PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
J Immunol. Author manuscript; available in PMC 2012 September 1.
Published in final edited form as:
PMCID: PMC3159830
NIHMSID: NIHMS307058

AID binds cooperatively with UNG and Msh2-Msh6 to Ig switch regions dependent upon the AID C terminus*

Abstract

Activation-induced cytidine deaminase (AID) is induced in B cells during an immune response and is essential for both class switch recombination (CSR) and somatic hypermutation (SHM) of antibody genes. The C terminal 10 amino acids of AID are required for CSR but not for SHM, although their role in CSR is unknown. Using retroviral transduction into mouse splenic B cells, we show that the C terminus is not required for S region DSBs, and therefore functions downstream of DSBs. Using chromatin immunoprecipitation, we show that AID binds cooperatively with UNG and the mismatch repair proteins Msh2-Msh6 to Ig Sμ and Sγ3 regions, and this depends on the C terminus and the deaminase activity of AID. We also show that mismatch repair does not contribute to the efficiency of CSR in the absence of the AID C terminus. Although it has been demonstrated that both UNG and Msh2-Msh6 are important for introduction of S region DSBs, our data suggest that the ability of AID to recruit these proteins is important for DSB resolution, perhaps by directing the S region DSBs toward accurate and efficient CSR via non-homologous end joining.

Introduction

AID initiates both CSR and SHM in B cells during an immune response. AID deaminates dCs to dUs, initiating DNA repair processes that lead to DNA breaks in Ig switch (S) regions and to SHM in Ig variable region genes (1, 2). The C terminus of AID is required for CSR but not for somatic SHM (3, 4). However, the role of the AID C terminus in CSR is unknown.

The structure of AID is well conserved; mouse and human AID have 92% peptide sequence identity (5). AID has a domain required for SHM but not for CSR between amino acids 13 and 23, a catalytic (deaminase) domain between amino acids 56 and 94, and a domain required for CSR but not SHM between amino acids 182 and 198 (3, 4, 6, 7). It has a robust chromosome region maintenance-1 (CRM1)-dependent nuclear export signal (NES) also located at the C-terminus between amino acids 190 and 198 (8-10). Nuclear localization of AID appears to be tightly regulated, since AID predominantly resides in the cytoplasm, and nuclear AID undergoes rapid ubiquitin-mediated proteasomal degradation (11). The half-life of nuclear AID is 3 times shorter than that of cytoplasmic AID. However, nuclear export is not required for CSR, as mouse AIDF198A is not exported from nuclei, and yet CSR and SHM are only modestly reduced in cells expressing this mutant (9). Also, many AID mutants with substitution mutations in the C terminus that retain a functional NES are unable to potentiate CSR (12); this has been suggested to be due to interaction with an unidentified factor(s) (13).

During CSR, the dUs in S regions generated by AID are converted into DSBs in the donor (Sμ) and acceptor Sx regions (1). The dU bases are excised by uracil-N-glycosylase 2 (UNG) and deficiency in UNG causes a dramatic reduction in S region DSBs and in CSR (14-16). Apurinic/apyrimidinic endonuclease 1 and 2 (APE1/2) have been shown to be important for S region DSBs during CSR (17); these enzymes can nick the abasic sites generated by UNG activity. When the nicked sites on opposite DNA strands are sufficiently near, they can form DSBs, which can be recombined with DSBs in another S region. Recombination occurs predominantly by non-homologous end-joining (NHEJ), resulting in CSR (18).

If the single-strand breaks (SSBs) created by AID-UNG-APE activities are too far apart to spontaneously form a DSB, mismatch repair (MMR) proteins can process the SSBs into DSBs during CSR (19-21). The Msh2-Msh6 heterodimer binds G:U mismatches (22), and recruits Mlh1-Pms2 heterodimers (23). Subsequently Exonuclease 1 (24) loads at SSBs generated by APE1/2 activity, most likely excises past the U:G mismatch until reaching a SSB on the other DNA strand, thus creating a DSB with staggered ends. DNA polymerase can then fill in the staggered ends to generate a blunt-ended DSB or a DSB with a small overhang that can be recombined by NHEJ (20).

Mouse B cells expressing ΔAID (C-terminal 10 amino acids deleted, i.e., AIDΔ189-198) have greatly reduced CSR (~10% of wild type, WT), but have normal levels of AID-induced mutations in Ig Sμ regions (3). Thus, AID targeting to the Sμ region is retained in this mutant. Furthermore, DSBs are detected in both donor and acceptor S regions in activated aid-/- CH12F3-2 B lymphoma cells expressing this mutant (25). In fact the DSBs appeared to be somewhat increased relative to cells expressing full-length AID, and there was also a 10-fold increase in c-myc-IgH translocations. It has also been shown that the in vitro deaminase activity of ΔAID is at least as high as full-length AID (26, 27). Taken together, these data indicate that the C terminus of AID is not needed for introduction of dUs and DSBs in S regions. To explain these data, it is possible that the C terminus of AID regulates the timing of DSB creation and repair, and/or interacts with proteins that direct S region DSBs toward accurate NHEJ and CSR.

Although the mutation frequency in the Sμ region is unchanged in ΔAID-expressing cells, the frequency of transition mutations relative to transversions at G:C bp within Sμ is increased by two fold compared to that of WT AID (3). This is similar to the effect on V region SHM of treating cells with an UNG inhibitor (28), and suggests that UNG activity might be overwhelmed or otherwise compromised in ΔAID-expressing cells. We hypothesized that the AID C terminus might be involved in recruiting UNG and other proteins that work together to convert dU's to DSBs, and that these interactions are important for directing DSBs toward proper CSR.

To begin to address these possibilities, in this study we asked if AID interacts with UNG via its C-terminus. We find that UNG interacts with full-length AID but not ΔAID, and this interaction is only detected in association with Ig S regions. Because MMR proteins also recognize dU in DNA, in the form of U:G mismatches, we also asked if MMR proteins interact with AID via its C-terminus, in association with S regions. Indeed, we find that Msh2-Msh6 interacts with AID when associated with S regions and that this depends on the AID C terminus. Finally, we show that the interactions between AID and UNG and between AID and MMR proteins increase the stability of binding of AID, UNG, and Msh2-Msh6 to S regions, and that in cells expressing ΔAID, MMR does not contribute to CSR.

Materials and Methods

Mice

All mouse strains were extensively (≥8 generations) backcrossed to C75BL/6. AID-deficient mice were obtained from T. Honjo (Kyoto University, Kyoto, Japan) (29). Msh2-deficient mice were obtained from T. Mak, Univ. of Toronto CA (30). UNG-deficient mice were obtained from D. Barnes and T. Lindahl, London Research Institute, UK (31). Msh6-deficient mice were obtained from W. Edelmann (32). Double knockout mice were bred by mating heterozygous mice. Mice were housed in the Institutional Animal Care and Use Committee-approved specific pathogen-free facility at the University of Massachusetts Medical School; these mice were used according to the guidelines from University of Massachusetts Medical School Animal Care and Use committee. For each experiment, splenic B cells were isolated from littermates.

Antibodies

Primary antibodies were for: ER (Santa Cruz Biotechnology sc-8002, lots G2307 and D0110); UNG (rabbit anti-peptide amino acids 280-295 from mouse UNG, prepared by Anaspec Corp); MSH2 (sc-494), MSH6 (sc-10798), and GAPDH (sc-25778). For immunoblotting, secondary antibodies used were goat-anti-rabbit (sc-2004) or donkey anti-mouse-horseradish peroxidase (sc-2020) (all from Santa Cruz Biotechnology).

Retroviral constructs

pMX-PIE-AID-FLAG-ER-IRES-GFP-puro and pMX-PIE-ΔAID-FLAG-ER-IRES-GFP-puro (3) were received from Drs V. Barretto and M. Nussenzweig (The Rockefeller University, NY). To create the control retrovirus: pMX-PIE-ER-IRES-GFP, the ER gene from RV-AID-ER was PCR amplified with a forward primer: 5’ GCCGGATCCCGCCATGTCTGCTGGAGACATGAGAGCT 3’; and a reverse primer: 5’ GGCCTCGAGGAGCTCAAGCTGTGGCAGGGAAACC 3’. The PCR product was digested with BamHI and XhoI, and inserted into BamHI- and XhoI-digested pMX-PIE vector containing IRES, GFP, and puromycin genes downstream of XhoI site. The construct was sequenced and we confirmed proper expression of the RV-ER construct by western blotting. To create the AIDH56R/E58Q-ER mutant, the AID gene was subcloned into Bluescript, mutated using Stratagene Quik-Change and then reinserted into pMX-PIE retroviral plasmid.

