www.invitrogen.com). The purity of the RNA was analyzed by measuring the absorbance ratio at 260 and 280 nm using a spectrophotometer, and the integrity of the RNA was confirmed by analyzing for the presence of intact 28S and 18S RNA following agarose gel electrophoresis. Reverse transcription (RT) was performed starting from 1 μg of RNA using Superscript-III (Invitrogen) according to the manufacturer's protocols. Polymerase chain reaction (PCR) was performed with 50 ng of cDNA, 500 nM each primer, and a total volume of 25 μl using PCR supermix (Roche Diagnostics, Basel, Switzerland, http://www.roche-applied-science.com) and the following primer pairs: TTF1 forward, CCAAGCGCATCCAATCTCAA; TTF1 reverse, GGCAGAGTGTGCCCAGAGTG; CC10 forward, CACCCTGGTCACACTGGCTC; CC10 reverse, GGAGGGTGTCCACCAGCTTC; SPC forward, TTGGTCCTTCACCTCTGTCC; SPC reverse, CTCCAGAACCATCTCCGTGT; PDPN forward, CCAGCGAAGACCGCTATAAG; PDPN reverse, GGTCACCGTGGATTCTGAGT. Primers were designed to discriminate between human and murine mRNA. PCR conditions were as follows: 28 cycles of 95°C for 30 seconds, 60°C for 30 seconds, and 72°C for 30 seconds; and 72°C extension for 2 minutes. Loading conditions were checked using a mouse β-actin (mACTB), and the presence of human DNA in each sample was analyzed with human β-actin (hACTB).
Real-Time PCR
Real-time PCR was performed using LightCycler 480 Probe Master Mix in a LightCycler 480 instrument (Roche Diagnostics). Human CXCR4 (hCXCR4) and stromal cell-derived factor 1 (SDF1) expression was calculated following normalization to ACTB levels by relative quantification [11]. hCXCR4 was first amplified with external primers hCXCR4big-forward (F) (ATGCTTTCCTTGGAGCCAAA) and hCXCR4big-reverse (R) (ATGCTTTCCTTGGAGCCAAA). Real-time PCR was performed with hCXCR4-Forward (CTGTGAGCAGAGGGTCCAG) and hCXCR4-Reverse (ATGAATGTCCACCTCGCTTT) and with probe 55 from the Universal ProbeLibrary (Roche Diagnostics). Real-time PCR for SDF1 was performed with the following primers and probe: SDF1-Forward (CTGTGCCCTTCAGATTGTTG), SDF1-Reverse (TAATTTCGGGTCAATGCACA), and probe 41 from the Universal ProbeLibrary (Roche Diagnostics). Real-time PCR for the human Y chromosome was performed using the following primers and probe for Sry genes: SRY-Forward (TCGCATTTTTCAGGACAGC), SRY-Reverse (CGTTGACTACTTGCCCTGCT), and probe 16 from the Universal ProbeLibrary (Roche Diagnostics). A standard curve was obtained with a synthetic oligonucleotide (Operon, Alameda, CA, http://www.operon.com). Absolute quantification was performed with the second derivative maximum method. Real-time PCR conditions were as follows: 45 cycles of 95°C for 10 seconds, 60°C for 30 seconds.
Single-Cell Preparation
Hanks' balanced saline solution (HBSS)-perfused lung samples were finely minced with razor blades and enzymatically digested for 1 hour at 37°C in a solution of 1 mg/ml collagenase IV, 0.1 mg/ml hyaluronidase (Sigma-Aldrich), and 30 U/ml DNaseI (Roche Diagnostics) in DMEM/F12 medium. The resulting digest was then filtered through a 40 μm Falcon cell strainer (BD Biosciences, San Diego, http://www.bdbiosciences.com) to remove debris and washed with HBSS. A sample chamber positioned on the top of a microscope slide was loaded with ~105 cells and centrifuged in a Cytospin2 (Thermo Shandon Inc., Pittsburgh, http://www.thermo.com) at 350 rpm for 5 minutes. The slide was dried and stored at −80°C until it was used.
