PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
J Mol Biol. Author manuscript; available in PMC 2012 September 2.
Published in final edited form as:
PMCID: PMC3156286
NIHMSID: NIHMS315210
Structure of H/ACA RNP protein Nhp2p reveals cis/trans isomerization of a conserved proline at the RNA and Nop10 binding interface
Bon-Kyung Koo,1,2 Chin-Ju Park,1,2§ Cesar F. Fernandez,1 Nicholas Chim,1 Yi Ding,1 Guillaume Chanfreau,1 and Juli Feigon1*
1Department of Chemistry and Biochemistry, and the Molecular Biology Institute, PO Box 951569, University of California, Los Angeles, CA 90095-1569, USA
* Corresponding Author: Juli Feigon, Tel:1-310-206-6922, Fax:1-310-825-0982, feigon/at/mbi.ucla.edu
2These authors contributed equally to this work
§Current address: Gwangju Institute of Science and Technology, 261 Cheomdan-gwagiro, Buk-gu, Gwangju 500-712 Republic of Korea
Current address: Department of Molecular Biology and Biochemistry, 2212 Natural Sciences 1, University of California, Irvine, CA 92697
Current address: Galaxy Biotech, LLC, 1230 Bordeaux Dr., Sunnyvale, CA 94089.
H/ACA small nucleolar and Cajal body ribonucleoproteins (RNPs) function in site-specific pseudouridylation of eukaryotic rRNA and snRNA, rRNA processing, and vertebrate telomerase biogenesis. Nhp2, one of four essential protein components of eukaryotic H/ACA RNPs, forms a core trimer with the pseudouridylase Cbf5 and Nop10 that specifically binds to H/ACA RNAs. Crystal structures of archaeal H/ACA RNPs have revealed how the protein components interact with each other and with the H/ACA RNA. However, in place of Nhp2p, archaeal H/ACA RNPs contain L7Ae, which binds specifically to an RNA K-loop motif absent in eukaryotic H/ACA RNPs, while Nhp2 binds a broader range of RNA structures. We report solution NMR studies of S. cerevisiae Nhp2 (Nhp2p), which reveal that Nhp2p exhibits two major conformations in solution due to cis/trans isomerization of the evolutionarily conserved Pro83. The equivalent proline is in the cis conformation in all reported structures of L7Ae and other homologous proteins. Nhp2p has the expected α-β-α fold, but the solution structures of the major conformation of Nhp2p with trans Pro83 and of Nhp2p-S82W with cis Pro83 reveal that Pro83 cis/trans isomerization affects the positions of numerous residues at the Nop10- and RNA-binding interface. An S82W substitution, which stabilizes the cis conformation, also stabilizes the association of Nhp2p with H/ACA snoRNPs in vivo. We propose that Pro83 plays a key role in the assembly of the eukaryotic H/ACA RNP, with the cis conformation locking in a stable Cbf5-Nop10-Nhp2 ternary complex and positioning the protein backbone to interact with the H/ACA RNA.
Keywords: Nhp2, L7Ae, NMR, snoRNP, scaRNP
Most H/ACA small nucleolar and small Cajal body ribonucleoproteins (snoRNPs and scaRNPs) function in the pseudouridylation of ribosomal and spliceosomal small nuclear RNAs, respectively, in eukarya and archaea.1 Each H/ACA RNP consists of an H/ACA RNA and four evolutionary conserved proteins, Nhp2 (L7Ae in archaea),2 Cbf5 (called Dyskerin3 or Nap574 in mammals), Nop10, and Gar1. In most eukaryotes, each H/ACA RNA has two hairpins followed respectively by single stranded regions containing a conserved H-Box (ANANNA) and ACA-box (ACA).5,6 In archaea, the number of hairpins varies from 1 to 3, but is most often 1.710 Substrate RNAs bind to internal loops in the H/ACA hairpins, which are specific for each substrate, through base pairing11,12 with the target U and the adjacent 3′ nucleotide unpaired at the top of the internal loop.13,14 Cbf5 functions as the pseudouridylase catalytic subunit, and the other three proteins are essential for optimal activity, stability, maturation, and nucleolar localization of the H/ACA RNPs.1517 L7Ae does not interact with other H/ACA RNP proteins in the absence of the H/ACA RNA,18,19 while Nhp2p interacts directly with Cbf5 and Nop10 to form a ternary complex prior to binding H/ACA RNA.20 The 3′ half of human telomerase RNA (hTR) is an H/ACA scaRNA that is bound by the H/ACA proteins.2124 Mutations in the human H/ACA RNP proteins Dyskerin, Nop10, and Nhp2 have been found in the genes of some patients with the bone marrow failure syndrome dyskeratosis congenita (DC).3,2527
Reconstitution in vitro and crystal structures of archaeal H/ACA protein complexes with and without RNA have provided a general structural framework of the molecular interactions in H/ACA RNPs.18,2831 Cbf5 interacts with Nop10, a small protein that is largely unstructured in isolation,13,32 which forms an interface between L7Ae and Cbf5 to form an RNP complex that can be assembled independently of Gar1.29 Gar1 binds to Cbf5 without contacts to the other proteins. The crystal structure of H/ACA RNPs from the archaeon P. furiosus (PDB ID: 2HVY), which contains all four proteins with a guide RNA, revealed that interactions between the H/ACA guide RNA and Cbf5, Nop10, and L7Ae occur at the two ends of the guide RNA.33 L7Ae interacts with the upper stem-loop of the H/ACA RNA. In archaea, the upper stem-loop contains an RNA motif called a K-turn or K-loop,34 with stacked A-G and G-A base pairs and a flipped out U, which interact specifically with L7Ae. At the opposite end, the 3′ ACA tail interacts with the PUA domain of Cbf5. Comparison with the crystal structure of substrate RNA-bound H/ACA RNPs without L7Ae (PDB ID: 2RFK) and fluorescence spectroscopy revealed that L7Ae plays a key role in re-orienting the substrate RNA bound to the H/ACA guide pocket for catalysis.35