B cell purification and cultures

Mouse splenic B cells were isolated as previously described, by T cell depletion with antibody and complement (33). B cells were cultured at 105 cells/ml in 5% CO2. Lipopolysaccharide (LPS) (25 μg/ml), anti-IgD dextran (α-δ-dex) (0.3 ng/ml) and IL-4 (20 ng/ml) were used to induce class switch recombination to IgG1; LPS and α-™-dex were used to induce IgG3 switching. Human BAFF/BLyS (50 ng/ml)(Human Genome Sciences) was included in all cultures.

Cell cycle analysis

To analyze cell cycle progression of cells expressing AID-ER, ΔAID-ER, or ER, aid-/- mouse splenic B cells were transduced with retroviruses after culture for 48 hours. Cells were harvested one day later, and flow cytometry was used to determine GFP expression levels. Cells were stained with PI and analyzed by flow cytometry to study the cell cycle progression. For this experiment we used cultures in which more than 95% of cells expressed GFP.

Cell proliferation assay

Proliferation of aid-/- B cells expressing AID-ER, ΔAID-ER, or ER was assayed by staining freshly isolated aid-/- mouse splenic B cells with PKH26 (Sigma Corp), as prescribed in the product manual. Cells were then cultured for 48 hours, and infected with retroviruses expressing AID-ER, ΔAID-ER, or ER. PKH26 fluorescence was assayed by live cell FACS two days after infection.

Production of retroviruses in Phoenix-E cells

We seeded 3×106 Phoenix-E cells per 10 cm plate with 10 ml of complete RPMI1640 medium with heat-inactivated serum 24 hrs before transfection with the retroviral constructs. To transfect the retroviral constructs, Fugene 6 (Roche) was brought to room-temp and mixed well before use. 27 μL of Fugene 6 was added to 600 μL of serum free RPMI1640 at room temp. Fugene 6 was pipetted directly into the medium without contacting the walls of the plastic tube, mixed, and incubated at room-temperature for 5 min. Six μg of retroviral plasmid construct and 3 μg pCL-Eco plasmid (expressing RV-Gag, Pol, and Env proteins) were added, mixed, and incubated for 45 min at room-temp. The mixture was then added drop-wise to a 10 cm plate containing Phoenix-E cells. The plate was swirled to ensure even distribution. The plate was incubated at 37°C for 24 hrs, and moved to a 32°C incubator, which resulted in a higher titer of virus production. Transfection efficiency of Phoenix cells was checked with FACS for GFP. Cultures that have ~65-90% GFP+ cells yielded good to excellent virus titers. Virus supernatant was collected 2 days after transfection, and replaced with 10 ml of fresh complete RPMI1640 with heat-inactivated serum. The supernatant was then centrifuged at 1200 rpm for 5 min. Virus was harvested 2 more times every 48 hrs thereafter. The supernatant was used immediately or snap-frozen in liquid nitrogen before storing at -80°C. Since the virus-titer decreases at each freeze-thaw cycle, appropriate aliquots were made before they were frozen.

Retroviral infection of B cells

4 ml of B cells at 105/ml were cultured for two days in 6-well plates or 2 ml in 24-well plates in IgG1 or IgG3 CSR conditions. Each culture was split into two cultures on day 2. The culture plates were centrifuged at 1200 rpm for 5 min after the split in order to remove the supernatant without removing the cells. The cells on the plate were re-suspended in the retrovirus cocktail containing: virus supernatant 1 ml, RPMI1640 1ml, heat-inactivated FBS 30 μL, LPS (25 μg/ml), IL4 (20 ng/ml) (not included in IgG3 switching conditions), BLyS (50 ng/ml), anti-δ-dex (0.3 ng/ml), 4OHT (Sigma) (1 μM) (3) and polybrene (10 μg/mL) (3). After 45 min at room temp in the cocktail, the cells were resuspended in the cocktail, and the culture plates centrifuged at 2000 rpm (Beckman-Coulter, Allegra-12R centrifuge) for 45 minutes at 20°C. The plates were returned to 37°C, 5% CO2 for 24 hrs.

CSR Assay and FACS analysis

To study CSR in cells expressing AID-ER, ΔAID-ER, or ER, we cultured 2 ml of B cells (105 per ml) for 2 days in IgG1 or IgG3 switching conditions described above, and infected these cells with retrovirus to express AID-ER, ΔAID-ER, or ER. Cells were treated with 1 μM OHT at time of infection. Cells were harvested 24 hr after infection and subjected to FACS staining and analysis as described previously (33), except that cells were not fixed in order to detect EGFP, and were stained with 7-AAD (BD-Bioscience) to allow us to gate out dead and dying cells. Statistical difference in CSR between different cultures was determined by a 2-tailed T test.

Chromatin immunoprecipitation (ChIP)

ChIP assays were performed as described previously (34). Live cells were isolated by flotation on Lympholyte M (Cedar Lane, Ontario Canada) 24 hrs after retroviral transduction. After recovery and washing twice, 2 × 107 live cells were resuspended in PBS, and were cross-linked with formaldehyde at a final concentration of 1% for 5 min at 37°C. Cross-linking was stopped by adjustment to 125 mM glycine, incubating 5 min at room temp. Cross-linked cells were sonicated on ice for 200 sec. Sonication was performed in 10 sec bursts, the sample was incubated for 15 sec in ice between each bursts. 106 cell equivalents were used per IP, and 105 cells were used for the input samples. To correct for this, ChIP results were divided by 10. Significance was calculated by a two-tailed T test. ChIP results were assayed by real time PCR using Sybr Green (Invitrogen), except for the first two experiments shown in Suppl Fig S4. Two or 3 PCRs were performed per ChIP. Primers for Sμ were: (forward) DK99 5’- AAC TAG GCT GGC TTA ACC GAG ATG-3’, (reverse) DK100 5’- GTC CAG TGT AGG CAG TAG AGT TTA-3’; Primers for Cμ were: (forward) DK46 5’-GTC AGT CCT TCC CAA ATG TCT TCC-3’, (reverse) DK47 5’- CTG GAA TGG GCA CAT GCA GAT CTT T-3’. Primers for Sγ3 were: (forward) 5’- ACA GGG TCC CAG GTT ATG CAG-3’; (reverse) 5’-GTC ACT CAC ACT GGC TTC CC-3’. Statistical significance was determined by a two-tailed T test.

In vitro transcription translation

The T7 promoter was fused to the genes encoding AID-ER, ΔAID-ER, ER, GST or GST-UNG. The constructs were then inserted into pCSR®4-TOPO (Invitrogen) plasmid. In vitro transcription and translation were performed using the PROTEINscript® II T7 Kit, as prescribed in the manufacturer's manual (Ambion). In vitro transcription and translation was optimized for comparable levels of expression of AID-ER, ΔAID-ER, and ER, and also for GST and GST-UNG.

GST Pull-down

Equal volume of GST or GST-UNG was added to each tube containing AID-ER, ΔAID-ER and ER in dilution buffer containing: PBS with Complete protease inhibitor cocktail (Roche), 200 μM phenylmethanesulfonylfluoride (PMSF), 200 μM sodium orthovanadate, 50 μM NaF, 2 μM β-glycerophosphate, 50 μM ZnCl2, 200 μg/ml ethidium bromide. The mixtures were incubated at 4°C for 12 hrs and then incubated with glutathione beads for another 2 hrs. The beads were spun down and then washed 3X with wash buffer. The wash buffer was made by adding 200 mM NaCl and 0.05% NP40 to the dilution buffer without ethidium bromide. The proteins were then eluted with elution buffer after the third wash. The eluates were then subjected to western blotting.

