Mi-2/NuRD complex function is required for normal S phase progression and assembly of pericentric heterochromatin

doi:10.1091/mbc.E11-03-0258

Mol Biol Cell. 2011 September 1; 22(17): 3094–3102.

PMCID: PMC3164457

Copyright This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

Mi-2/NuRD complex function is required for normal S phase progression and assembly of pericentric heterochromatin

Jennifer K. Sims and Paul A. Wade^*

Laboratory of Molecular Carcinogenesis, National Institute of Environmental Health Sciences, Research Triangle Park, NC 27709

Kerry Bloom, Monitoring Editor

University of North Carolina

*Address correspondence to: Paul A. Wade (Email: wadep2/at/niehs.nih.gov).

Received March 28, 2011; Revised May 27, 2011; Accepted June 27, 2011.

“ASCB®,” “The American Society for Cell Biology®,” and “Molecular Biology of the Cell®” are registered trademarks of The American Society of Cell Biology.

This article has been cited by other articles in PMC.

Abstract

During chromosome duplication, it is essential to replicate not only the DNA sequence, but also the complex nucleoprotein structures of chromatin. Pericentric heterochromatin is critical for silencing repetitive elements and plays an essential structural role during mitosis. However, relatively little is understood about its assembly and maintenance during replication. The Mi2/NuRD chromatin remodeling complex tightly associates with actively replicating pericentric heterochromatin, suggesting a role in its assembly. Here we demonstrate that depletion of the catalytic ATPase subunit CHD4/Mi-2β in cells with a dampened DNA damage response results in a slow-growth phenotype characterized by delayed progression through S phase. Furthermore, we observe defects in pericentric heterochromatin maintenance and assembly. Our data suggest that chromatin assembly defects are sensed by an ATM-dependent intra–S phase chromatin quality checkpoint, resulting in a temporal block to the transition from early to late S phase. These findings implicate Mi-2β in the maintenance of chromatin structure and proper cell cycle progression.

INTRODUCTION

DNA-templated processes in eukaryotic nuclei take place within a complex nucleoprotein assembly termed chromatin. The template for production of daughter DNA strands has been recognized since the demonstration of semiconservative replication (Meselson and Stahl, 1958 blue right-pointing triangle

). Duplication of the nongenetic information of chromosomes along with their specialized, biologically essential structures represents an additional burden to the chromosomal duplication machinery. Following passage of the replication fork, normal cell division requires maintenance of protein stoichiometry, sustaining of modification status of both protein and DNA, and assembly of higher-order chromosomal structures (Groth et al., 2007b blue right-pointing triangle

). The details of how these processes are templated and how the numerous enzymatic reactions required are coordinated remain poorly understood.

Nuclear regions that remain highly condensed throughout the cell cycle are generically termed heterochromatin. In mammals, a substantial portion of the genome is embedded within heterochromatin, which tends to be gene poor and enriched in repetitive sequence, including classic satellites and transposable elements (Henikoff, 2000 blue right-pointing triangle

). Maintenance of heterochromatic structures during mitosis requires faithful replication of all epigenetic marks, as well as association of appropriate nonhistone proteins. Two predominant covalent modifications are associated with constitutive heterochromatin throughout the cell cycle: trimethylation of lysine 9 on histone H3 (H3K9me3) and DNA methylation at CpG dinucleotides (Rice et al., 2003 blue right-pointing triangle

; Weber and Schubeler, 2007 blue right-pointing triangle

). Genetic perturbation of the enzymatic machinery responsible for deposition of either of these marks leads to genomic instability, centromeric defects, and gross chromosomal abnormalities (Rice et al., 2003 blue right-pointing triangle

; Weber and Schubeler, 2007 blue right-pointing triangle

). An essential nonhistone component of heterochromatin, heterochromatin protein 1 (HP-1), is conserved throughout the animal and plant kingdoms and localizes to pericentric heterochromatin (Bannister et al., 2001 blue right-pointing triangle

; Lachner et al., 2001 blue right-pointing triangle

). Although the precise architecture of constitutive heterochromatin remains unknown, it has been proposed that HP-1 dimers stabilize spatially proximal nucleosomes through binding to trimethyl lysine 9 via their chromodomains (Nielsen et al., 2001 blue right-pointing triangle

Multiple studies have investigated the role(s) played by chromatin remodeling enzymes in assembly and maintenance of heterochromatin. Both the WSTF-ISWI and ACF-SNF2h complexes localize to pericentric heterochromatin, and perturbation of either results in reduced rates of replication (Collins et al., 2002 blue right-pointing triangle

; Poot et al., 2004 blue right-pointing triangle

). Deletion of Brg1 in murine fibroblasts results in dramatic defects in pericentric heterochromatin, H3K9me3, and aberrant mitoses (Bourgo et al., 2009 blue right-pointing triangle

). Functional deficiencies of the SNF2 family members LSH, DDM1, and ATRX have likewise been associated with defects in pericentric heterochromatin (Gendrel et al., 2002 blue right-pointing triangle

; Xue et al., 2003 blue right-pointing triangle

; Yan et al., 2003 blue right-pointing triangle

We previously reported that an additional protein complex containing an SNF2 family ATPase, the Mi-2/NuRD complex, is recruited to a novel nuclear structure in rapidly proliferating B cells, termed NuRD bodies (Helbling Chadwick et al., 2009 blue right-pointing triangle