Statistical Analysis
Comparisons between two groups were made using an unpaired t test. A value of p ≤ .05 was considered statistically significant. Analyses were done using GraphPad Prism software (GraphPad Software, Inc., San Diego, http://www.graphpad.com). Data are shown as mean ± SD.
hAFSC Engraft In Vitro into Epithelium and Mesenchyme of Embryonic Lung Explants and Start to Express the Early Differentiation Marker TTF1
To investigate the ability of hAFSC to integrate in murine lung tissues, we cultured lungs between E11.5 and E12.5 for short-term experiments. Approximately 104 CM-Dil-labeled hAFSC were microinjected intratracheally into the embryonic lungs that were then analyzed at different time points. After 1 week, hAFSC had integrated into both epithelium and mesenchyme of embryonic lungs (Fig. 1A, 1B). To assess whether hAFSC differentiate into lung epithelial-specific lineages after microinjection, we used TTF1, a transcription factor that is expressed in early embryonic lung epithelium, as a marker. Reverse transcription (RT)-PCR performed with TTF1 human-specific primers showed that hAFSC do express TTF1 at 7 days after the microinjection (Fig. 1C).
Figure 1
Figure 1
hAFSC integrate into embryonic lung epithelium and mesenchyme and express the early marker of differentiation TTF1. Embryonic lung at embryonic stage 11.5 was microinjected with 104 hAFSC and cultured for 1 week. Immunohistochemistry for TTF1 (green) (more ...)
hAFSC Home In Vivo to Adult Mouse Lung
We also examined whether hAFSC were able to uptake and integrate into adult mouse lung. For these experiments we did not damage the lung of the recipient mice, and approximately 106 luciferase-labeled hAFSC were tail vein-injected per nude mouse. hAFSC were monitored as the cells passed through the circulation. Figure 2B is representative of eight different experiments (of 15 total experiments) and shows that AFSC localize in the lung right after the injection. During the next few days, AFSC distribute around the body and sublocalize mainly in the area of liver and lung, although a relatively weak signal is sometimes seen in the head. A range of efficiency of uptake of hAFSC into the lung was observed in luciferase experiments. Figure 2A and 2C shows two examples of the maximum and the minimum level of engraftment. The graph in Figure 3B shows that hAFSC have an engraftment of 1.6% ± 0.65% 1 week after the injection in control mice and that the engraftment goes down to 0.47% ± 0.18% after 40 days. Engrafted CM-Dil-labeled cells were detectable 2 weeks after injection by fluorescence (Fig. 2D) and up to 7 months from the injection by CISH for Y chromosome (Fig. 2E). All these in vivo experiments were done using uninjured nude mice. Mice monitored up to 7 months from the injection did not show any neoplasia arising from the hAFSC. Also, intramuscular injection of hAFSC in nude mice did not produce any tumor formation (data not shown).
Figure 2
Figure 2
Human amniotic fluid stem cells (hAFSC) can integrate into adult mouse lung after tail vein injection. (A–C): Bioluminescence of mice injected with amniotic fluid stem cells (AFSC) expressing luciferase. After 21 days AFSC were still detected (more ...)
Figure 3
Figure 3
Lung injury increases the level of integration of hAFSC. (A): Absolute quantification of Sry genes on the Y chromosome by real-time polymerase chain reaction. Data are reported as Y chromosome copy number and thus the number of hAFSC per 1,000 lung cells. (more ...)