Genomic DNA preparation and linker ligation-mediated PCR (LM-PCR)

After culture for 24 hrs after RV infection, viable cells were isolated by flotation on Lympholyte M, cells were imbedded in low melt agarose plugs, DNA isolated and LM-PCR performed as described (16), with slight modifications. For linker ligation, 50 μl 1X ligase buffer was added to the 50 μl plugs which were then heated to 65°C to melt the agarose. 20 μl DNA (about 200,000 cell equivalents) was added to 2 μl T4 DNA Ligase (2 Weiss units, MBI Fermentas, Hanover, MD), 10 μl ds annealed linker in 1X ligase buffer, 3 μl 10x Ligase buffer and 30 μl dH20 and incubated overnight at 18°C. Linker was prepared by annealing 5 nmoles each of LMPCR. 1 ( 5 ’-GCGGTGACCCGGGAGATCTGAATTC-3’) and LMPCR.2 (5’-GAATTCAGATC-3’) in 300 μl 1X ligase buffer, which results in a ds oligo with a 14 nt ss overhang that can only ligate unidirectionally. Ligated DNA samples were heated at 70°C for 10 min, diluted 5x in dH20 and then assayed for gapdh DNA by PCR to adjust DNA input prior to LM-PCR. The primers 5'sμ (5’-GCAGAAAATTTAGATAAAATGGATACCTCAGTGG-3’), Sg3-AP: 5′-AACATTTCCAGGGACCCCGGAGGAG-3′; and CmuL2: 5′-CTGCGAGAGCCCCCTGTCTGATAAG-3′ were used in conjunction with linker primer (LMPCR.1) to amplify DNA breaks in Sμ, Sγ3, or Cμ respectively. Three-fold dilutions of input DNA (0.5, 1.5 and 4.5 μl for Sμ/Cμ LM-PCR, 1.5, 4.5 and 13.5 μl for Sγ3 LM-PCR) were amplified by HotStar Taq (Qiagen) using a touchdown PCR program (28 cycles after touchdown for Sμ LM-PCR and 35 cycles after touchdown for Sγ3 LM-PCR). PCR products were electrophoresed on 1.25% agarose gels and blotted onto nylon membranes (GeneScreen Plus, Perkin Elmer, Waltham, MA). Blots were hybridized with an Sμ-specific oligonucleotide probe (mu probe5’: 5’-AGGGACCCAGGCTAAGAAGGCAAT-3’) for 5’ Sμ LM-PCR , or Sγ 3-L P : 5′-GGACCCCGGAGGAGTTTCCATGATCCTGGG-3′ or Cμ: 5′-TGGCCATGGGCTGCCTAGCCCGGGACTTCCTG-3′ that had been end-labeled with [γ32P]-ATP. Semi-quantitative assessment of DSB frequency was achieved by densitometry scanning of autoradiographs, combining all 3 dose titration lanes for each mouse. For determination of the sites of DSBs, PCR products were cloned into pCR4-TOPO (Invitrogen, Carlsbad, CA).

RESULTS

Expression of ΔAID-ER or AID-ER does not alter cell cycle progression or cell proliferation

To test the role of the AID C terminus in CSR, we expressed full length AID or truncated AID lacking the C terminal 10 amino acids by retroviral transduction in activated aid-/- mouse splenic B cells. The retroviral constructs encode full-length AID or ΔAID (Δ189-198) fused to a FLAG tag and the estrogen receptor (ER) (AID-ER and ΔAID-ER, respectively) (3) (Fig 1a). The fusion protein is followed by an internal ribosome entry site (IRES) and a gene encoding enhanced green fluorescent protein (EGFP). This entire construct is flanked by long terminal repeats (LTR). We also prepared a control vector that expresses the ER protein but no AID.

Figure 1
Transduction of AID-ER, ΔAID-ER, and ER in aid-/- mouse splenic B cells does not alter cell cycle progression or cell proliferation

The three retroviral constructs (AID-ER, ΔAID-ER or ER) were transduced into aid-/- splenic B cells two days after activation with LPS, BLyS, and anti-IgD dextran +/- IL-4 to induce CSR to IgG1 or IgG3, respectively. The cultures were treated with tamoxifen (4OHT) at the time of retroviral transduction, which induces nuclear localization of ER-tagged proteins, to allow AID to reach its target. One day later, transduction efficiency was assayed by GFP expression (Fig 1b). In this study we only include experiments in which the three different retroviruses yielded similar GFP expression. Consistent with previous reports, full length AID-ER induces ~10-fold more IgG1 and IgG3 CSR than does ΔAID-ER in aid-/- splenic B cells, as shown by flow cytometry analyses (Fig 1f). In the absence of OHT treatment, AID-ER does not induce CSR (data not shown). The expression levels of AID-ER and ΔAID-ER proteins in cells with similar GFP expression are quite similar (Fig 1c), and the proteins are present in both nucleus and cytoplasm (Fig 1g). Previously, it was reported that ΔAID-ER is not expressed as well as AID-ER in splenic B cells (3). Perhaps this is because in those experiments, cells were cultured for 3 days after viral transduction, whereas we assay our experiments one day after transduction. We chose this time because there is adequate CSR and less cell death on day 1 than on subsequent days.

Since CSR is cell division linked (35, 36), it is important to examine whether the cell cycle profiles and cell proliferation rates in cells expressing ΔAID-ER are similar to that of cells expressing AID-ER. We stained cells expressing AID-ER, ΔAID-ER, or ER with propidium iodide (PI) on day 1 after transduction and examined the cell cycle profile of each using flow cytometry. AID-ER or ΔAID-ER expression has no effect on cell cycle progression of aid-/- B cells (Fig 1d). To examine cell proliferation, B cells were stained with PKH26 prior to activation and transduction with RV-AID-ER, RV-ΔAID-ER, or RVER. The rate of PKH26 dilution by cell division was assayed by flow cytometry and indicates that cells transduced with the three different RV constructs proliferate similarly (Fig 1e).

ΔAID-ER induces S region DSBs in aid-/- B cells

S region DSBs are an essential intermediate in CSR, and are dependent upon AID, UNG, and MMR (15, 16, 21, 37-39). We asked whether we could confirm the previous report that S region DSBs are present in cells expressing ΔAID (25). We used ligation-mediated (LM)-PCR to analyze Sμ and Sγ3 DSBs in aid-/- splenic B cells expressing AID-ER, ΔAID-ER, or ER. As expected, non-transduced WT B cells showed abundant DSBs in Sμ and Sγ3 regions while aid-/- B cells, either non-transduced or transduced with the control RV-ER showed very few S region DSBs (Fig 2a). We also performed LM-PCR on GFP-negative cells FACS-sorted from RV-infected populations and found very few S region DSBs (Fig 2a). However, aid-/- cells expressing either AID-ER or ΔAID-ER, but not ER alone, contain abundant blunt DSBs in Sμ and Sγ3 region DNA, but very few DSBs in the Cμ gene. The GAPDH bands shown below the blots are an internal PCR control for template loading. The GFP expression among the different cell populations used for LM-PCR was similar in the experiment shown in Fig 2a, ranging from 69-79%, suggesting that the expression of AID and ΔAID was similar. We also assayed staggered DSBs in RV-transduced cells by treating the genomic DNAs with T4 DNA polymerase prior to linker ligation. As shown in Fig 2b, the number of DSBs in T4-Pol treated DNA from cells expressing AID and ΔAID appear similar. This experiment was performed 3 times with similar results.

Figure 2
ΔAID-ER is proficient in inducing Sμ and Sγ3 DSBs during CSR

To determine whether there is a difference between AID and ΔAID-induced Sμ and Sγ3 DSBs in cells expressing low vs high amounts of AID and ΔAID, we sorted cells according to levels of GFP expression. Suppl Fig S1 shows the profile of GFP expression and gates used for this sort. As we found when unsorted cells were analyzed, the numbers of Sμ and Sγ3 DSBs detected in cells expressing high amounts of AID or ΔAID (GFP-high) were similar (Fig 2c; Suppl Figs S2, S3). In GFP-low cells, ΔAID appears to induce fewer S region DSBs than does full-length AID. Perhaps, in cells expressing lower amounts of AID, the conversion of dU's to DSBs is less efficient in ΔAID-expressing cells than in cells expressing full-length AID, despite the fact that ΔAID has high deaminase activity. This reduction in DSBs cannot account for the severe reduction in CSR in ΔAID-expressing cells, since abundant breaks are found in unsorted ΔAID-expressing cells (Fig 2a) and switching is 10-fold reduced.