). These NuRD bodies are localized to pericentric heterochromatin enriched in H3K9me3 specifically during late S phase. Furthermore, NuRD body accumulation is tightly linked to active DNA replication, as well as to chromatin assembly at regions of DNA replication (Helbling Chadwick et al., 2009 blue right-pointing triangle

). In this study, we demonstrate that depletion of the catalytic ATPase subunit CHD4/Mi-2β results in a slow-growth phenotype that is, in part, a manifestation of delayed progression through S phase. In addition, we observe defects in pericentric heterochromatin maintenance and assembly. Our data suggest that incomplete chromatin assembly is sensed by an ATM-dependent intra–S phase checkpoint, resulting in a temporal block to the transition from early to late S phase. These data indicate a critical role for Mi-2β in assembly and/or maintenance of chromatin structure(s) required for proper cell cycle progression.

RESULTS

NuRD complex is required for proper heterochromatin formation

Recent studies propose that Mi-2/NuRD complex is critical for maintaining higher-order chromatin structure and preventing accumulation of double-stranded DNA damage (Pegoraro et al., 2009 blue right-pointing triangle

; Chou et al., 2010 blue right-pointing triangle

; Larsen et al., 2010 blue right-pointing triangle

; Polo et al., 2010 blue right-pointing triangle

; Smeenk et al., 2010 blue right-pointing triangle

). To determine whether NuRD complex may be also functionally relevant to heterochromatin formation, as suggested by its association with replicating DNA (Helbling Chadwick et al., 2009 blue right-pointing triangle

), we depleted two different subunits of NuRD complex in Ramos cells: the ATPase nucleosome remodeling subunit Mi-2β/CHD4 (shCHD4) or MBD3 (shMBD3), which is essential for complex integrity (Kaji et al., 2007 blue right-pointing triangle

). We subsequently evaluated localization of MTA3, a subunit of the NuRD complex. In controls (CTRL), NuRD bodies were seen in ~40% of cells, similar to previous data (Helbling Chadwick et al., 2009 blue right-pointing triangle

). CHD4 knockdown resulted in a decrease of NuRD body formation to ~20% of cells (Figure 1A). In addition, we observed redistribution of MTA3 throughout the nucleus, suggesting that the global chromatin environment is disrupted. Similar to Hutchinson–Gilford progeria syndrome, in which NuRD complex is sequestered at the nuclear lamina, we observed a global loss of H3K9me3 staining in the absence of CHD4 (Figure 1B; Pegoraro et al., 2009 blue right-pointing triangle

). In contrast, there was no change in the localization pattern of another heterochromatic histone modification, histone H4 lysine 20 trimethylation (H4K20me3), indicating that depletion of NuRD complex specifically disrupts localization of trimethylated H3K9 (Supplemental Figure S2A). To rule out that disruption of heterochromatin structure in the absence of CHD4 was unique to Ramos cells, we depleted a second germinal center–like B-cell line, Raji, and saw similar loss of H3K9me3 foci (Supplemental Figure S5).

FIGURE 1:

Depletion of CHD4 leads to loss of NuRD bodies and defects in pericentric heterochromatin. (A) Left, Ramos cells transduced with either control (CTRL) or CHD4 short hairpin RNA (shCHD4) lentivirus were spun onto slides and stained for MTA3. Right, staining (more ...)

We hypothesized that depletion of NuRD complex alters pericentric heterochromatin structure at the satellite repeats found on human chromosomes 1, 9, and 16 (Helbling Chadwick et al., 2009 blue right-pointing triangle

). Therefore, we examined gross structure of the megabase block of Satellite 2 (Sat 2) DNA located at pericentric heterochromatin of chromosome 1, using fluorescence in situ hybridization (FISH). The majority of Sat2 structures in CTRL cells show punctate staining, with an equal distribution of signal between foci within the nucleus. In contrast, ~50% of the Sat2 structures in shCHD4 cells scored (n > 70) are less compacted and often (~50%) have unequal distribution of signal between foci (Figure 1, C and D). To ensure that the diffuse structures that we observed in shCHD4 cells were not an artifact of imaging, Z-series sections were taken through the nucleus and rendered into a maximum-intensity projected image (Figure 1C, Max Int) with similar results. To determine whether the defects are specific for NuRD body–enriched Sat2 structures, two-color FISH was performed, comparing structures of chromosome 10 alpha satellite repeats (Chr10 α-sat), which do not recruit NuRD complex, to the Sat2 repeats. These repeats remained as discrete foci with equal staining in the absence of CHD4 (Supplemental Figure S2B), demonstrating a failure of appropriate assembly and/or maintenance of higher-order chromatin structure at pericentric heterochromatin.

Although we observed specific effects at pericentric heterochromatin, we hypothesized that Mi-2/NuRD complex may exert a more global influence on chromatin organization. To address this hypothesis, micrococcal nuclease (MNase) digestions were performed to analyze nucleosome structure in shCHD4 cells. Digestion with increasing concentrations of MNase indicated no defects in wrapping of DNA by the histone octamer in bulk chromatin from shCHD4 cells (Figure 2A). However, phosphorylation of KAP1, a marker of global chromatin decondensation, is increased in the absence of CHD4 (Figure 2B; Ziv et al., 2006 blue right-pointing triangle

), suggesting a broad role for CHD4 in some aspect of higher-order chromatin structure but not in assembly or maintenance of normal nucleosome configuration.