hAFSC Uptake and Integration into the Lung Following Oxygen Injury
To assess the engraftment of hAFSC into adult lung after injury, nude mice treated with 99% O2 for 3 days were used. hAFSC were tail vein-injected and lungs were collected at different time points to evaluate the engraftment. The percentage of integration was determined by counting CM-Dil-positive cells as a percentage of the total number of cells (number of DAPI-stained nuclei). Per time point, six mice were analyzed, and five random areas were chosen for each lung (on different sections). The number of cells per field was ~2,000. Figure 3B shows that the percentage of engraftment of hAFSC after O2 treatment was 6.15% ± 1.90% after 7 days, 4.43% ± 1.03% after 15 days, and 1.48% ± 0.51% after 40 days. The level of engraftment was significantly increased compared with the administration without damage (p < .001). Figure 3A shows the level of integration for the same experiment analyzed by quantitative real-time PCR of Y chromosome. A standard curve was performed using a synthetic nucleotide (efficiency = 1.94; error = 0.066), and data were reported as number of donor cells (corresponding to Y chromosome copy number) per 1,000 lung cells. The engraftment in this case was 56.5 ± 17.82 after 7 days (p < .001), 38.25 ± 10.63 after 15 days (p < .001), and 16.25 ± 7.80 after 40 days (p < .01). All the experiments were performed using nude mice; nevertheless, nonspecific phagocytose activity may occur, particularly when the lung is injured. Therefore, immunohistochemistry (IHC) for macrophage marker F4/80 was performed to take into account the possibility that the CM-Dil signal may derive from phagocytosed hAFSC. Following oxygen injury, 11% ± 3.2% of CM-Dil detection derived from phagocyte-associated hAFSC, and therefore almost 90% of the hAFSC signal did not merge with macrophages (Fig. 2F).
hAFSC Differentiation and Recruitment After Oxygen Injury
To determine whether hAFSC were able to differentiate into epithelial lung lineages after integration, we analyzed the expression of specific markers. hAFSC were first analyzed for endogenous expression of the following lung specific markers: PDPN for type I pneumocytes, TTF1 as a general lung epithelial marker, SPC for type II pneumocytes, and CC10 for Clara cells. Of these, only PDPN was endogenously detected in hAFSC prior to microinjection into lung (Fig. 4A, 4B).
Figure 4
Figure 4
hAFSC have differentiated into epithelial lung lineages 2 weeks after tail vein injection. (A): Reverse transcription-polymerase chain reaction (RT-PCR) PDPN for prior injection of hAFSC. (B): Immunohistochemistry showed that hAFSC expressed endogenous (more ...)
Since human TTF1 had already been detected 1 week after the microinjection of hAFSC into embryonic lungs, we expected to confirm the presence of hAFSC expressing TTF1 during the in vivo experiments. IHC showed TTF1 expression in hAFSC after 1 month and up to 7 months from the injection of oxygen-treated mice. Using female mouse recipients for tail vein injection, we were able to use FISH for chromosome Y to track hAFSC differentiation. Figure 4C–4F shows IHC for TTF1 (red) and therefore demonstrates that the Y chromosome-positive cell (green) is differentiating into a peripheral lung epithelial cell lineage.
Single-cell analysis with FISH for the Y chromosome and IHC for TTF1 (Fig. 4G) confirmed the differentiation of hAFSC and excluded the possibility of multilayer artifacts. Also, RT-PCR for human-specific TTF1 (Fig. 4H) after 7 months from the injection confirmed that hAFSC integrate, differentiate, and maintain their differentiation. Human ACTB was used to assess the presence of mRNA derived from hAFSC in all the samples, whereas mouse ACTB was used as a loading control.
We also checked for differentiation of type II pneumocyte lineage. Figure 5A and 5B shows an hAFSC-derived CM-Dil-labeled cell expressing SPC. Single-cell analysis with FISH for the Y chromosome and IHC for SPC confirmed that the signal was from an integrated hAFSC (Fig. 5C). However, RT-PCR was not positive for human-specific SPC in whole lung, suggesting that differentiation into type II pneumocytes is not a frequent event after integration of hAFSC.