One possible role of the C terminus might be to promote interaction between Sμ and a downstream acceptor S region, perhaps thereby allowing AID to attack the acceptor S region. However, we found that the AID C terminus is not required for introduction of DSBs into Sγ3 in B cells induced to switch to IgG3, as our LM-PCR data indicate that cells expressing full length AID and ΔAID have similar numbers of Sγ3 DSBs (Fig 2 and Suppl Fig S3).

To determine whether loss of the C terminus alters the sites at which DSB are found, we cloned and sequenced the LM-PCR products. The sites of DSBs in Sμ of AID-ER-or ΔAID-ER-expressing aid-/- B cells are indistinguishable from each other (Table I) and from those in WT B cells expressing endogenous AID (17), but different from those few DSBs cloned from aid-/- cells (16). As true for Sμ DSBs instigated by endogenous AID, ≥80% of the DSBs occur at G:C bp and preferentially at AID (WRC/GYW and AGCT) target hotspots. These data suggest that deletion of the AID C terminus does not alter the ability of AID to generate DSBs in S regions or the sequence specificity of Sμ DSBs.

Table I
Sites of blunt Sμ DSBs in cells expressing full length or ΔAID*

AID and UNG bind cooperatively to Sμ DNA and their binding depends on the AID C-terminus

As it is clear that ΔAID mutates Sμ and induces DSBs, we expected ΔAID-ER to be detected at the Sμ region in vivo using chromatin immunoprecipitation assays (ChIP). Surprisingly, the ChIP data show decreased association of ΔAID-ER with Sμ DNA compared to AID-ER in aid-/- splenic B cells induced to switch to IgG3 (Fig 3a). As anti-ER antibody can precipitate AID-ER, ΔAID-ER, and ER proteins equally well from total cell extracts (Fig 3b), we conclude that binding of AID-ER to the Sμ region that is stable enough to be detected by ChIP, depends upon its C terminus. Supplementary Fig S4 shows a gel analysis of the anti-ER ChIP at Sμ. The association of full length AID with Sμ is only observed if cells are treated with OHT to induce the ER-tagged proteins to move to nuclei (data not shown). Since ΔAID induces the same frequency of mutations at Sμ as does full length AID (3), it is clear that the ability of AID to stably associate with Sμ is not important for its ability to deaminate Sμ, although it might be important for CSR.

Figure 3
Chromatin immunoprecipitation (ChIP) demonstrates that the C-terminus of AID is required for recruitment of AID-ER and UNG to Sμ DNA, and that UNG is important for recruitment of AID-ER to Sμ

Cells expressing ΔAID-ER show an increased proportion of C>T and G>A transition mutations in the 5’ Sμ region relative to C>A and C>G or G>C and G>T transversion mutations, similar to the phenotype of ung-/- B cells (3). This suggests that AID might associate with UNG via the AID C terminus, and help recruit UNG to switch regions. We asked, therefore, if association of endogenous UNG with Sμ is compromised in cells expressing C terminal deleted AID. Indeed, ChIP with anti-UNG antibody demonstrated that whereas UNG associates with Sμ in aid-/- cells expressing AID-ER, it is found only at background levels in cells expressing ΔAID-ER (Fig 3d). As UNG is required for S region DSBs (16), it is clear that it must associate with S regions in ΔAID-expressing cells, although apparently this interaction is not stable enough to be detected by ChIP under our conditions.

Our finding that binding of UNG to Sμ in vivo depends on the AID C terminus prompted us to ask if the preferential binding of full-length AID to Sμ likewise depends upon UNG. We expressed the 3 retroviruses in aid-/-ung-/- splenic B cells and performed ChIP with anti-ER antibody. Our results demonstrate that in cells lacking UNG, full length AID-ER does not associate better than does ΔAID-ER with Sμ (Fig 3a). Fig 3c shows that AID and ΔAID can be detected in both whole cell and nuclear extracts from aid-/-ung-/- cells. Neither AID-ER, ΔAID-ER, or UNG are found at the Cμ region in these cells, which indicates that the association is specific for Sμ (Fig 3a, d). We conclude that the ability of full-length AID but not ΔAID to associate stably with Sμ depends upon the presence of UNG. The inability of UNG to bind Sμ in cells expressing ΔAID is not due to a lack of dU's, as AID lacking the C terminus is a highly active cytidine deaminase (26, 27). Also, this result is not an artifact due to possible differences in numbers of Sμ SSBs or DSBs, which theoretically could affect the ability to amplify Sμ DNA in the ChIP, because the quantitative PCR results in these experiments showed that there were equal amounts of amplifiable input DNA in the WT, ΔAID, and ER samples (data not shown). To ensure that not all proteins bind better to the Sμ region in AID-expressing cells than in ΔAID-expressing cells, we performed ChIP for RNA polymerase II. RNA Pol II binds Sμ similarly in cells expressing each of the 3 RV constructs (Fig 3e). Taken together, these data suggest that AID and UNG bind cooperatively to the Sμ region in B cells undergoing CSR, and that this cooperative binding depends on the AID C-terminus. Despite the fact that in cells expressing ΔAID, neither UNG nor ΔAID bind stably enough to be detected in our ChIP assays, it is clear that ΔAID and UNG have enzymatic activity at the S region in cells expressing ΔAID due to the presence of DSBs (Fig 2) (25). These results suggest that the binding detected by ChIP might be important for a process downstream of DSB formation.

AID and Msh2-Msh6 bind cooperatively with Sμ DNA dependent upon the AID C-terminus

The MMR heterodimer Msh2-Msh6 binds to U:G mismatches that result from AID activity (22). Interestingly, msh6-/- mice have altered targeting of AID, as the AID induced-mutations in V regions are more focused at WRC hotspots in these mice than in WT mice (40, 41). We asked if endogenous Msh2-Msh6 can be detected at S regions expressing RV-AID, and if so whether association of endogenous Msh2-Msh6 with Sμ in vivo depends upon the C terminus of AID. ChIP for Msh2 and for Msh6 in aid-/- B cells demonstrated that both Msh2 and Msh6 associate with Sμ in cells expressing full-length AID-ER, but not significantly above background when expressing ΔAID-ER or ER (Fig 4a). Binding of Msh2 and Msh6 is not detected at the Cμ region (Fig 4b), in agreement with our finding that AID-ER binds Sμ and not Cμ.

Figure 4
ChIP demonstrates that the C-terminus of AID is important for recruitment of Msh2-Msh6 to Sμ DNA, and that Msh2-Msh6 is important for binding of AID-ER to Sμ

We next asked if binding of full-length AID to Sμ in vivo might depend upon these MMR proteins, in addition to UNG, by expressing the RV constructs in aid-/-msh2-/- and in aid-/-msh6-/- cells. Indeed, we found that in the absence of Msh2 or Msh6, AID-ER does not bind better than ΔAID-ER to the Sμ region, and the binding was at background levels (Fig 4c). This is not due to differential expression of the AID proteins, as the amounts of AID-ER and ΔAID-ER are similar in cytoplasmic and nuclear extracts of B cells from both aid-/-msh2-/- and aid-/-msh6-/- mice (Fig 4d). Together with the results showing reduced binding of Msh2-Msh6 to Sμ in cells expressing ΔAID-ER, these data suggest that AID binds cooperatively with Msh2-Msh6 to the Sμ region and that this cooperative binding depends on the C terminus of AID. We hypothesize that cooperative binding of AID with UNG and Msh2-Msh6 stabilizes the binding of AID to Sμ, thus allowing the binding to be detected by ChIP. This increased stability does not appear necessary, however, for the deamination activity of AID, nor for S region DSBs. As UNG is essential for DSBs (16), and MMR proteins contribute to formation of Sμ DSBs (20, 21), it is clear that these proteins must be binding and acting at S region in ΔAID-expressing cells, but perhaps binding only transiently. We conclude that a complex of AID, UNG, and Msh2-Msh6 that is stable enough to be detected by ChIP requires the AID C terminus, and that this complex might be required for CSR.