FIGURE 2:

Depletion of NuRD complex results in global alterations in chromatin structure. (A) Left, nuclei extracted from CTRL and shCHD4 cells 5 d after transduction were digested with increasing concentrations of micrococcal nuclease (MNase). A total of 1 μg (more ...)

CHD4 is required for normal S phase progression

On depletion of CHD4 and MBD3, we observed a slow-growth phenotype at early time points after infection (Figure 3A and Supplemental Figure S1C). However, as cells remain in culture, the growth rate of both shCHD4 and shMBD3 knockdowns mirrors that of CTRLs, suggesting that cells lacking NuRD complex are selected against. Assessment of CHD4 mRNA levels at 7 d after transduction indicated a return to near control levels, supporting the hypothesis that the cells lacking CHD4 are unable to proliferate over many cell divisions (Supplemental Figure S1A, day 7 expression). To further address this, we examined cell viability of cultures 4 and 7 d after infection. Analysis of the sub-G₁ population of cells 4 d after infection revealed that there was a larger proportion of dead cells in the absence of CHD4 compared with CTRL cells (Supplemental Figure S1D, day 4). As the cells remained in culture, the shCHD4 sub-G₁ population decreased and returned to CTRL levels, indicating that cells lacking CHD4 are selected against in culture (Supplemental Figure S1D, day 7).

FIGURE 3:

Depletion of NuRD complex results in altered kinetics of S phase progression. (A) Growth curves were performed in transduced Ramos cells. Three days after infection, cells were plated at a density of 200,000 cells/ml, and growth was monitored by counting (more ...)

Early in the time course of depletion (days 4 and 5), we noted a global decrease in markers of G2/M phase, including cyclin B1 and histone H3 serine 10 phosphorylation (H3S10P; Figure 3B), indicating that asynchronous cultures were spending less time in G2/M phase. This result is consistent with increased residence time in G1 as documented recently by several groups for CHD4 depleted cells (Chou et al., 2010 blue right-pointing triangle

; Larsen et al., 2010 blue right-pointing triangle

; Polo et al., 2010 blue right-pointing triangle

; Smeenk et al., 2010 blue right-pointing triangle

) or with altered kinetics of S phase progression. To examine the effect of depletion of NuRD complex on S phase progression, asynchronous cells lacking CHD4 were labeled with 10 μM BrdU for 15 min and monitored by flow cytometry 4 d after transduction. A moderate increase in the S phase population was observed in shCHD4 cells compared with CTRL cells, indicating a perturbation in S phase (Supplemental Figure S3A). To examine active DNA replication at the individual cell level, bromodeoxyuridine (BrdU)-labeled asynchronous cells were fixed onto slides, stained, and scored as early (I), mid (II), or late (III) S phase as previously described (Wu et al., 2005 blue right-pointing triangle

) (Figure 3C). There was a moderate decrease in the number of shCHD4 cells displaying patterns of mid S phase, suggesting that lack of NuRD complex results in defects in S phase progression (Figure 3C).

To determine the kinetics of S phase progression in the absence of NuRD complex, we synchronized CTRL, shCHD4, and shMBD3 cells at the G1/S boundary, released, and collected cells for analysis of DNA content and replication (by pulse labeling with BrdU prior to collection). At 3 h after release, all transduced cells were able to enter S phase at a similar rate (Supplemental Figure S3, B and C). However, at later time points (4.5 and 6 h), cells lacking CHD4 or MBD3 did not transition to late S phase at the same rate as CTRL cells, indicating that NuRD complex facilitates the transition from mid to late S phase (Figure 3D and Supplemental Figure S3C).

Replication progression can be impeded by an inability to remove histones in front of the replication fork or to load nucleosomes behind the fork (Groth et al., 2007a blue right-pointing triangle

). A change in nucleosome disassembly/reassembly resulting in replication stress can lead to uncoupling of DNA polymerase from the replicative DNA helicase (Jasencakova et al., 2010 blue right-pointing triangle

). To ascertain the incidence of replication stress in the absence of NuRD complex, we compared localization of Rad51 in CTRL and shCHD4 cells. We observed a significant increase in Rad51 nuclear staining, as well as in formation of nuclear foci, suggesting replication stress and altered fork progression (Figure 3E).

Although completion of DNA replication is delayed, cells lacking NuRD complex are able to complete replication as determined by copy number analysis, demonstrating equivalent abundance of both an early-replicating (glyceraldehyde 3-phosphate dehydrogenase [GAPDH]) and a late-replicating (Sat2) genomic region (Supplemental Figure S3D). These results suggest that although NuRD complex is dispensable for completion of replication, it is critical for normal kinetics of S phase progression.