To date, no structures of known eukaryotic H/ACA RNP proteins except for Nop1036 have been reported. Eukaryotic H/ACA RNAs do not contain the conserved K-loop found in archaeal H/ACA RNPs, and Nhp2 interacts with irregular stem-loop structures without any apparent specificity for the K-loop motif.37 Unlike L7Ae, in the absence of the other proteins Nhp2 binds non-specifically to RNA stem-loops in vitro, and the binding specificity for H/ACA RNAs appears to be conferred by the Cbf5-Nop10-Nhp2 core trimer, which forms prior to assembly with the RNA.20,37,38 Nevertheless, Nhp2 has a high level of homology with K-loop or K-turn binding proteins such as L7Ae, Snu13p, and 15.5kD protein, the human homologue of Snu13p.39,40 This raises an interesting paradox on the relationship between structure and function of Nhp2, since it bears sequence similarities with these proteins but appears to recognize a broader range of RNA structures.
Here we have investigated the structure of S. cerevisiae Nhp2 (Nhp2p) by solution NMR spectroscopy. Nhp2p adopts the α-β-α fold found in L7Ae and other homologous proteins. Surprisingly, however, the conserved Pro83 exhibits cis/trans isomerization. We report the structures of the major conformations of Nhp2p-WT (Pro83 trans) and Nhp2p-S82W (Pro83 cis), which show that Pro83 cis/trans isomerization results in conformational changes on the putative Nop10 and H/ACA RNA binding surface. The S82W mutation that stabilizes the Pro83 cis conformation also stabilizes the interaction of Nhp2p with H/ACA snoRNPs in vivo. In archaeal H/ACA RNPs, the homologous proline to Pro83 is part of a conserved “proline spine” that traverses the RNP from L7Ae through Nop10 to the active site of Cbf5,41 and interacts with both Nop10 and the flipped out U in the H/ACA RNA K-loop. We propose that Pro83 likely plays a similar role in Nhp2p, positioning the backbone of residue 82 to interact with the RNA, in spite of the absence of the K-loop motif. The cis/trans isomerization leading to flexibility at the RNA- and protein-binding interface may assure pre-assembly of the core Cbf5-Nop10-Nhp2p trimer prior to H/ACA RNA binding.
Nhp2p-WT has multiple conformations in solution due to proline cis/trans isomerization
Nhp2p contains an additional N-terminal extension (~14–23 residues) compared to other homologous 15.5kD family proteins. The full length Nhp2p behaved as a dimer in gel filtration chromatography and showed poor quality 1H-15N HSQC spectra (data not shown). A version of Nhp2p containing a deletion of the first 23 residues (Nhp2p-24–156) was monomeric at concentrations used for NMR studies (~0.8mM). We hereby refer to this N-terminally truncated version of Nhp2p as Nhp2p-WT. An 1H-15N HSQC spectrum of Nhp2p-WT is shown in Figure 1A. Although the cross peaks are for the most part well dispersed, indicative of a folded protein, many residues gave rise to two cross peaks. The backbone assignment of Nhp2p-WT revealed that ~36 of the amide signals are duplicated, indicating the presence of (at least) two conformations in slow exchange. We hypothesized that the two sets of peaks might arise from propagation of structural changes due to proline cis/trans isomerization. To test this hypothesis and identify the source of the structural heterogeneity, we generated six single proline-to-alanine substitutions in Nhp2p separately (P83A, P91A, P100A, P105A, P119A, and P127A, which includes all but the 3 prolines in the N-terminal region). Of these, P83, P91, and P100 are completely conserved in the Nhp2 orthologs 15.5kD, snu13p and L7Ae (Figure 2), as well as Nhp2 from other organisms. The 1H-15N HSQC spectra of the Nhp2p proteins containing mutations of the less conserved prolines (Nhp2p-P105A, Nhp2p-P119A and Nhp2p-P127A), all had doubled peaks similar to Nhp2p-WT (Figure S1), indicating that two (or more) conformations were present in these mutants as well. The 1H-15N HSQC spectra of Nhp2p-P91A and Nhp2p-P100A (Figure S1) all showed poor chemical shift dispersion and line broadening, indicating that the alanine substitutions in these proteins disrupted proper protein folding. Only Nhp2p-P83A gave a well-dispersed 1H-15N HSQC with about one-third the number of doubled peaks (Figure 1B). Subsequent sequential assignment indicated that the remaining doubled cross peaks corresponded to residues near Pro33 and Pro105. These results indicate that the main source of the conformational heterogeneity in Nhp2p-WT is the presence of cis/trans isomerization of Pro83. This gives rise to two major conformations which are present at a ratio of about 60:40, based on integration of the 1H-15N HSQC cross peak volumes (Figure 1C). The two non-conserved prolines, Pro33 and Pro105, which also show cis/trans isomerization have a more local effect on the structure.