Mutations of the catalytic domain of AID prevent cooperative binding of AID, UNG, and Msh2 to S μ and Sγ3 in ChIP assays

We have been unable to detect direct binding between AID and UNG or between AID and Msh2 (data not shown). We hypothesized that detectable binding of UNG and Msh2-Msh6 to Sμ depends on the presence of their dU substrates, and therefore that the deaminase activity of AID would be required to detect cooperative binding of AID, UNG and Msh2 to Sμ. To test this hypothesis, we transduced aid-/- B cells with RVAIDH56R/E58Q, i.e. full-length AID with two mutations in the catalytic domain resulting in complete absence of deaminase activity (42). ChIP assays demonstrated that neither RV-AIDH56R/E58Q, UNG, nor Msh2 detectably bind Sμ in cells expressing this mutant AID, although in these experiments AID, UNG and Msh2 bind Sμ in cells expressing full-length wild type AID (Fig 5a-c). Thus, the cooperative binding of UNG and Msh2-Msh6 with AID depends upon the presence of dU's in DNA.

Figure 5
ChIP demonstrates that the deaminase activity of AID is required for cooperative binding of AID, UNG and Msh2-Msh6 to Sμ and Sγ3 regions (a-c)

As AID also acts on acceptor S regions, we asked whether the cooperative binding of these three proteins would also occur at Sγ3, and would also depend upon the deaminase activity of AID. Indeed, as shown in Fig 5a-c, AID, UNG and Msh2 bind to Sγ3 regions in cells transduced with wild-type AID but not in cells transduced with RV-AIDH56R/E58Q, nor in cells transduced with ER alone. A western blot of total cell extracts shows that the mutant AID was expressed as well as WT AID (Fig 5d). Thus, we conclude that AID cooperatively binds with UNG and Msh2-Msh6 to both donor S and acceptor S regions dependent upon the presence of dU's in DNA. Our results support the hypothesis that in addition to deamination of dCs, leading to DSBs, AID has a role in CSR subsequent to generation of DSBs, and this role results in stabilization of the binding of UNG and MMR specifically to S regions.

MMR deficiency has no effect on CSR in cells expressing ΔAID

CSR is reduced by 50-75% in MMR-deficient B cells (1, 33, 40, 43-45). As we found that cooperative binding between AID and the Msh2-Msh6 heterodimer at Sμ depends upon the AID C terminus, we next asked if the C terminus of AID is important for the ability of MMR to increase CSR efficiency. We hypothesized that recruitment of Msh2-Msh6 by AID is important for the function of MMR during CSR, and that in cells expressing ΔAID-ER, deficiencies in Msh2 or Msh6 proteins will not reduce CSR efficiency relative to MMR-sufficient cells. To test this hypothesis, we examined CSR to IgG1 and IgG3 in aid-/-msh2-/- and in aid-/-msh6-/- B cells transduced with the three RV constructs (Fig 6). In cells expressing full-length AID, CSR was reduced by 45-70% by Msh2 or Msh6-deficiency, consistent with results in MMR-deficient cells expressing endogenous AID. These results demonstrate that despite being over-expressed, AIDER behaves similarly to endogenous AID as optimal CSR depends upon MMR.

Figure 6
Msh2-Msh6 proteins increase CSR in cells expressing AID-ER but not in cells expressing ΔAID-ER

Importantly, although switching to IgG1 in aid-/- B cells expressing ΔAID-ER is reduced by ~90% compared to that of cells expressing AID-ER, it is not further reduced by deficiencies in Msh2 (Fig 6a,b, upper panels) or Msh6 (Fig 6c,d, upper panels). Similarly, switching to IgG3 in ΔAID-ER-expressing aid-/- B cells is reduced by ~90% relative to AID-ER-expressing aid-/- B cells, but not further reduced in aid-/-msh2-/- B cells (Fig 6a,b, lower panels) or in aid-/-msh6-/- B cells (Fig 6c,d, lower panels). As ΔAID is an active deaminase and induces Sμ mutations, this is not due to the lack of U:G mismatch substrates for Msh2-Msh6 in Sμ. These data indicate that Msh2 and Msh6 do not increase CSR in cells in which AID lacks the C terminus.

In conclusion, these data reveal that the C terminus of AID is important for recruitment of UNG and Msh2-Msh6 to Ig S regions, and that this recruitment is important for the function of Msh2-Msh6 in CSR. Although both UNG and MMR are important for DSB formation during CSR, our results indicate that the AID C terminus is not required for Sμ or Sγ3 DSBs, suggesting that UNG and MMR can contribute to DSB formation without binding stably. These data clearly indicate that the block in CSR caused by lack of the AID C terminus occurs downstream of S region DSB formation, although it is possible that the efficiency of DSB formation is reduced. We conclude that a complex of AID, UNG, and Msh2-Msh6 that is stable enough to be detected by ChIP requires the AID C terminus, and that this complex is important for CSR.

DISCUSSION

We have demonstrated that AID binds cooperatively with both UNG and Msh2-Msh6 to the Ig Sμ region in B cells induced to switch to IgG3, and that the cooperative binding requires the C terminal 10 amino acids of AID. Full-length AID was not detected at Sμ by ChIP in cells lacking UNG, Msh2, or Msh6 and thus all three components are required for complex formation. The interactions might be direct or indirect. Consistent with the ChIP results, we found that the MMR proteins Msh2 and Msh6 do not contribute to CSR in cells expressing ΔAID, indicating that the ability of AID to recruit MMR proteins to Sμ is important for the role of MMR during CSR. The associations between AID and UNG and between AID and Msh2-Msh6 are detected when AID is localized on S regions; we have not been able to detect binding in the absence of DNA or at the Cμ region. The binding to both Sμ and Sγ3 are only detected when AID is competent for deaminase activity, suggesting that the cooperative binding between AID and UNG and Msh2-Msh6 occurs after AID has deaminated dC's. However, as not all dU's are likely to be excised by UNG and converted to SSBs, it is likely that at any one moment in cells undergoing CSR, S regions contain a mixture of dU's, abasic sites, and SSBs (1). Thus, S regions could have substrates for UNG and MMR binding, despite also having SSBs and DSBs.

It is puzzling that there are about as many Sμ DSBs in cells expressing ΔAID as in cells expressing full-length AID, despite lower recruitment of AID, UNG and MMR. Considerable evidence indicates that UNG is essential for S region DSBs (16), and that MMR is important for conversion of SSBs to DSBs in S regions during CSR. In the absence of MMR, DSBs appear to only form from SSBs that are near on opposite strands (19-21, 46, 47). Sμ region DSBs have also been observed using LM-PCR in HIGM2 patients with C terminal deletions of AID (48). Also, CH12F3-2 lymphoma B cells expressing C terminal deleted AID have been shown to have as many Sμ region DSBs as cells expressing full length AID (25). Therefore, it seems clear that in the absence of the AID C terminus, both UNG and MMR can still access dU and U:G mismatches resulting from AID activity. One possibility to explain the numerous DSBs detected in cells expressing ΔAID is that ΔAID might have higher catalytic activity than full-length AID (27), and the increased dU's might require fewer UNG and MMR molecules to induce DSBs. However, we favor the alternative possibility that DSBs are induced with lower efficiency in cells expressing ΔAID, but are also repaired or recombined inefficiently and thus accumulate. This appears consistent with the fact that GFP-low cells expressing ΔAID have fewer DSBs than GFP-low cells expressing full-length AID. We hypothesize that in GFP-high cells this repair problem would be exacerbated due to overwhelming the repair/recombination mechanisms because of the high AID levels, thus explaining the similar numbers of DSBs observed in ΔAID- and AID-expressing GFP-high and in total GFP+ cells. Inefficient repair/recombination is also consistent with the increased translocations found in B cells expressing RV-ΔAID (25), as unresolved DSBs increase the risk of DNA translocations, carcinogenesis, and cell death.

Our results suggest that the C terminus of AID promotes the formation of a protein complex that not only generates S region DNA breaks, but also promotes their repair in a manner that leads to productive CSR. UNG and MMR proteins might help recruit other proteins involved in subsequent repair steps during CSR. For example, Msh2 and Msh6 have been found in a large complex of DNA repair proteins in HeLa cells, termed BASC, which also includes Mre11-Rad50-Nbs1 (MRN). MRN binds DSBs induced by AID and is known to be important for repair of DSBs and for CSR (1, 49-52). Another possibility is suggested by findings in over-expression experiments that AID binds DNAPKcs, dependent upon the AID C terminus (53), and that Msh2-Msh6 binds to Ku70-Ku80 (54). As Ku and DNA-PKcs are important for directing DNA breaks towards NHEJ, it is possible that in addition to its role in converting SSBs to DSBs, MMR associated with the AID C terminus is involved in recruiting DNA-PK-Ku proteins to sites of AID-induced DSBs. Chromosomal translocations have been shown to be mediated by microhomology-mediated end joining (55), an alternative form of end-joining in which recombination is mediated by short microhomologies between the two recombining sequences. In addition, B cells with mutations in DNA damage response or repair genes that are involved in CSR, including mutations in MMR or UNG genes, often show increased lengths of junctional microhomology (46, 56-59). Most importantly, Sμ-Sα junctions from two human patients expressing AID with C terminal deletions show highly significantly increased lengths of junctional microhomology (59). These results suggest that the AID C terminus, MMR and UNG are involved in the recombination step during CSR and perhaps direct S region DSBs towards NHEJ.