An ATM-dependent intra–S phase checkpoint is activated in the absence of CHD4

Chromatin structure can be altered by many conditions, including hypotonic growth and treatment with trichostatin A (TSA) or chloroquine (Bakkenist and Kastan, 2003 blue right-pointing triangle

). Such structural defects could result in changes in S phase progression similar to those observed in the absence of NuRD complex. To test this model, we synchronized cells at the G1/S boundary, released into TSA, and monitored progression by flow cytometry. TSA delayed the early to late S phase transition, similar to NuRD complex depletion (Figure 4A and Supplemental Figure S4A). These data predict that cells lacking NuRD complex contain altered chromatin structures that trigger a chromatin quality checkpoint, altering S phase progression. Due to transcriptional repression of ATR in Ramos cells as part of the normal biological program of germinal center B lymphocytes, we focused on components of the ATM signaling pathway (Supplemental Figure S4B). Five days after transduction, an increase in phosphorylated ATM and CHK2 was detected in shCHD4 cells, indicating activation of the ATM signaling pathway (Figure 4, B and C). Furthermore, a marker of S phase stress, histone H3 lysine 56 acetylation (H3K56Ac), was also increased (Figure 4C). This was not due to changes in HDAC activity in the absence of CHD4, as total acetylation of H3 was unchanged (Supplemental Figure S4C). Furthermore, we observed destabilization of CDC25A consistent with altered S phase progression (Figure 4D). In the presence of caffeine, CTRL and shCHD4 cells progressed through S phase at similar rates, confirming that activation of an ATM-dependent checkpoint was responsible for the observed S phase delay (Figure 4E).

FIGURE 4:

Activation of an ATM-dependent intra–S phase checkpoint in cells lacking NuRD complex. (A) Distribution of cells during S phase after treatment with either ethanol (EtOH) or 10 μM TSA. Each value represents the mean ± SD of three (more ...)

We hypothesized that ATM activation was due to altered chromatin structure rather than double-stranded DNA damage. To test this hypothesis, we examined levels of markers of double-strand breaks, γH2AX and phosphorylated serine 14 of histone H2B (H2BS14P), and observed no detectible changes (Supplemental Figure S4, D and E). In addition, inhibition of MRE11, a component of the MRN double-strand break repair complex, had no effect on the slow-proliferation phenotype of CHD4-depleted cells (Supplemental Figure S4F; Dupre et al., 2008 blue right-pointing triangle

). These data support the conclusion that defects in chromatin structure resulting from lack of CHD4 are sensed by the ATM intra–S phase checkpoint, resulting in delayed transition from early to late S phase (Figure 5).

FIGURE 5:

Mi-2/NuRD complex depletion in germinal center B cells leads to alterations in chromatin, checkpoint activation, and delayed progression through S phase. Disruption of pericentric heterochromatin higher-order structure results in activation of ATM, as (more ...)

DISCUSSION

It has been speculated that Mi-2/NuRD complex participates in chromatin assembly due to the unique enzymatic properties of the complex, as well as to its localization to heterochromatin during S phase (Wade et al., 1998 blue right-pointing triangle

; Helbling Chadwick et al., 2009 blue right-pointing triangle

). In this study, we provide evidence that Mi-2/NuRD complex function is critical for replication of higher-order chromatin structure during S phase, as evidenced by aberrant structures at pericentric satellite repeats and accumulation of molecular markers of chromatin decondensation. These chromatin structural defects resulting from loss of CHD4/Mi-2β or MBD3 are manifested in a slow-growth phenotype with delayed S phase progression and activation of an ATM-dependent intra–S phase checkpoint. We observe the activation of ATM and loss of heterochromatin in two different germinal center B-cell lines, Ramos and Raji, indicating that the effects we document are not cell line specific (Supplemental Figure S5). Our data suggest that the initiating signal for checkpoint activation is a physical defect in chromatin structure, implying the presence of a chromatin quality checkpoint in addition to the G2/M chromosome integrity checkpoint (Figure 5).

Chromosomal quality control prior to the completion of DNA synthesis would permit the cell to pause and correct chromatin assembly defects at early replicons prior to initiation of late replication forks. Given the complex nature of higher-order chromatin structures in mammals and the close juxtaposition of unique sequence regions with repetitive DNA, it seems plausible that extensive quality control measures might be used to ensure architectural integrity and appropriate functional partitioning of the genome. Manipulation of components of both chromatin assembly machinery and chromatin-modifying enzymes results in defects in S phase progression, activation of intra–S phase checkpoint, and changes in chromatin structure, supporting our hypothesis that improper histone modifications and alterations in chromatin structure are detrimental (Bakkenist and Kastan, 2003 blue right-pointing triangle

; Ye et al., 2003 blue right-pointing triangle

; Bhaskara et al., 2008 blue right-pointing triangle

; Quivy et al., 2008 blue right-pointing triangle

). Furthermore, the presence of multiple signaling pathways suggests an intimate relationship between chromatin assembly and cell cycle control, including mediation of Asf1 function by both Chk2 and the Tlk1 signaling pathway (Emili et al., 2001 blue right-pointing triangle

; Hu et al., 2001 blue right-pointing triangle

; Groth et al., 2003 blue right-pointing triangle

). Using an ATM-dependent pathway to survey alterations in chromatin structure could serve as an efficient mechanism to prevent fork progression in the absence of appropriate chromatin assembly, which could potentially leave DNA vulnerable to rearrangements, nuclease degradation, or formation of secondary structures that can be read as DNA damage (Lambert and Carr, 2005 blue right-pointing triangle

; Groth et al., 2007a blue right-pointing triangle

, 2007b

; Quivy et al., 2008 blue right-pointing triangle

Multiple SNF2 superfamily ATPase enzymes have been documented to have similar functions in chromatin remodeling and have been implicated as critical to the integrity of pericentric heterochromatin (Collins et al., 2002 blue right-pointing triangle