Figure 1
Figure 1
1H-15N HSQC of Nhp2p show many doubled cross peaks due to proline cis/trans isomerization
Figure 2
Figure 2
Sequence alignment and structure of Nhp2p-WT and Nhp2p-S82W
Comparison of Nhp2p-WT and Nhp2p-P83A
Due to the presence of nine prolines in Nhp2p-WT (24–156) and the increased spectral overlap caused by the duplicated peaks, it was highly challenging to obtain the backbone assignment of Nhp2p-WT. Therefore, we initially tried to determine the structure of Nhp2p-P83A, assuming it would represent the conformation of Nhp2p-WT with Pro83 in the trans orientation. However, although the Pro83 to Ala mutation resulted in a unique conformation for most residues of the protein, it also induced the loss of NH resonances near the mutated residue from Ala84 to Ile90. Based on sequence alignment with homologous proteins and preliminary structures of Nhp2p-P83A, these residues correspond to the N-terminal half of helix α3, which was consequently not well defined. In contrast to the case for Nhp2p-P83A, amide resonances for Asp85 to Ser88 were present in spectra of Nhp2p-WT. Since further analysis indicated that substitution of Pro83 with Ala partially destabilized helix α3, we proceeded to assign the resonances from the major conformation of Nhp2p-WT for structure determination. Resonance assignments were greatly aided by comparison of chemical shifts and assignments of Nhp2p-P83A. The other missing amides in the spectra of Nhp2p-P83A were also absent in the spectrum of Nhp2p-WT. Ala84 was assigned from the spectra of Nhp2p-S82W as discussed below. Backbone assignments were ~90% completed, and nearly complete side-chain assignments were obtained for those residues.
The major conformation of Pro83 is trans in Nhp2p-WT and cis in Nhp2p-S82W
Based on comparison with the spectra from Nhp2p-P83A, it appeared that the major conformation of Nhp2p-WT had Pro83 in the trans conformation. A BLAST42 search of the PDB database and a DALI43 server search predicts that Nhp2p is structurally most similar to H. sapiens 15.5 kD (human homolog of Snu13p), followed by S. cervisiae Snu13p, the putative C. parvum Nhp2, and P. furiosus L7Ae. Sequence homology for these proteins with Nhp2p is 63%, 58%, 74%, and 68%, respectively (Figure 2A). The residues that are equivalent to Nhp2p Pro83 have a cis conformation in the solution structure of 15.5kD (2JNB)44 and the crystal structures of Snu13p (2ALE),45 L7Ae (1PXW, 1XBI),46,47 L7Ae in complex with K-loop RNA (1SDS),48 15.5kD in complex with RNA (1E7K),39 and L7Ae in various H/ACA RNP complexes with RNA (2HVY, 3HJW, 3HAX).28,29,33 We therefore wanted to confirm that the major conformation of Nhp2p-WT had a trans Pro83 and to determine the structure of Nhp2p with Pro83 in the cis conformation. Since the identity of the residue preceding a Pro can influence the conformation of the peptide bond,4952 we investigated the effect of the S82E and S82W amino acid substitutions. These substitutions were chosen because homologous proteins have an acidic residue (Glu or Asp) at position 82, and Trp has been shown to increase the ratio of cis:trans proline conformers in α-hemoglobin stabilizing protein.50 1H-15N HSQC spectra of Nhp2p-S82E showed more doubled peaks than Nhp2p-WT. Thus, the Glu substitution does not induce Nhp2p to form a single conformation with cis Pro83 as seen in structures of homologous proteins. The 1H-15N HSQC spectra of Nhp2p-S82W showed a well-dispersed peak pattern with the same number of doubled peaks as Nhp2p-WT. However, the ratio of the cross peak volumes for almost all the doubled peaks changed from 60:40 to 40:60 (Figure 1C,D). This indicates that the minor conformation in Nhp2p-WT is the major conformation in Nhp2p-S82W.