Figure 5
Figure 5
Human amniotic fluid stem cells (hAFSC) can acquire a type II pneumocyte phenotype. (A, B): Murine adult lung treated with >99% oxygen for 3 days was processed for immunohistochemistry (IHC) 15 days after tail vein injection. CM-Dil-labeled hAFSC (more ...)
hAFSC Differential Recruitment and Differentiation After Naphthalene Injury
To further investigate the ability of hAFSC to participate in reparative processes after lung injury, we produced specific damage of Clara cells with naphthalene. hAFSC were then either tail vein-injected or intratracheally inoculated after naphthalene treatment. Counting the number of integrated cells in the areas surrounding airway positions (considering a surrounding area to be within a two-cell-diameter distance [~20 μm] from the airway epithelium), we found significant differences in cell counts. Airways of control, hyperoxia-treated, or naphthalene-treated mice were analyzed on six or four mice, per treatment group, and within each mouse 20 random airways were used for counting. In the naphthalene-treated mice that received tail vein-injected hAFSC, 25.33 ± 8.56 hAFSC were found within the airway tissue, whereas following hyperoxia and in the control mice the numbers of cells were 2.67 ± 2.43 and 1.33 ± 1.60, respectively (p < .001). Thus, hAFSC injected intravenously after naphthalene treatment appeared to enrich in the airway tissue surrounding the damaged airways but were not able to integrate and differentiate into the upper airway epithelium per se. In contrast, intratracheal administration of hAFSC led to a statistically significant integration in the upper airway epithelium compared with untreated control mice. Figure 3A shows that the engraftment analyzed by quantitative real-time PCR of Y chromosome was 105 ± 25.65 after 7 days, 43 ± 18.57 after 15 days, and 22.25 ± 4.32 after 40 days (p < .001). Strikingly, hAFSC were found near the bronchioalveolar junctions, a location where Clara cell regeneration is postulated to occur (Fig. 6A, 6B). Furthermore, 40 days after the damage, hAFSC positive for both CC10 and Y chromosome were detected in the airways (Fig. 6C). FISH for Y chromosome from cytospin samples also appeared hAFSC CC10 and Y chromosome-positive (Fig. 6D). RT-PCR for human CC10 was positive in one of five samples analyzed (Fig. 6E). hACTB was efficiently expressed in all the samples, suggesting that hAFSC mRNA was present in all the samples. As a loading control, mACTB was used.
Figure 6
Figure 6
hAFSC can integrate into the upper airways and express the Clara cell-specific marker CC10. First, lungs were damaged with 275 mg/kg naphthalene, and then ~2.5 × 105 hAFSC were administered intratracheally. (A): Fifteen days after the (more ...)
CXCR4 and SDF1 As Candidate Uptake Signals
To test the hypothesis that CXCR4/SDF1 signaling contributes to the plasticity of hAFSC, the expression of CXCR4 and SDF1 was analyzed by ISH and real-time PCR before and after naphthalene injury. Cultured hAFSC constitutively express hCXCR4 (Fig. 7A). One week after injection into the recipient injured lung, hAFSC still had a significant amount (47.4% ± 23.1%) of hCXCR4 expression, whereas it was notably reduced after 2 weeks (7.3% ± 3.7%) (Fig. 7B). Furthermore, SDF1, as shown in IHC and real-time PCR experiments, is constitutively expressed in the airways and is upregulated by 16-fold (16.8 ± 8.8; p < .001) 1 week after naphthalene injury (Fig. 7C–7F). Taken together, these data suggest that the observed plasticity of hAFSC in response to different damage may rely on the CXCR4/SDF1 signaling.
Figure 7
Figure 7
CXCR4 and SDF1 expression during naphthalene lung injury. The CXCR4/SDF1 axis may be involved in hAFSC plasticity. (A): Immunohistochemistry (IHC) showed that cultured hAFSC expressed CXCR4 (green), indicating that they may be responsive to presence of (more ...)
Checking for Cell Fusion
We have tried to verify whether hAFSC, once integrated into the recipient lung, were undergoing cellular fusion with lung resident cells. Analysis of tissue sections and cytospin samples did not show Y chromosome-positive cells in combination with X chromosome (supplemental online Fig. 1A–1D).