; Gendrel et al., 2002 blue right-pointing triangle

; Xue et al., 2003 blue right-pointing triangle

; Yan et al., 2003 blue right-pointing triangle

; Poot et al., 2004 blue right-pointing triangle

; Bourgo et al., 2009 blue right-pointing triangle

; Cohen et al., 2010 blue right-pointing triangle

; Cohet et al., 2010 blue right-pointing triangle

). This apparent paradox could result from multiple scenarios that are not mutually exclusive. It is conceivable that different cell types use different combinations of SNF2 ATPases in the process of chromatin maturation at these structures, depending on the local chromatin environment. Multiple histone modifications, as well as patterns of DNA methylation, are critical for defining specific types of heterochromatin. Data from our previous work describe three cell-type-specific subclasses of pericentric heterochromatin as defined by enrichment of H3K9me3, H3K27me3, and H4K20me3 alone or in combination (Helbling Chadwick et al., 2009 blue right-pointing triangle

). These variations in chromatin composition could result in recruitment of different SNF2 ATPases. Alternatively, the process of replicating pericentric heterochromatin may be staged, with each stage requiring a different ATPase subunit. Studies of the ISWI complex in S phase progression have demonstrated that SNF2H, ACF1, and WSTF are critical for decondensation of heterochromatin ahead of the replication fork, whereas our current data are more compatible with a direct role for CHD4 in assembly of higher-order structure(s) following fork progression (Figure 5; Collins et al., 2002 blue right-pointing triangle

; Poot et al., 2004 blue right-pointing triangle

; Helbling Chadwick et al., 2009 blue right-pointing triangle

Maintenance of genome integrity is an essential process facilitated in eukarya by the nucleoprotein structures of chromatin. Multiple disease states result from mutation or aberrant function of enzymes dedicated to formation and/or maintenance of normal chromatin architecture, including the Mi-2/NuRD complex (Sillibourne et al., 2007 blue right-pointing triangle

; Pegoraro et al., 2009 blue right-pointing triangle

; Chou et al., 2010 blue right-pointing triangle

; Cohet et al., 2010 blue right-pointing triangle

; Larsen et al., 2010 blue right-pointing triangle

; Misteli, 2010 blue right-pointing triangle

; Polo et al., 2010 blue right-pointing triangle

; Smeenk et al., 2010 blue right-pointing triangle

). Our results highlight the quality control processes engaged to monitor appropriate chromatin assembly to ensure that cells stably maintain their genomes.

MATERIALS AND METHODS

Cell culture

Ramos and Raji cells were purchased from the American Type Culture Collection (Rockville, MD) and maintained in RPMI 1640 medium (Life Technologies, Carlsbad, CA) supplemented with 10% fetal bovine serum (FBS). 293T lentiviral packaging cells were maintained in DMEM/F12 medium (Life Technologies) supplemented with 10% FBS.

Short hairpin RNA–mediated depletion of CHD4 and MBD3

Generation of lentivirus was performed as previously described (Lai et al., 2010 blue right-pointing triangle

), using the following vectors: pGIPZ shCHD4 (V2LHS_14657), shMBD3 (V3LHS_392211), and pGIPZ empty (RHS4349) (Open Biosystems, Thermo Biosystems, Huntsville, AL). Fluorescence-activated cell sorting (FACS) based on green fluorescent protein (GFP) intensity was used (FACSVantage with Digital Option; BD Biosciences, San Diego, CA).

Western analysis

Total protein was extracted from GFP-positive cells using lysis buffer (8 M urea, 1% SDS, 0.125 M Tris, pH 6.8), and phosphorylated proteins were enriched using a PhosphoProtein Purification Kit (Qiagen, Valencia, CA). Total protein extract was analyzed by resolving 10 μg of protein or 50 μg of phosphoprotein lysate on SDS–PAGE gels and immunoblotted using the following antibodies: CHD4 (A301-081A; Bethyl Laboratories, Montgomery, TX), MBD3 (sc-9402; Santa Cruz Biotechnology, Santa Cruz, CA), actin (MAB1501; Chemicon, Millipore, Billerica, MA), ATR (sc-1887; Santa Cruz Biotechnology), H3 general (ab1791; Abcam, Cambridge, MA), H3 acetylation (06-599; Upstate, Millipore), γH2AX (05-636; Upstate, Millipore), H3K56Ac (39281; Active Motif, Carlsbad, CA), MTA3, cyclin B1 (sc-594, Santa Cruz Biotechnology), H3S10P (sc-8656-R; Santa Cruz Biotechnology), phospho-CHK2 (2197, Cell Signaling Technology, Beverly, MA), phospho-KAP-1 (S824, A300-767A-1; Bethyl Laboratories), CDC25A (ab2357; Abcam,), H2BS14P (07-191; Upstate, Millipore), and H2B general (07-371, Upstate, Millipore).