The spectra of Nhp2p-S82W also allowed us to assign Ala84, whose amide was missing in Nhp2p-WT, and therefore confirmed that the major conformation of Pro83 is trans in Nhp2p-WT and cis in Nhp2p-S82W. The chemical shift difference δ(13Cβ)-δ(13Cγ) for proline is diagnostic for the conformation of the preceding peptide bond, with average values of 4.5 ± 1.2 and 9.6 ± 1.3 ppm observed for trans and cis isomers, respectively.50,53,54 The chemical shift difference δ(13Cβ)-δ(13Cγ) for the major conformation of Pro83 in Nhp2-WT was 5.34 ppm, indicating a trans Ser82-Pro83 conformation, and 8.11 ppm for Nhp2-S82W, indicating a cis peptidyl conformation. Further evidence for the proline conformations was obtained from 13C-edited NOESY spectra, which show a strong αHn-1-αHn(Pro) NOE cross peak for the cis conformation and a weak or no visible NOE cross peak for the trans conformation.
We were unable to unambiguously determine the peptide bond conformation for Pro119, since we could not assign the Pro119 13Cβ and 13Cγ chemical shifts or the Hα resonance of Arg118. The chemical shift analyses of 13Cβ and 13Cγ show that the conformation of all other prolines is trans except for Pro83, Pro33, and Pro105, which show a mixture of cis and trans as discussed above.
Solution structures of Nhp2p with the cis and trans conformation of Pro83
The structure calculations for Nhp2p-WT and Nhp2p-S82W (residues 36–156) were performed using 915 and 1001 interproton distance restraints, respectively, and 177 and 178 dihedral angle restraints, respectively (Table 1). The N-terminal unstructured part of the construct (Met24 to Ala35, 12 a.a.) was not included in the structure calculations due to lack of restraints. For the residues with two sets of peaks, indicative of two conformations, we used restraints associated with the larger populated state only, which corresponded to the trans conformation of Pro83 in Nhp2p-WT and the cis conformation of Pro83 in Nhp2p-S82W. Due to the spectral overlap from the doubling of many resonances, the backbone and side chain assignments were only about 90% complete for both proteins. Superposition of the 20 lowest energy structures for Nhp2p-WT and Nhp2p-S82W for residues 36–156 are shown in Figure 2B,C. While most of the secondary structure of Nhp2p-WT and Nhp2p-S82W is well defined (Table 1) except for the beginning of α3, the β4-α5 loop (residues 126–138) and α4-β4 loop (residues 112–118) are less well determined.
Table 1
Table 1
Structural statistics for Nhp2p-WT and Nhp2p-S82W
The protein structure for both Nhp2p-WT (trans Pro83) and Nhp2p-S82W (cis Pro83) is composed of four β-strands and five α-helices organized in a αβαβαβαβα order (Figure 2). It is a three-layered α-β-α sandwich, as seen in the homologous proteins, with one layer comprising α-helices 4, 1, and 5, the middle layer comprising a four-stranded β-sheet with 1(↑), 4(↓), 2(↑), and 3(↑) order, and the other layer comprising α-helices 2 and 3, which are parallel with the β-strands. Based on the sequence alignment with homologous proteins (Figure 2A) Nhp2p has a relatively longer amino acid sequences between β4 and α5 than the homologous proteins, and in the structure this region contains a short helical element (N130 to K133) in the middle. However, the location of α5 is very similar to that of the homologous proteins (see Figure 5).
Figure 5
Figure 5
Comparison of Nhp2p with homologous proteins
In the structure of Nhp2p-WT, the Ser82-Pro83 αH distance is 4.89Å, while in Nhp2p-S82W the equivalent αH distance is 2.31Å. For comparison, the Glu61-Pro62 αH distance in 15.5kD is 2.5Å and 1.02Å in the free and RNA bound structures, respectively. Analysis of the 1H-15N HSQC spectra of Nhp2p-WT and Nhp2p-P83A shows that Pro83 cis/trans isomerization affects the chemical shifts of many residues on helix α2, α3, α4, and the β-sheet (Figure 3A). Remarkably, the residues that have doubled peaks due to cis/trans isomerization of Pro83 are localized to the face of the protein that interacts with Nop10 and H/ACA RNA in the homologous L7Ae complexes28,29 (Figure 3A,B). There is a strong correspondence between the doubled peaks on helix α3 and helix α2 and the residues that would be expected to interact with Nop10 and RNA, respectively. Pro83 is in the β2-α3 turn and caps the N-terminal end of helix α3. Superposition of Nhp2p-WT and Nhp2p-S82W shows that changing the prolyl peptide bond from trans to cis has a significant effect on the position of helix α3, which moves closer to helix α2 (Figure 3C,D). The distance between α2 and α3 is ~9.5 Å in Nhp2p-WT (trans Pro83) and ~8.0Å for Nhp2p-S82W (cis Pro83). These two helices are separated by ~7.0Å in L7Ae in the H/ACA RNP.33 Helix α3 of Nhp2p-WT is also angled up ~10° relative to the position of α3 of Nhp2p-S82W. The positions of the trans and cis proline side chains are substantially different, with cis Pro83 much closer to helix α2, and the backbones of the preceding residue 82 point in opposite directions (Figure 3D). Of the two other prolines that also show cis/trans isomerisation, Pro105 is in the loop between β3 and α4, and is on the opposite side of the protein from Pro83 (Figure 2D,E), and the cis/trans isomerization has only small local effects on the structure. Pro33 is in the disordered N-terminus, which is not shown in the final structures.