CSR and V-D-J recombination both involve NHEJ and occur during G1 phase of the cell cycle. Recent studies have shown that a mutant of RAG-2 (T490A), which prevents degradation of RAG-2 during S phase, results in aberrant V-D-J recombination and increased chromosomal translocations, indicating the importance of cell cycle control for accurate recombination (60, 61). AID-dependent Sμ DSBs are only observed during G1 phase in normal splenic B cells undergoing CSR, indicating that most DBS are introduced, recombined and repaired during G1 phase (21, 49). It is possible that the interaction of AID with UNG and MMR might be important to recruit these proteins to S regions during G1 phase, since UNG and MMR proteins are primarily associated with S phase activity. MMR is known to associate with the replication machinery and to correct nucleotides mis-incorporated during S phase due to DNA polymerase errors (23, 62). UNG is important for removal of dU incorporated instead of dT during replication, and in both primary fibroblasts and HeLa cells UNG is expressed at much higher levels during S phase than during G1 or G2 phases (63, 64). However, in splenic B cells induced to undergo CSR, UNG expression is slightly higher in G1 phase than in S phase. UNG is active in G1 phase B cell extracts, and is clearly important for excision of dUs due to deamination by AID (14, 16, 21). It is possible that if UNG and MMR are not specifically recruited to Sμ during G1 phase by full-length AID, these proteins might only be available at S regions during S phase, thus creating DSBs in S phase. During DNA replication, DSBs cause stalling of DNA polymerase and collapse of replication forks, which are then sometimes repaired by break-induced replication, which is highly inaccurate (65). This could lead to translocations and greatly reduced CSR. Alternatively, inefficient repair of DSBs in G1 phase cells expressing ΔAID could cause DSBs to be retained during S and G2 phases, and thus lead to chromosomal rearrangements.

The binding of UNG and MMR to AID might be indirect and occur via other proteins. AID has been shown to interact with several proteins (66). Protein kinase A (PKA), which phosphorylates AID at S38, is specifically localized at S regions during CSR, and might participate in a PKA-RPA-AID complex (67, 68). Phosphorylation of AID at S38 is required for interaction with RPA and for CSR (69, 70), but it is possible that the AID C terminus is also involved. Interestingly, RPA32 has been shown to interact with UNG by a yeast two-hybrid assay (71). Also, a recent publication reported that the C-terminus of AID interacts with the 14-3-3 adaptor protein complex and that this interaction is important for recruitment of AID to S regions, as 14-3-3 binds specifically to AGCT motifs (72). Deficiency in 14-3-3 proteins results in a 50% decrease in CSR. However, since the ΔAID-ER mutant induces as many Sμ mutations as AID-ER, the recruitment of AID by 14-3-3 is not necessary for the ability of AID to deaminate Sμ. Also, we find that the preferential occurrence of Sμ DSBs at AGCT hotspots is identical in cells expressing both AID and ΔAID. It is possible, however, that 14-3-3, when bound to AID, is important for recruiting UNG and MMR and other repair proteins to Sμ.

Supplementary Material

Acknowledgments

We thank V. Barreto and M. Nussenzweig (The Rockefeller University, NY) for the pMX-PIE-AID-FLAG-ER-IRES-GFP-puro and pMX-PIE-ΔAID-FLAG-ER-IRES-GFP-puro plasmids. We thank K. Rauch for preparing the AIDH56R/E58Q-ER mutant. We thank our colleagues at the Univ of Mass Med School, R. Gerstein, R.T. Woodland, N. Rhind, M. Volkert and J.E.J. Guikema, at the Academic Medical Center, Univ of Amsterdam, for helpful suggestions, and the UMMS Flow Cytometry Core Facility for excellent technical assistance.

Footnotes

*The research was supported by grants from the NIH to JS: RO1 AI023283 and R21 AI88578.

Competing financial interests

The authors declare no competing financial interests.