Immunofluorescence, fluorescence in situ hybridization, and imaging

Immunofluorescence and immuno-FISH were performed as previously described (Helbling Chadwick et al., 2009 blue right-pointing triangle

), using the following antibodies and probes: H3K9me3 (07-523; Millipore), MTA3 (Fujita et al., 2004 blue right-pointing triangle

), BrdU (347580; BD Biosciences), H3S10P (sc-8656-R; Santa Cruz Biotechnology), H4K20me3 (39180; Active Motif), Rad51 (ab213; Abcam), P-ATM (S1981) (10H11.E12; Cell Signaling Technology), Classical Satellite (D1Z1) (LPE-001; Rainbow Scientific, Windsor, CT), and Chromosome 10 alpha satellite (LPE-010; Rainbow Scientific). To expose BrdU antigens for detection of actively replicating genomic regions, fixed and blocked cells were immersed in 4 N HCl for 10 min, followed by extensive washing in phosphate-buffered saline prior to the addition of BrdU antibody.

Images were collected on a Zeiss Axiovert 200 imaging system equipped with an Axiocam MR digital camera controlled by AxioVision software (Zeiss, Thornwood, NY). Confocal images were collected on a Zeiss LSM 510 UV laser scanning confocal microscope controlled by Zeiss LSM software. Maximum-intensity projections were derived from Z-series images taken at 1-μm steps and rendered around a single x-axis plane. Images were analyzed using Photoshop CS2 (Adobe, San Jose, CA) and Zeiss LSM software. H3K9me3 and H4K20me3 foci analysis was performed using MetaMorph imaging software (version 7.7.1; Molecular Devices, Downington, PA) to count the number of nuclei in an image in addition to the number of H3K9me3 or H4K20me3 foci in each cell. First nuclei were counted with the Integrated Morphology Analysis feature using a threshold (>50 units) to separate each nucleus. In instances in which multiple nuclei overlapped, manual separation was performed with the cut tool. The threshold was then reset, and a morphological TopHat filter (100 pixels²) was applied to identify the heterochromatin. Before measuring the number of heterochromatin spots by “integrated morphometry,” a low threshold (<10 units) was applied to filter low-intensity noise. Log data were then transferred to Excel sheets (Microsoft, Redmond, WA). Student's t tests were used to determine statistical significance of all images analyzed.

Cell synchronization and FACS analysis

Two days after transduction, Ramos cells were synchronized as previously described (Helbling Chadwick et al., 2009 blue right-pointing triangle

). After synchronization, cells were released into medium either in the presence or absence of 0.5 mM caffeine or 10 μM TSA (Sigma-Aldrich, St. Louis, MO). At each time point, cells were pulsed with 10 μM BrdU for 15 min, fixed, and stained using the APC BrdU Flow Kit (BD Biosciences). Cells were analyzed using the BD LSR II Flow Cytometer System. Analysis of flow data were performed using Flowjo software (TreeStar, Ashland, OR).

Nucleic acid extraction

Total RNA was extracted from GFP-positive cells 5 d after transduction using the RNeasy Mini Kit (Qiagen). cDNA was synthesized as described (Fujita et al., 2004 blue right-pointing triangle

). Expression analysis of NuRD complex members was performed using Quantitect primer assays (Qiagen): MTA3 (QT00064988), CHD4 (QT00025522), CHD3 (QT00007063), MBD2 (QT00007084), MBD3 (QT00035252), and GAPDH (QT01192646). Total genomic DNA was extracted from GFP-positive cells 7 d after transduction using the DNeasy Mini Kit (Qiagen). Copy-number analysis was performed as described (Quivy et al., 2008 blue right-pointing triangle

), using the following primer sets: Satellite 2, CATCGAATGGAAATGAAAGGAGTC and ACCATTGGATGATTGCAGTCAA; GAPDH, GCCCCCGGTTTCTATAAATTG and GGCGACGCAAAAGAAGATG

MNase digestion

Cells were incubated in nuclear isolation buffer (150 mM NaCl, 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid, pH 7.5, 1.5 mM MgCl₂, 10 mM KCl, 0.5% Nonidet P-40, 0.5 mM dithiothreitol) at 4°C to release nuclei. Nuclei were resuspended in MNase digestion buffer (0.32 M sucrose, 50 mM Tris-HCl, pH 7.4, 4 mM MgCl₂, 1 mM CaCl₂) to a final concentration of 1 μg/ml as determined by A₂₆₀. Amounts of 0.01, 0.05, 0.1, and 0.5 μg/ml MNase were added, and nuclei were digested for 5 min at 37°C before quenching with 10 mM EDTA. Amounts of 0.02% SDS, 1 μg of proteinase K, and 1 μg of RNase A were added prior to phenol extraction and ethanol precipitation of genomic DNA. A total of 1 μg of DNA was fractionated by agarose electrophoresis.

Supplementary Material

Supplemental Materials

Click here to view.

Acknowledgments

We gratefully acknowledge C. J. Tucker, Agnus Janoshazi, and the Fluorescence Microscopy and Imaging Center, National Institute of Environmental Health Sciences, for assistance with microscopy and quantitation of images. We thank Carl Bortner, Maria Sifre, and the Flow Cytometry Center, National Institute of Environmental Health Sciences, for assistance with flow cytometry. This work was substantially improved by critical comments on the manuscript and discussion with Karen Adelman, Aleksandra Adomas, Archana Dhasarathy, Guang Hu, and Anne Lai. This work was supported by the Intramural Research Program of the National Institute of Environmental Health Sciences, National Institutes of Health (Project Z01ES101965 to P.A.W.).