Figure 3
Figure 3
Effect of proline isomerization on the structure of Nhp2p
Although the NMR (and CD) spectra indicate that Nhp2p-WT, Nhp2p-P83A, and Nhp2p-S82W all form folded structures, CD spectra (Figure S2) showed that Nhp2p-P83A is much more stable and Nhp2p-S82W is somewhat less stable than Nhp2p-WT. These results indicate that even though the absence of the Pro83 in Nhp2p-P83A partially destabilizes helix α3, overall the trans conformation at position 83 results in a more stable protein fold.
The S82W substitution stabilizes the association of Nhp2p with H/ACA snoRNPs, while the Nhp2p-P83A mutant shows reduced interaction with H/ACA snoRNPs
We hypothesized that adoption of the cis conformation is important for Nhp2p function and H/ACA RNP formation in vivo, since L7Ae as well as other homologous proteins all have a cis proline at the same position. To test this hypothesis, we constructed plasmids expressing full-length FLAG-tagged versions of Nhp2p, either wild-type or with the S82W or P83A mutations. These mutations were chosen because Nhp2p-S82W has a higher proportion of cis Pro83 (60%) than Nhp2p-WT, while position 83 in Nhp2p-P83A is locked in the trans conformation. The plasmids were transformed into a wild-type strain and the genomic copy of NHP2 was deleted, such that the only sources of cellular Nhp2p were the plasmid borne versions.
The strains expressing full-length FLAG-tagged Nhp2p, Nhp2p-P83A, and Nhp2p-S82W all showed comparable growth rates and levels of Nhp2p expression (Figure S3), showing that these FLAG-tagged versions of Nhp2p are functional, and that the mutations do not grossly affect Nhp2p function or expression in vivo. However, significant differences were observed when we investigated the stability of the interaction of Nhp2p mutants with H/ACA snoRNPs in vivo. As Nhp2p is a stable core component of yeast H/ACA snoRNPs, we assessed the association of the S82W and P83A mutants with H/ACA snoRNPs by monitoring their interaction with H/ACA snoRNAs in co-immunoprecipitation experiments. We used anti-FLAG antibodies to pull-down FLAG-tagged Nhp2p wild-type, -S82W, or -P83A and assessed the level of Nhp2-associated snoRNAs by Northern blot (Figure 4A). Immunoprecipitation experiments were performed at either physiological salt concentration (150 mM NaCl), or at higher, more stringent salt concentration 500 mM NaCl. As H/ACA snoRNP complexes are stable, we found that Nhp2p is capable of interaction with H/ACA snoRNAs at 500 mM NaCl (Figure 4A), consistent with previous reports.17,55 No immunoprecipitation of the U1 snRNA was observed in any of these conditions (Figure 4A), confirming the specificity of these co-immunoprecipitations studies. Only small differences in the level of snoRNA pulled down with Nhp2p, Nhp2p-P83A, and Nhp2p-S82W were observed in low salt conditions (Figure 4A). However under more stringent high salt conditions, Nhp2p-S82W showed a higher level of association than the wild-type version with snoRNAs, especially for snR37 and snR42 and to a lesser extent snR32. In contrast, at this salt concentration Nhp2p-P83A exhibited an almost complete loss of interaction with all snoRNAs. The stronger association of S82W with some specific snoRNAs should be considered in light of the observation that Nhp2p-S82W is somewhat less stable than Nhp2p-WT (see above). These results correlate well with the level of cis peptide bond conformation between residues 82 and 83 in the different Nhp2p versions.
Figure 4
Figure 4
Nhp2-P83A shows decreased association with H/ACA snoRNA and proteins, while Nhp2p-S82W stabilizes the association with H/ACA snoRNPs
To confirm that the RNA pull-downs accurately reflect the association of Nhp2p with the intact H/ACA snoRNPs and not just with the H/ACA snoRNAs, we assessed the interaction of these various versions of Nhp2p with Cbf5p. We performed a second set of co-precipitation experiments using wild-type and mutant Nhp2p constructs expressed in a strain containing a TAP-tagged version of Cbf5p. After pull down with Calmodulin-Sepharose beads to precipitate the TAP-tagged Cbf5p, we monitored the association of wild-type and mutant versions of Nhp2p by western blot using anti-FLAG antibodies. While the amount of Cbf5p precipitated was similar for all constructs (Figure 4B), we found that the S82W version of Nhp2p associated more robustly with Cbf5p than the wild-type Nhp2p, especially at more stringent salt conditions (Figure 4B). This result shows that despite the variability of association with individual snoRNAs observed in Figure 4A, Nhp2-S82W is more strongly associated with the bulk of H/ACA snoRNPs than the wild-type version. In contrast the P83A mutant showed a much-reduced association with Cbf5p in these conditions (Figure 4B, which is consistent with the results observed in the RNA co-immunoprecipitation experiments. In conclusion, we found that increasing the conformation of Pro83 to cis using the S82W mutation stabilizes the association of Nhp2p with most H/ACA RNPs, while the P83A mutation strongly decreases its association with the RNPs. We cannot rule out that the deletion of the conserved Pro83 in Nhp2p-P83A, rather than the obligate trans conformation induced by the alanine substitution, is responsible for the decreased association with H/ACA RNPs. Nevertheless, the results with Nhp2p-S82W strongly support the hypothesis that the cis conformation of Pro83 of Nhp2p strengthens the association of Nhp2p with the other components of the H/ACA RNPs in vivo.