REFERENCES

1. Stavnezer J, Guikema JEJ, Schrader CE. Mechanism and regulation of class switch recombination. Ann Rev Immunol. 2008;26:261–292. [PMC free article] [PubMed]
2. Peled JU, Kuang FL, Iglesias-Ussel MD, Roa S, Kalis SL, Goodman MF, Scharff MD. The biochemistry of somatic hypermutation. Annu Rev Immunol. 2008;26:481–511. [PubMed]
3. Barreto V, Reina-San-Martin B, Ramiro AR, McBride KM, Nussenzweig MC. C-terminal deletion of AID uncouples class switch recombination from somatic hypermutation and gene conversion. Mol Cell. 2003;12:501–508. [PubMed]
4. Ta VT, Nagaoka H, Catalan N, Durandy A, Fischer A, Imai K, Nonoyama S, Tashiro J, Ikegawa M, Ito S, Kinoshita K, Muramatsu M, Honjo T. AID mutant analyses indicate requirement for class-switch-specific cofactors. Nat Immunol. 2003;4:843–438. [PubMed]
5. Muto T, Muramatsu M, Taniwaki M, Kinoshita K, Honjo T. Isolation, tissue distribution, and chromosomal localization of the human activation-induced cytidine deaminase (AID) gene. Genomics. 2000;68:85–88. [PubMed]
6. Revy P, Muto T, Levy Y, Geissmann F, Plebani A, Sanal O, Catalan N, Forveille M, Dufourcq-Labelouse R, Gennery A, Tezcan I, Ersoy F, Kayserili H, Ugazio AG, Brousse N, Muramatsu M, Notarangelo LD, Kinoshita K, Honjo T, Fischer A, Durandy A. Activation-induced cytidine deaminase (AID) deficiency causes the autosomal recessive form of the Hyper-IgM syndrome (HIGM2). Cell. 2000;102:565–575. [PubMed]
7. Shinkura R, Ito S, Begum NA, Nagaoka H, Muramatsu M, Kinoshita K, Sakakibara Y, Hijikata H, Honjo T. Separate domains of AID are required for somatic hypermutation and class-switch recombination. Nat Immunol. 2004;5:707–712. [PubMed]
8. Ito S, Nagaoka H, Shinkura R, Begum N, Muramatsu M, Nakata M, Honjo T. Activation-induced cytidine deaminase shuttles between nucleus and cytoplasm like apolipoprotein B mRNA editing catalytic polypeptide 1. Proc Natl Acad Sci U S A. 2004;101:1975–1980. [PubMed]
9. McBride KM, Barreto V, Ramiro AR, Stavropoulos P, Nussenzweig MC. Somatic Hypermutation Is Limited by CRM1-dependent Nuclear Export of Activation-induced Deaminase. J Exp Med. 2004;199:1235–1244. [PMC free article] [PubMed]
10. Brar SS, Watson M, Diaz M. Activation-induced cytosine deaminase (AID) is actively exported out of the nucleus but retained by the induction of DNA breaks. J Biol Chem. 2004;279:26395–26401. [PubMed]
11. Aoufouchi S, Faili A, Zober C, D'Orlando O, Weller S, Weill JC, Reynaud CA. Proteasomal degradation restricts the nuclear lifespan of AID. J Exp Med. 2008;205:1357–1368. [PMC free article] [PubMed]
12. Geisberger R, Rada C, Neuberger MS. The stability of AID and its function in class-switching are critically sensitive to the identity of its nuclear-export sequence. Proc Natl Acad Sci U S A. 2009;106:6736–6741. [PubMed]
13. Ellyard JI, Benk AS, Taylor B, Rada C, Neuberger MS. The dependence of Ig class-switching on the nuclear export sequence of AID likely reflects interaction with factors additional to Crm1 exportin. Eur J Immunol. 2011;41:485–490. [PMC free article] [PubMed]
14. Rada C, Williams GT, Nilsen H, Barnes DE, Lindahl T, Neuberger MS. Immunoglobulin isotype switching is inhibited and somatic hypermutation perturbed in UNG-deficient mice. Curr Biol. 2002;12:1748–1755. [PubMed]
15. Imai K, Slupphaug G, Lee WI, Revy P, Nonoyama S, Catalan N, Yel L, Forveille M, Kavli B, Krokan HE, Ochs HD, Fischer A, Durandy A. Human uracil-DNA glycosylase deficiency associated with profoundly impaired immunoglobulin class-switch recombination. Nat Immunol. 2003;4:1023–1028. [PubMed]
16. Schrader CE, Linehan EK, Mochegova SN, Woodland RT, Stavnezer J. Inducible DNA breaks in Ig S regions are dependent upon AID and UNG. J Exp Med. 2005;202:561–568. [PMC free article] [PubMed]
17. Guikema JE, Linehan EK, Tsuchimoto D, Nakabeppu Y, Strauss PR, Stavnezer J, Schrader CE. APE1- and APE2-dependent DNA breaks in immunoglobulin class switch recombination. J Exp Med. 2007;204:3017–3026. [PMC free article] [PubMed]
18. Chaudhuri J, Alt FW. Class-switch recombination: interplay of transcription, DNA deamination and DNA repair. Nat Rev Immunol. 2004;4:541–552. [PubMed]
19. Min I, Schrader C, Vardo J, D'Avirro N, Luby T, Stavnezer J, Selsing E. The Sm tandem repeat region is critical for isotype switching in the absence of Msh2. Immunity. 2003;19:515–524. [PubMed]
20. Stavnezer J, Schrader CE. Mismatch repair converts AID-instigated nicks to double-strand breaks for antibody class-switch recombination. Trends Genet. 2006;22:23–28. [PubMed]
21. Schrader CE, Guikema JE, Linehan EK, Selsing E, Stavnezer J. Activation-induced cytidine deaminase-dependent DNA breaks in class switch recombination occur during G1 phase of the cell cycle and depend upon mismatch repair. J Immunol. 2007;179:6064–6071. [PubMed]
22. Wilson TM, Vaisman A, Martomo SA, Sullivan P, Lan L, Hanaoka F, Yasui A, Woodgate R, Gearhart PJ. MSH2-MSH6 stimulates DNA polymerase {eta}, suggesting a role for A:T mutations in antibody genes. J Exp Med. 2005;201:637–645. [PMC free article] [PubMed]
23. Modrich P. Mechanisms in eukaryotic mismatch repair. J Biol Chem. 2006;281:30305–30309. [PMC free article] [PubMed]
24. Bardwell PD, Woo CJ, Wei K, Li Z, Martin A, Sack SZ, Parris T, Edelmann W, Scharff MD. Altered somatic hypermutation and reduced class-switch recombination in exonuclease 1-mutant mice. Nat Immunol. 2004;5:224–229. [PubMed]
25. Doi T, Kato L, Ito S, Shinkura R, Wei M, Nagaoka H, Wang J, Honjo T. The C-terminal region of activation-induced cytidine deaminase is responsible for a recombination function other than DNA cleavage in class switch recombination. Proc Natl Acad Sci U S A. 2009;106:2758–2763. [PubMed]
26. Bransteitter R, Pham P, Calabrese P, Goodman MF. Biochemical analysis of hypermutational targeting by wild type and mutant activation-induced cytidine deaminase. J Biol Chem. 2004;279:51612–51621. [PubMed]
27. Kohli RM, Abrams SR, Gajula KS, Maul RW, Gearhart PJ, Stivers JT. A Portable Hot Spot Recognition Loop Transfers Sequence Preferences from APOBEC Family Members to Activation-induced Cytidine Deaminase. J Biol Chem. 2009;284:22898–22904. [PubMed]
28. Di Noia J, Neuberger MS. Altering the pathway of immunoglobulin hypermutation by inhibiting uracil-DNA glycosylase. Nature. 2002;419:43–48. [PubMed]
29. Muramatsu M, Kinoshita K, Fagarasan S, Yamada S, Shinkai Y, Honjo T. Class switch recombination and hypermutation require activation-induced cytidine deaminase (AID), a potential RNA editing enzyme. Cell. 2000;102:553–563. [PubMed]
30. Reitmair AH, Redston M, Cai JC, Chuang TC, Bjerknes M, Cheng H, Hay K, Gallinger S, Bapat B, Mak TW. Spontaneous intestinal carcinomas and skin neoplasms in Msh2-deficient mice. Cancer Res. 1996;56:3842–3849. [PubMed]
31. Baar J, Pennell NM, Shulman MJ. Analysis of a hot spot for DNA insertion suggets a mechanism for Ig switch recombination. J. Immunol. 1996;157:3430–3435. [PubMed]
32. Edelmann W, Yang K, Umar A, Heyer J, Lau K, Fan K, Liedtke W, Cohen PE, Kane MF, Lipford JR, Yu N, Crouse GF, Pollard JW, Kunkel T, Lipkin M, Kolodner R, Kucherlapati R. Mutation in the mismatch repair gene Msh6 causes cancer susceptibility. Cell. 1997;91:467–477. [PubMed]
33. Schrader CE, Edelmann W, Kucherlapati R, Stavnezer J. Reduced isotype switching in splenic B cells from mice deficient in mismatch repair enzymes. J. Exp. Med. 1999;190:323–330. [PMC free article] [PubMed]
34. Kaminski DA, Stavnezer J. Stimuli that enhance IgA class switching increase histone 3 acetylation at S alpha, but poorly stimulate sequential switching from IgG2b. Eur J Immunol. 2007;37:240–251. [PubMed]
35. Hodgkin PD, Lee J-H, Lyons AB. B cell differentiation and isotype switching is related to division cycle number. J. Exp. Med. 1996;184:277–281. [PMC free article] [PubMed]
36. Rush JS, Liu M, Odegard VH, Unniraman S, Schatz DG. Expression of activation-induced cytidine deaminase is regulated by cell division, providing a mechanistic basis for division-linked class switch recombination. Proc Natl Acad Sci U S A. 2005;102:13242–13247. [PubMed]
37. Catalan N, Selz F, Imai K, Revy P, Fischer A, Durandy A. The block in immunoglobulin class switch recombination caused by activation-induced cytidine deaminase deficiency occurs prior to the generation of DNA double strand breaks in switch mu region. J Immunol. 2003;171:2504–2509. [PubMed]