Abbreviations used:


BrdU	bromodeoxyuridine

CTRL	control

FISH	fluorescence in situ hybridization

H3K9me3	histone H3 lysine 9 trimethylation

H3K27me3	histone H3 lysine 27 trimethylation

H4K20me3	histone H4 lysine 20 trimethylation

HP-1	heterochromatin protein 1

MNase	micrococcal nuclease

Sat2	satellite 2

shCHD4	CHD4 short hairpin RNA

shMBD3	MBD3 short hairpin RNA

TSA	trichostatin A

Footnotes

This article was published online ahead of print in MBoC in Press (http://www.molbiolcell.org/cgi/doi/10.1091/mbc.E11-03-0258) on July 7, 2011.

REFERENCES

Bakkenist CJ, Kastan MB. DNA damage activates ATM through intermolecular autophosphorylation and dimer dissociation. Nature. 2003;421:499–506. [PubMed]
Bannister AJ, Zegerman P, Partridge JF, Miska EA, Thomas JO, Allshire RC, Kouzarides T. Selective recognition of methylated lysine 9 on histone H3 by the HP1 chromo domain. Nature. 2001;410:120–124. [PubMed]
Bhaskara S, Chyla BJ, Amann JM, Knutson SK, Cortez D, Sun ZW, Hiebert SW. Deletion of histone deacetylase 3 reveals critical roles in S phase progression and DNA damage control. Mol Cell. 2008;30:61–72. [PMC free article] [PubMed]
Bourgo RJ, et al. SWI/SNF deficiency results in aberrant chromatin organization, mitotic failure, and diminished proliferative capacity. Mol Biol Cell. 2009;20:3192–3199. [PMC free article] [PubMed]
Chou DM, Adamson B, Dephoure NE, Tan X, Nottke AC, Hurov KE, Gygi SP, Colaiacovo MP, Elledge SJ. A chromatin localization screen reveals poly (ADP ribose)-regulated recruitment of the repressive polycomb and NuRD complexes to sites of DNA damage. Proc Natl Acad Sci USA. 2010;107:18475–18480. [PubMed]
Cohen SM, Chastain PD 2nd, Rosson GB, Groh BS, Weissman BE, Kaufman DG, Bultman SJ. BRG1 co-localizes with DNA replication factors and is required for efficient replication fork progression. Nucleic Acids Res. 2010;38:6906–6919. [PMC free article] [PubMed]
Cohet N, Stewart KM, Mudhasani R, Asirvatham AJ, Mallappa C, Imbalzano KM, Weaver VM, Imbalzano AN, Nickerson JA. SWI/SNF chromatin remodeling enzyme ATPases promote cell proliferation in normal mammary epithelial cells. J Cell Physiol. 2010;223:667–678. [PMC free article] [PubMed]
Collins N, Poot RA, Kukimoto I, Garcia-Jimenez C, Dellaire G, Varga-Weisz PD. An ACF1-ISWI chromatin-remodeling complex is required for DNA replication through heterochromatin. Nat Genet. 2002;32:627–632. [PubMed]
Dupre A, et al. A forward chemical genetic screen reveals an inhibitor of the Mre11-Rad50-Nbs1 complex. Nat Chem Biol. 2008;4:119–125. [PMC free article] [PubMed]
Emili A, Schieltz DM, Yates JR, 3rd, Hartwell LH. Dynamic interaction of DNA damage checkpoint protein Rad53 with chromatin assembly factor Asf1. Mol Cell. 2001;7:13–20. [PubMed]
Fujita N, Jaye DL, Geigerman C, Akyildiz A, Mooney MR, Boss JM, Wade PA. MTA3 and the Mi-2/NuRD complex regulate cell fate during B lymphocyte differentiation. Cell. 2004;119:75–86. [PubMed]
Gendrel AV, Lippman Z, Yordan C, Colot V, Martienssen RA. Dependence of heterochromatic histone H3 methylation patterns on the Arabidopsis gene DDM1. Science. 2002;297:1871–1873. [PubMed]
Groth A, Corpet A, Cook AJ, Roche D, Bartek J, Lukas J, Almouzni G. Regulation of replication fork progression through histone supply and demand. Science. 2007a;318:1928–1931. [PubMed]
Groth A, Lukas J, Nigg EA, Sillje HH, Wernstedt C, Bartek J, Hansen K. Human Tousled like kinases are targeted by an ATM- and Chk1-dependent DNA damage checkpoint. EMBO J. 2003;22:1676–1687. [PubMed]
Groth A, Rocha W, Verreault A, Almouzni G. Chromatin challenges during DNA replication and repair. Cell. 2007b;128:721–733. [PubMed]
Helbling Chadwick L, Chadwick BP, Jaye DL, Wade PA. The Mi-2/NuRD complex associates with pericentromeric heterochromatin during S phase in rapidly proliferating lymphoid cells. Chromosoma. 2009;118:445–457. [PMC free article] [PubMed]
Henikoff S. Heterochromatin function in complex genomes. Biochim Biophys Acta. 2000;1470:O1–O8. [PubMed]
Hu F, Alcasabas AA, Elledge SJ. Asf1 links Rad53 to control of chromatin assembly. Genes Dev. 2001;15:1061–1066. [PubMed]
Jasencakova Z, Scharf AN, Ask K, Corpet A, Imhof A, Almouzni G, Groth A. Replication stress interferes with histone recycling and predeposition marking of new histones. Mol Cell. 2010;37:736–743. [PubMed]