Comparison of the structure of Nhp2p to functional orthologues
Box C/D and H/ACA RNPs function in site-specific 2′O methylation and pseudouridylation of ribosomal and snRNAs.31,56,57 The archaeal L7Ae, S. cerevisiae Snu13p, and H. sapiens 15.5 kD proteins bind specifically to K-turn motifs present in box C/D RNAs.38,39,48,5860 L7Ae also has specificity for the related K-loop motif found in archaeal H/ACA RNAs.18,30,34,61 In eukaryotic H/ACA RNPs, which do not contain a K-loop motif, L7Ae is replaced by Nhp2. In contrast to L7Ae, which binds specifically to K-loop or K-turn RNA in the absence of other box C/D or box H/ACA proteins, Nhp2p binds non-specifically to irregular stem-loops in vitro.37 In vivo, Nhp2p assembles with Nop10p and Cbf5 (the pseudouridylase), and the ternary complex confers specificity for the H/ACA RNA.20
While the structures of archaeal H/ACA RNPs, proteins and RNA complexes have provided detailed insight into their architecture and functional roles,41 there is little structural information on eukaryotic H/ACA proteins. Comparison of the structures of Nhp2p and of the homologous proteins 15.5 kD, Snu13p, L7Ae, and the putative C. parvum Nhp2 in the free state (Figure 5A) shows that, on the RNA and protein binding surface, all these proteins have a similar helix α2 length but there are differences in the length and structure of helix α3. The N-terminal end of helix α3 has a kink or bend in Nhp2p-S82W, Snu13p, C. parvum putative Nhp2, and L7Ae and the helix is shorter in 15.5 kD. The putative Nhp2 from C. parvum, identified by structural genomics,62 has a structure and sequence more similar to L7Ae than Nhp2p. Nhp2p has a higher pI (9.73) than the homologous proteins (Snu13p, L7Ae, C. parvum putative Nhp2p, and 15.5kD have pIs of 6.57, 5.35, 5.85, and 8.36, respectively) and the binding surface is more positively charged (Figure 5B). Comparison of the electrostatic potential surface of Nhp2p reveals that the protein-binding region (primarily helix α3) is less negatively charged and the RNA binding region (primarily helix α2) is more positively charged than the homologous proteins. The more positively charged RNA binding region on Nhp2p may facilitate stronger electrostatic interactions to compensate for lower specificity of interaction with a broader range of RNA substrates that do not have a K-loop or K-turn.
Our structure also provides insights into the effects of two human Nhp2 mutations associated with dyskeratosis congenita, V126M and Y139H, which have been shown to affect RNP assembly.63 Analysis of the structure shows that the equivalent residues, V122 and F146 in Nhp2p, are at the beginning of β4 and within α5, respectively. F146 is in the hydrophobic core, and the human mutation to histidine would be expected to destabilize the protein. V122 is in the RNA binding region and is the first residue in β4 of Nhp2p, so a mutation to methionine could destabilize both the hydrophobic core and RNA binding.
Conformational flexibility at the H/ACA RNA and Nop10 binding interface
The structural studies of Nhp2p presented here revealed that three prolines, Pro33, Pro105, and the universally conserved Pro83, are undergoing cis/trans isomerization, leading to conformational flexibility. Pro33 is in the flexible N-terminus of the protein, such that cis/trans isomerization of this proline has little effect on the folded structure. Pro105 is at the beginning of the β3-α4 loop. It is localized on the opposite surface of the protein from the Nop10- and RNA-binding surface (Figure 2), and also has only a local effect on the structure. In contrast, the cis/trans isomerization of the conserved Pro83 results in significant chemical shift differences for residues on the protein and RNA binding interface, and a large change in the positions of the proline and adjacent loop residues and of helix α3 relative to helix α2 (Figure 3 and and6),6), as discussed further below.
Figure 6
Figure 6
Comparison of the Nop10 and RNA binding interface of Nhp2p-WT, Nhp2p-S82W, and L7AE
Among Nhp2p orthologues studied to date, only Nhp2p has been found to show cis/trans isomerization of the universally conserved Pro83. Of these proteins, only the structure of 15.5kD protein has been solved in solution by NMR. Published 1H-15N HSQC spectra of 15.5kD44 and Snu1364 clearly show no indication of cis/trans isomerization of the residue equivalent to Pro83. Nevertheless, the NMR study of 15.5kD protein also showed that helix α3, which interacts with the 61kD protein, is conformationally dynamic, and the flexibility of α3 was suggested to be an important attribute of the protein interaction interface.44 As discussed above, helix α3 is less well defined and much more variable in length and structure than helix α2 (Figure 5) among the homologous proteins, perhaps indicating variability in the intrinsic flexibility of the free proteins, with L7Ae being the most rigid and Nhp2p being the most flexible. Many eukaryotic proteins adopt multiple conformations in the absence of binding partners.65,66 In the case of Nhp2p, interconversion between the major conformations due to Pro83 cis/trans isomerization may drive the formation of the ternary Cbf5-Nop10-Nhp2 complex prior to assembly with the H/ACA RNA. This in turn assures that Nhp2p binds specifically to H/ACA RNAs rather than non-specifically to any RNA stem-loop.