In this study we have demonstrated for the first time that hAFSC can undergo lung-specific lineage differentiation and that these cells possess a certain level of plasticity in response to different types of lung damage. In vitro microinjection into mouse embryonic lung showed the ability of hAFSC to engraft and differentiate by expressing the early lung marker TTF1. The expression of TTF1 1 week after microinjection suggests that hAFSC can commit to differentiation into lung lineages shortly after integration and prompted us to evaluate hAFSC for longer-term experiments in adult mice.
To determine the ability of AFSC to home in adult lung, we used AFSC expressing luciferase and detected the bioluminescence after tail vein injection. For these experiments, no damage to the lung of the recipient nude mice was done, but we were able to find a basal level of engraftment after AFSC administration in uninjured lung. AFSC were concentrated in the lung shortly after injection. During the following days AFSC circulated around the body, concentrating in the liver and in the lung but having low signals from other parts, including the head in some cases. Most importantly, AFSC were detectable in the lung 3 weeks after the injection, suggesting that there was a reasonable window of time in which to study them in the adult lung. The integration and persistence of AFSC in the absence of damage to the recipient lung was confirmed with direct analysis of CM-Dil-labeled AFSC after sectioning of the injected lungs at different time points. Quantitative analysis of the Y chromosome by real-time PCR confirmed the integration of AFSC. Despite the ability of hAFSC to integrate into the lung of nude mice in absence of injury, under these conditions we were not able to identify hAFSC differentiated into epithelial cells in the absence of injury. This result is consistent with the necessity of producing damage of the recipient lung to obtain stem cell-derived epithelial cells [12].
After exposure to oxygen, hAFSC exhibit significantly stronger engraftment, probably due to enhanced niche accessibility [13]. Hyperoxia is known to cause oxidative damage of alveolar cells, acting directly because of cellular oxygen toxicity and indirectly through the accumulation of inflammatory mediators [14]. The engraftment of hAFSC into the three-dimensional scaffold of the lung during the first days after injection showed a distribution in clusters positioned around small vessels. This pattern was previously reported for injection of marrow-derived cells into lung [15]. The percentage of integration was analyzed, counting integrated hAFSC after sectioning and with absolute quantification of Y chromosome by real-time PCR, with comparable results. One week after injection the number of integrated cells among the total population was ~6%. This percentage decreased over time, but a detectable level of cells persisted at 2 weeks and 40 days. Combining Y chromosome detection and pan-cytokeratin as an epithelial marker on IHC, we tried to address the percentage of integrated AFSC going through differentiation. Approximately 37% of the cells integrated at 40 days were going through differentiation, indicating that 0.5% of the lung population was represented by hAFSC differentiated into epithelial lineages. Notably, human TTF1 was still found by RT-PCR and IHC after 7 months from the injection into adult mice. This result suggests that at least some of the integrated hAFSC may have retained a self-renewal capability and can maintain the expression of this early differentiation marker.
Pro-SPC expression by hAFSC has been observed during our analysis by IHC, and this was confirmed with Y chromosome on single cells, suggesting that engraftment as type II pneumocytes can occur. However, the major caveat on this conclusion is that we could not detect SPC expression with RT-PCR with human-specific primers.
After naphthalene injury, hAFSC showed localization within the bronchial tissue versus at bronchioalveolar junctions, where the damage to Clara cells had occurred, depending on the respective route of administration: i.v. versus intratracheal. Naphthalene is an aromatic hydrocarbon used to injure the lung by specifically destroying Clara cells that express the cytochrome P450 (Cyp2f2) [16]. hAFSC given by tail vein injection after naphthalene injury accumulated in the upper airway, increased numbers compared with after oxygen treatment. This behavior suggests a certain level of plasticity of AFSC in responding to different types of lung damage.