Kaji K, Nichols J, Hendrich B. Mbd3, a component of the NuRD co-repressor complex, is required for development of pluripotent cells. Development. 2007;134:1123–1132. [PubMed]
Lachner M, O'Carroll D, Rea S, Mechtler K, Jenuwein T. Methylation of histone H3 lysine 9 creates a binding site for HP1 proteins. Nature. 2001;410:116–120. [PubMed]
Lai AY, et al. DNA methylation prevents CTCF-mediated silencing of the oncogene BCL6 in B cell lymphomas. J Exp Med. 2010;207:1939–1950. [PMC free article] [PubMed]
Lambert S, Carr AM. Checkpoint responses to replication fork barriers. Biochimie. 2005;87:591–602. [PubMed]
Larsen DH, et al. The chromatin-remodeling factor CHD4 coordinates signaling and repair after DNA damage. J Cell Biol. 2010;190:731–740. [PMC free article] [PubMed]
Meselson M, Stahl FW. The replication of DNA in Escherichia coli. Proc Natl Acad Sci USA. 1958;44:671–682. [PubMed]
Misteli T. Higher-order genome organization in human disease. Cold Spring Harb Perspect Biol. 2010;2:a000794. [PMC free article] [PubMed]
Nielsen AL, Oulad-Abdelghani M, Ortiz JA, Remboutsika E, Chambon P, Losson R. Heterochromatin formation in mammalian cells: interaction between histones and HP1 proteins. Mol Cell. 2001;7:729–739. [PubMed]
Pegoraro G, Kubben N, Wickert U, Gohler H, Hoffmann K, Misteli T. Ageing-related chromatin defects through loss of the NURD complex. Nat Cell Biol. 2009;11:1261–1267. [PMC free article] [PubMed]
Polo SE, Kaidi A, Baskcomb L, Galanty Y, Jackson SP. Regulation of DNA-damage responses and cell-cycle progression by the chromatin remodelling factor CHD4. EMBO J. 2010;29:3130–3139. [PMC free article] [PubMed]
Poot RA, Bozhenok L, van den Berg DL, Steffensen S, Ferreira F, Grimaldi M, Gilbert N, Ferreira J, Varga-Weisz PD. The Williams syndrome transcription factor interacts with PCNA to target chromatin remodelling by ISWI to replication foci. Nat Cell Biol. 2004;6:1236–1244. [PubMed]
Quivy JP, Gerard A, Cook AJ, Roche D, Almouzni G. The HP1-p150/CAF-1 interaction is required for pericentric heterochromatin replication and S-phase progression in mouse cells. Nat Struct Mol Biol. 2008;15:972–979. [PubMed]
Rice JC, Briggs SD, Ueberheide B, Barber CM, Shabanowitz J, Hunt DF, Shinkai Y, Allis CD. Histone methyltransferases direct different degrees of methylation to define distinct chromatin domains. Mol Cell. 2003;12:1591–1598. [PubMed]
Sillibourne JE, Delaval B, Redick S, Sinha M, Doxsey SJ. Chromatin remodeling proteins interact with pericentrin to regulate centrosome integrity. Mol Biol Cell. 2007;18:3667–3680. [PMC free article] [PubMed]
Smeenk G, Wiegant WW, Vrolijk H, Solari AP, Pastink A, van Attikum H. The NuRD chromatin-remodeling complex regulates signaling and repair of DNA damage. J Cell Biol. 2010;190:741–749. [PMC free article] [PubMed]
Wade PA, Jones PL, Vermaak D, Wolffe AP. A multiple subunit Mi-2 histone deacetylase from Xenopus laevis cofractionates with an associated Snf2 superfamily ATPase. Curr Biol. 1998;8:843–846. [PubMed]
Weber M, Schubeler D. Genomic patterns of DNA methylation: targets and function of an epigenetic mark. Curr Opin Cell Biol. 2007;19:273–280. [PubMed]
Wu R, Terry AV, Singh PB, Gilbert DM. Differential subnuclear localization and replication timing of histone H3 lysine 9 methylation states. Mol Biol Cell. 2005;16:2872–2881. [PMC free article] [PubMed]
Xue Y, Gibbons R, Yan Z, Yang D, McDowell TL, Sechi S, Qin J, Zhou S, Higgs D, Wang W. The ATRX syndrome protein forms a chromatin-remodeling complex with Daxx and localizes in promyelocytic leukemia nuclear bodies. Proc Natl Acad Sci USA. 2003;100:10635–10640. [PubMed]
Yan Q, Huang J, Fan T, Zhu H, Muegge K. Lsh, a modulator of CpG methylation, is crucial for normal histone methylation. EMBO J. 2003;22:5154–5162. [PubMed]
Ye X, Franco AA, Santos H, Nelson DM, Kaufman PD, Adams PD. Defective S phase chromatin assembly causes DNA damage, activation of the S phase checkpoint, and S phase arrest. Mol Cell. 2003;11:341–351. [PubMed]
Ziv Y, Bielopolski D, Galanty Y, Lukas C, Taya Y, Schultz DC, Lukas J, Bekker-Jensen S, Bartek J, Shiloh Y. Chromatin relaxation in response to DNA double-strand breaks is modulated by a novel ATM- and KAP-1 dependent pathway. Nat Cell Biol. 2006;8:870–876. [PubMed]

Articles from Molecular Biology of the Cell are provided here courtesy of
American Society for Cell Biology