The cis conformation of Pro83 plays a key role at the H/ACA RNA and Nop10 binding interface
Figure 6 illustrates the positions of the side chains on the putative RNA and Nop10 binding surface, which are localized primarily on the helix α2 and helix α3 surface, of Nhp2p-WT (trans) and Nhp2p-S82W (cis) compared with L7Ae in the archaeal H/ACA RNP (PDB ID: 2HVY). In Nhp2p-WT with trans Pro83, helix α3 is positioned ~9.5 Å from helix α2, while in Nhp2p-S82W, with cis Pro83, helix α3 is positioned ~8.0 Å from helix α2. This shifts the side chains of the putative Nop10 binding residues H89, L93 (α3), and V64 (α2) closer together to form a more compact binding surface, as observed for the equivalent residues H66, L70, and T41 in L7Ae. The repositioning of helix α3 relative to helix α2 also puts the RNA binding residues, which are on helix α2 and the α4-β4 loop, closer to the Nop10 binding surface.
L7Ae interacts with the archaeal RNAs at the K-loop motif, with additional contacts to some phosphates in the stem below the A-G base pairs. The K-loop motif contains tandem G-A, A-G base pairs at the top of a stem-loop with a conserved G/A-N-G/U sequence on the 3′ side of the loop.34 These stem–loops are related by sequence and structure to the K-turn, which consists of two RNA stems separated by a short asymmetric loop with a characteristic sharp bend (kink) between the two stems, one with tandem A-G base pairs, the other with Watson-Crick pairs.67 The residues that have side-chain or backbone hydrogen bond or electrostatic interactions with the RNA K-loop and stem are R34, K35, N38, E39, K42, R46, D59, A96, A98 in L7Ae,33 which correspond to K57, R58, K61, E62, K65, K69, S82, S121, and V123 in Nhp2p. The lysine and arginine residues are conserved, and the other residues hydrogen bond via their backbone atoms. Significantly, as discussed in the following, the cis conformation of Pro83 changes the position of residue 82 so that its backbone amide and carbonyl point toward instead of away from the putative RNA binding surface on helix α2 (Figure 3D).
In the archaeal P. furiosus H/ACA RNP, a series of prolines in Cbf5, Nop10, and L7Ae stack on each other to form a proline spine (Figure 6D),41 which connects the flipped out nucleotides at the active site to the functionally important L7Ae. The universally conserved Pro83 corresponds to L7Ae Pro60, the last proline in the proline spine. Pro60 interacts with Pro33 of Nop10 and stacks over the flipped out U of the K-loop. In addition, the cis conformation of Pro60 positions the peptide backbone NH and C=O of Asp59 to hydrogen bond to the C2 carbonyl and N3 imino of the flipped out U (Figure 6D). The amino acid at position 59 (Ser82 in Nhp2p) is not conserved, but since the hydrogen bonds with the flipped out uracil are from the peptide backbone, the identity of the side chain at this position is not important. In fact, in the archaeal M. jannaschii L7Ae the equivalent residue is a lysine and makes identical interactions with the RNA base. The same contacts are seen in the complexes of the homologous proteins 15.5 kD and Snu13 with K-turns in box C/D snoRNAs.
The Nhp2p-S82W substitution stabilized the binding to H/ACA RNPs, consistent with our proposal that the stabilization is due to the cis conformation of Pro83, while Nhp2p-P83A reduces binding to the RNP. Remarkably, the cis Pro83 and Ser82 are positioned to interact with Nop10 and the RNA in the same way as for L7Ae. However, eukaryotic H/ACA RNPs do not have a K-turn or K-loop motif. Since the universally conserved proline (at position 83 in Nhp2p) and the preceding residue appear to have a conserved structure and interaction with a flipped out U among a diverse set of homologous proteins, we examined the secondary structure of H/ACA RNAs in S. cerevisiae for which substrates have been identified (http://yeastgenome.org and http://people.biochem.umass.edu/fournierlab/snornadb/main.php).68 Approximately 73% (27 of 37) have a U, ten or eleven base pairs from the top of the pseudouridylation pocket at or near a loop, that could potentially bulge out to hydrogen bond with the Ser82 backbone. In the K-loop found in archaeal H/ACA RNAs, the universally conserved bulge U is ten base pairs from the top of the pseudouridylation pocket, counting the two G•A base pairs. We hypothesize that Pro83 in Nhp2p serves the same function as Pro60 in L7Ae, adopting the cis conformation in the complex with Nop10-Cbf5, which correctly positions Pro83 next to Pro33 of Nop10 and the backbone of the Ser82 to hydrogen bond with a bulged out U on the upper stem-loop of the H/ACA RNA. We conclude that Nhp2p Pro83 may play a key role in the assembly of the eukaryotic H/ACA RNP, with the cis conformation locking in a stable Cbf5-Nop10-Nhp2 ternary complex and positioning the protein backbone to interact with the H/ACA RNA, thus stabilizing the overall structure of H/ACA RNPs.