The chemokine SDF1 is involved in progenitor cell trafficking [17], and the CXCR4/SDF1 signaling axis is involved in the homing of circulating stem cells into bleomycin-injured lung [18]. We found that cultured hAFSC express hCXCR4 and retain a significant amount of hCXCR4 expression 7 days after the administration of the cells to a naphthalene-injured lung. SDF1, which is the ligand of CXCR4, is constitutively expressed in the airways, and its level of expression has a peak after 7 days from naphthalene injury. Taken together, these observations are consistent with a possible involvement of the CXCR4/SDF1 signaling axis on the plasticity of hAFSC observed in this study.
hAFSC added intratracheally after naphthalene injury initially had an higher level of epithelial integration, possibly due to the direct administration (Fig. 3A). During the following days, there was a progressive reduction of integrated cells from 15 to 40 days. After naphthalene injury, intratracheally administered hAFSC were found at bronchioalveolar positions where CC10-positive cells had been damaged. Also, FISH for Y chromosome and IHC for CC10 on tissue sections, as well as single-cell cytospin, showed that hAFSC in these conditions can start to express CC10, indicating that they may differentiate into Clara cells (Fig. 6D).
We tried to determine whether hAFSC, once integrated into the recipient lung, were undergoing cellular fusion with endogenous resident cells (supplemental online Fig. 1). During the analysis of tissue and cytospin samples, we never found Y chromosome-positive cells in combination with the X chromosome. However, considering the small absolute number of Y chromosome-positive cells identified, we are unable to positively exclude the possibility that hAFSC may occasionally fuse with resident cells of recipient mouse lung.
Additional experiments and different approaches are needed to optimize hAFSC integration and differentiation. The possibility of deriving specific lung lineages from stem cells in vitro has already been shown [19]. Thus, the induction of the hAFSC into specific lung epithelial lineages before administration may be one approach to improving their integration, survival, and differentiation. Our data with embryonic lung organ culture and the expression of TTF1 1 week after the microinjection suggest that culture of hAFSC before injection in vivo into the adult animal may perhaps increase the percentage of integration and hopefully of differentiation. We conclude that the abilities of hAFSC, demonstrated herein, to express specific epithelial lung markers and to respond in a selective way to different types of lung damage support further evaluation of hAFSC as a resource for cell-based therapy for the lung.
Supplementary Material
Supplemental Figure
Supplemental Figure Legend
Acknowledgments
We thank E. Herzog for the suggestions for FISH and IHC double staining. This work was supported by NIH National Heart, Lung, and Blood Institute Grants HL60231, 44060, 44977, and 75773 (to D.W.), NIH KO8 (to R.E.D.F.), a California Institute for Regenerative Medicine Fellowship (to L.P. and C.T.), and Childrens Hospital Los Angeles Career Development Fellowship (to S.P.D.L.). The hybridoma antibody for podoplanin developed by Andrew Farr was obtained from the Developmental Studies Hybridoma Bank developed under the auspices of the National Institute of Child Health and Human Development and maintained by the Department of Biology Sciences, University of Iowa, Iowa City, IA.
Footnotes
Disclosure of Potential Conflicts of Interest: The authors indicate no potential conflicts of interest.
Author contributions: G.C.: conception and design, data analysis and interpretation, manuscript writing, assembly of data; L.P.: conception and design, hAFSC culture; S.S.: tail vein injection of hAFSC; S.G.: bioluminescence experiments; C.T.: real-time PCR experiments; J.L.: mouse preparation, intratracheal administration of hAFSC; G.T.: cytospin experiments; S.P.D.L.: naphthalene injury experiments; B.D.: conception and design, data analysis and interpretation; S.B.: manuscript writing, collection and assembly of data; P.M.: data analysis and interpretation; A.A.: data interpretation; R.E.D.F.: collection and assembly of data, financial support; D.W.: manuscript writing, final approval of manuscript, financial support.
See www.StemCells.com for supplemental material available online.