38. Rush JS, Fugmann SD, Schatz DG. Staggered AID-dependent DNA double strand breaks are the predominant DNA lesions targeted to S mu in Ig class switch recombination. Int Immunol. 2004;16:549–557. [PubMed]
39. Peron S, Metin A, Gardes P, Alyanakian MA, Sheridan E, Kratz CP, Fischer A, Durandy A. Human PMS2 deficiency is associated with impaired immunoglobulin class switch recombination. J Exp Med. 2008;205:2465–2472. [PMC free article] [PubMed]
40. Martomo SA, Yang WW, Gearhart PJ. A role for Msh6 but not Msh3 in somatic hypermutation and class switch recombination. J Exp Med. 2004;200:61–68. [PMC free article] [PubMed]
41. Li Z, Zhao C, Iglesias-Ussel MD, Polonskaya Z, Zhuang M, Yang G, Luo Z, Edelmann W, Scharff MD. The mismatch repair protein Msh6 influences the in vivo AID targeting to the Ig locus. Immunity. 2006;24:393–403. [PubMed]
42. Papavasiliou FN, Schatz DG. The activation-induced deaminase functions in a postcleavage step of the somatic hypermutation process. J Exp Med. 2002;195:1193–1198. [PMC free article] [PubMed]
43. Ehrenstein MR, Neuberger MS. Deficiency in Msh2 affects the efficiency and local sequence specificity of immunoglobulin class-switch recombination: parallels with somatic hypermutation. Embo J. 1999;18:3484–3490. [PubMed]
44. Li Z, Scherer SJ, Ronai D, Iglesias-Ussel MD, Peled JU, Bardwell PD, Zhuang M, Lee K, Martin A, Edelmann W, Scharff MD. Examination of Msh6- and Msh3-deficient mice in class switching reveals overlapping and distinct roles of MutS homologues in antibody diversification. J. Exp. Med. 2004;200:47–59. [PMC free article] [PubMed]
45. Roa S, Li Z, Peled JU, Zhao C, Edelmann W, Scharff MD. MSH2/MSH6 complex promotes error-free repair of AID-induced dU:G mispairs as well as error-prone hypermutation of A:T sites. PLoS One. 2010;5:e11182. [PMC free article] [PubMed]
46. Eccleston J, Schrader CE, Yuan K, Stavnezer J, Selsing E. Class switch recombination efficiency and junction microhomology patterns in Msh2-, Mlh1-, and Exo1-deficient mice depend on the presence of mu switch region tandem repeats. J Immunol. 2009;183:1222–1228. [PMC free article] [PubMed]
47. Eccleston J, Yan C, Yuan K, Alt FW, Selsing E. Mismatch Repair Proteins MSH2, MLH1, and EXO1 Are Important for Class-Switch Recombination Events Occurring in B Cells That Lack Nonhomologous End Joining. J Immunol. 2011;186:2336–2343. [PMC free article] [PubMed]
48. Imai K, Catalan N, Plebani A, Marodi L, Sanal O, Kumaki S, Nagendran V, Wood P, Glastre C, Sarrot-Reynauld F, Hermine O, Forveille M, Revy P, Fischer A, Durandy A. Hyper-IgM syndrome type 4 with a B lymphocyte-intrinsic selective deficiency in Ig class-switch recombination. J Clin Invest. 2003;112:136–142. [PMC free article] [PubMed]
49. Petersen S, Casellas R, Reina-San-Martin B, Chen HT, Difilippantonio MJ, Wilson PC, Hanitsch L, Celeste A, Muramatsu M, Pilch DR, Redon C, Ried T, Bonner WM, Honjo T, Nussenzweig MC, Nussenzweig A. AID is required to initiate Nbs1/gamma-H2AX focus formation and mutations at sites of class switching. Nature. 2001;414:660–665. [PubMed]
50. Wang Y, Cortez D, Yazdi P, Neff N, Elledge SJ, Qin J. BASC, a super complex of BRCA1-associated proteins involved in the recognition and repair of aberrant DNA structures. Genes Dev. 2000;14:927–939. [PubMed]
51. Dinkelmann M, Spehalski E, Stoneham T, Buis J, Wu Y, Sekiguchi JM, Ferguson DO. Multiple functions of MRN in end-joining pathways during isotype class switching. Nat Struct Mol Biol. 2009;16:808–813. [PMC free article] [PubMed]
52. Staszewski O, Baker RE, Ucher AJ, Martier R, Stavnezer J, Guikema JEJ. Activation-induced cytidine deaminase induces reproducible DNA breaks at many non-Ig loci in activated B cells. Mol Cell. 2011;41:232–242. [PMC free article] [PubMed]
53. Wu X, Geraldes P, Platt JL, Cascalho M. The double-edged sword of activation-induced cytidine deaminase. J Immunol. 2005;174:934–941. [PubMed]
54. Shahi A, Lee JH, Kang Y, Lee SH, Hyun JW, Chang IY, Jun JY, You HJ. Mismatch-repair protein MSH6 is associated with Ku70 and regulates DNA double-strand break repair. Nucleic Acids Res. 2011;39:2130–2143. [PMC free article] [PubMed]
55. Yan CT, Boboila C, Souza EK, Franco S, Hickernell TR, Murphy M, Gumaste S, Geyer M, Zarrin AA, Manis JP, Rajewsky K, Alt FW. IgH class switching and translocations use a robust non-classical end-joining pathway. Nature. 2007;449:478–482. [PubMed]
56. Ehrenstein MR, Rada C, Jones AM, Milstein C, Neuberger MS. Switch junction sequences in PMS2-deficient mice reveal a microhomology- mediated mechanism of Ig class switch recombination. Proc Natl Acad Sci U S A. 2001;98:14553–14558. [PubMed]
57. Schrader CE, Vardo J, Stavnezer J. Role for Mismatch Repair Proteins Msh2, Mlh1, and Pms2 in Immunoglobulin Class Switching Shown by Sequence Analysis of Recombination Junctions. J Exp Med. 2002;195:367–373. [PMC free article] [PubMed]
58. Stavnezer J, Bjorkman A, Du L, Cagigi A, Pan-Hammarstrom Q. Mapping of switch recombination junctions, a tool for studying DNA repair pathways during immunoglobulin class switching. Adv. Immunol. 2010;108:45–109. [PubMed]
59. Kracker S, Imai K, Gardes P, Ochs HD, Fischer A, Durandy AH. Impaired induction of DNA lesions during immunoglobulin class-switch recombination in humans influences end-joining repair. Proc Natl Acad Sci U S A. 2010;107:22225–22230. [PubMed]
60. Zhang L, Reynolds TL, Shan X, Desiderio S. Coupling of v(d)j recombination to the cell cycle suppresses genomic instability and lymphoid tumorigenesis. Immunity. 2011;34:163–174. [PMC free article] [PubMed]
61. Fugmann SD. RAG-2 Unleashed: Lymphocytes Beware. Immunity. 2011;34:137–139. [PMC free article] [PubMed]
62. Simmons LA, Davies BW, Grossman AD, Walker GC. Beta clamp directs localization of mismatch repair in Bacillus subtilis. Mol Cell. 2008;29:291–301. [PMC free article] [PubMed]
63. Hardeland U, Kunz C, Focke F, Szadkowski M, Schar P. Cell cycle regulation as a mechanism for functional separation of the apparently redundant uracil DNA glycosylases TDG and UNG2. Nucleic Acids Res. 2007;35:3859–3867. [PMC free article] [PubMed]
64. Hagen L, Kavli B, Sousa MM, Torseth K, Liabakk NB, Sundheim O, Pena-Diaz J, Otterlei M, Horning O, Jensen ON, Krokan HE, Slupphaug G. Cell cycle-pecific UNG2 phosphorylations regulate protein turnover, activity and association with RPA. Embo J. 2008;27:51–61. [PMC free article] [PubMed]
65. Llorente B, Smith CE, Symington LS. Break-induced replication: what is it and what is it for? Cell Cycle. 2008;7:859–864. [PubMed]
66. Stavnezer J. Complex regulation and function of activation-induced cytidine deaminase. Trends Immunol. 2011;32:194–201. [PMC free article] [PubMed]
67. Chaudhuri J, Khuong C, Alt FW. Replication protein A interacts with AID to promote deamination of somatic hypermutation targets. Nature. 2004;430:992–998. [PubMed]
68. Vuong BQ, Lee M, Kabir S, Irimia C, Macchiarulo S, McKnight GS, Chaudhuri J. Specific recruitment of protein kinase A to the immunoglobulin locus regulates class-switch recombination. Nat Immunol. 2009;10:420–426. [PubMed]
69. Basu U, Chaudhuri J, Alpert C, Dutt S, Ranganath S, Li G, Schrum JP, Manis JP, Alt FW. The AID antibody diversification enzyme is regulated by protein kinase A phosphorylation. Nature. 2005;438:508–511. [PubMed]
70. McBride KM, Gazumyan A, Woo EM, Schwickert TA, Chait BT, Nussenzweig MC. Regulation of class switch recombination and somatic mutation by AID phosphorylation. J Exp Med. 2008;205:2585–2594. [PMC free article] [PubMed]
71. Nagelhus TA, Haug T, Singh KK, Keshav KF, Skorpen F, Otterlei M, Bharati S, Lindmo T, Benichou S, Benarous R, Krokan HE. A sequence in the N-terminal region of human uracil-DNA glycosylase with homology to XPA interacts with the C-terminal part of the 34-kDa subunit of replication protein A. J Biol Chem. 1997;272:6561–6566. [PubMed]
72. Xu Z, Fulop Z, Wu G, Pone EJ, Zhang J, Mai T, Thomas LM, Al-Qahtani A, White CA, Park SR, Steinacker P, Li Z, Yates J, 3rd, Herron B, Otto M, Zan H, Fu H, Casali P. 14-3-3 adaptor proteins recruit AID to 5'-AGCT-3'-rich switch regions for class switch recombination. Nat Struct Mol Biol. 2010;17:1124–1135. [PMC free article] [PubMed]