1. Warburton D, Berberich MA, Driscoll B. Stem/progenitor cells in lung morphogenesis, repair, and regeneration. Curr Top Dev Biol. 2004;64:1–16. [PubMed]
2. Hong KU, Reynolds SD, Watkins S, et al. Basal cells are a multipotent progenitor capable of renewing the bronchial epithelium. Am J Pathol. 2004;164:577–588. [PubMed]
3. Hong KU, Reynolds SD, Giangreco A, et al. Clara cell secretory protein-expressing cells of the airway neuroepithelial body microenvironment include a label-retaining subset and are critical for epithelial renewal after progenitor cell depletion. Am J Respir Cell Mol Biol. 2001;24:671–681. [PubMed]
4. Kim CF, Jackson EL, Woolfenden AE, et al. Identification of bronchioalveolar stem cells in normal lung and lung cancer. Cell. 2005;121:823–835. [PubMed]
5. Giangreco A, Reynolds SD, Stripp BR. Terminal bronchioles harbor a unique airway stem cell population that localizes to the bronchoalveolar duct junction. Am J Pathol. 2002;161:173–182. [PubMed]
6. Krause DS, Theise ND, Collector MI, et al. Multi-organ, multi-lineage engraftment by a single bone marrow-derived stem cell. Cell. 2001;105:369–377. [PubMed]
7. Coraux C, Nawrocki-Raby B, Hinnrasky J, et al. Embryonic stem cells generate airway epithelial tissue. Am J Respir Cell Mol Biol. 2005;32:87–92. [PubMed]
8. Rippon HJ, Polak JM, Qin M, et al. Derivation of distal lung epithelial progenitors from murine embryonic stem cells using a novel three-step differentiation protocol. Stem Cells. 2006;24:1389–1398. [PubMed]
9. De Coppi P, Bartsch G, Jr, Siddiqui MM, et al. Isolation of amniotic stem cell lines with potential for therapy. Nat Biotechnol. 2007;25:100–106. [PubMed]
10. Wang X, Rosol M, Ge S, et al. Dynamic tracking of human hematopoietic stem cell engraftment using in vivo bioluminescence imaging. Blood. 2003;102:3478–3482. [PubMed]
11. Herzog EL, Van Arnam J, Hu B, et al. Threshold of lung injury required for the appearance of marrow-derived lung epithelia. Stem Cells. 2006;24:1986–1992. [PubMed]
12. Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001;29:e45. [PMC free article] [PubMed]
13. Pagano A, Barazzone-Argiroffo C. Alveolar cell death in hyperoxia-induced lung injury. Ann N Y Acad Sci. 2003;1010:405–416. [PubMed]
14. Adamson IY, Bowden DH. Bleomycin-induced injury and metaplasia of alveolar type 2 cells. Relationship of cellular responses to drug presence in the lung. Am J Pathol. 1979;96:531–544. [PubMed]
15. Ceradini DJ, Kulkarni AR, Callaghan MJ, et al. Progenitor cell trafficking is regulated by hypoxic gradients through HIF-1 induction of SDF-1. Nat Med. 2004;10:858–864. [PubMed]
16. Kotton DN, Ma BY, Cardoso WV, et al. Bone marrow-derived cells as progenitors of lung alveolar epithelium. Development. 2001;128:5181–5188. [PubMed]
17. Stripp BR, Maxson K, Mera R, et al. Plasticity of airway cell proliferation and gene expression after acute naphthalene injury. Am J Physiol. 1995;269:L791–L799. [PubMed]
18. Gomperts BN, Belperio JA, Rao PN, et al. Circulating progenitor epithelial cells traffic via CXCR4/CXCL12 in response to airway injury. J Immunol. 2006;176:1916–1927. [PubMed]
19. Ali NN, Edgar AJ, Samadikuchaksaraei A, et al. Derivation of type II alveolar epithelial cells from murine embryonic stem cells. Tissue Eng. 2002;8:541–550. [PubMed]