Protein Purification for Structural Studies
The gene encoding S. cerevisiae Nhp2p-WT(Nhp2p24–156) was cloned into the pET24a vector as a C-terminal histidine-tagged fusion (Novagen), and the construct was used to transform E. coli strain BL21(DE3) gold cells (Stratagene). Uniformly 15N- and 15N/13C labeled proteins were obtained by growing the transformed E. coli cells in M9-minimal media containing 15NH4Cl (Cambridge Isotopes Inc.) and unlabeled/13C6-labeled-D-glucose (Cambridge Isotope Inc.) as the sole nitrogen and carbon sources, respectively. Selectively 15N-Ile-labeled Nhp2p-S82W was prepared by incorporating 98% [15N]Ile in growth medium containing a mixture of the other unlabeled amino acids. A final concentration of 0.2 % (v/v) polyethylenimine applied to the crude lysate largely removed nucleic acid without precipitating the proteins. The proteins were purified by FPLC column chromatography with a Ni-NTA affinity column (GE Healthcare) followed by Resource S ion exchange and Superdex-75 (GE Healthcare) gel filtration. The purity and homogeneity of all samples were confirmed by SDS-PAGE.
Site-directed mutagenesis for six single P→A mutants (P83A, P91A, P100A, P105A, P119A and P127A), S→W mutant (S82W) and S→E mutant (S82E) was performed by PCR using the QuikChange site-directed mutagenesis kit (Stratagene). Mutations were confirmed by DNA sequencing. NMR samples for the Nhp2p-P83A and Nhp2p-S82W were prepared with the same purification procedure of the wild-type protein (Nhp2p-WT).
NMR spectroscopy and solution structure calculations
All spectra for assignments and structure determination were obtained on Bruker DRX 600 and 800 MHz spectrometers at 293 K (Nhp2p-P83A) and 298 K (Nhp2p-WT and Nhp2p-S82W). Backbone assignments of Nhp2p-WT and Nhp2p-S82W were obtained following standard procedures69 from CBCANH, HNCACB, CBCA(CO)NH, HNCO, and HN(CA)CO using uniformly 15N,13C-labeled proteins in a 90% H2O/10% D2O solution containing 20 mM HEPES-KOH, pH 7.4, 200 mM NaCl, 0.1 mM EDTA, 1 mM DTT. The same series of experiments were done for Nhp2p-P83A in a 90% H2O/10% D2O solution containing 100 mM sodium phosphate, 100 mM NaCl (pH 6). Side-chain assignments were obtained using HBHA(CO)NH70 and HCCH-TOCSY71 for each protein. Many residues have two sets of cross-peaks caused by cis/trans isomerization of Pro83 and to a lesser extent Pro33 and Pro105. Sidechain assignments were obtained only for the most populated conformer in each protein, which corresponds to Pro83 trans for Nhp2p-WT and Nhp2p-P83A and Pro83 cis for Nhp2p-S82W. The proline side chain carbon resonances were assigned from CC(CO)NH and HNCACB experiments, and the chemical shift difference δ(13Cβ)-δ(13Cγ) for proline was used to determine the proline peptide bond conformation (average values of 4.5 ± 1.2 and 9.6 ± 1.3 ppm for trans and cis isomers, respectively50,53,54). Side chain assignments for the 7 isoleucines were obtained or confirmed by analysis of 1H-15N HSQC spectrum of 15N-Ile- labeled Nhp2p-S82W.
The NOE cross-peaks for distance restraints were obtained from 3D 13C-edited NOESY-HSQC (τm=150 msec) and 3D 15N-edited NOESY-HSQC (τm=120 and 150 msec).72 Only cross peaks from the most populated conformer were used in the structure calculation. NOE-derived interproton distance restraints were classified into three ranges: 1.8–2.8, 1.8–3.4 and 1.8–5.0 Å, corresponding to strong, medium, and weak NOE cross-peak intensities, respectively. An additional 0.5 Å was added to the upper bound for NOEs involving methyl groups. The dihedral angle restraints were extracted from TALOS chemical shift analysis.73 The hydrogen bond restraints were determined based on the slowly exchanging amide protons identified by recording 1H-15N HSQC after a 15N-labeled protein sample had been exchanged into a D2O buffer. All data were processed with Topspin (Bruker) and NMRPipe,74 and analyzed with the program Sparky (http://www.cgl.ucsf.edu/home/sparky).
Structure calculations were performed with CYANA 2.175 and validated using Pro-Check NMR.76 Unambiguous side-chain NOE cross-peak assignments were obtained manually and used in an initial round of structure calculations to identify the secondary-structure topology. These initial structures were used to filter possible assignments for previously ambiguous peaks. Seven cycles of CYANA generated further side-chain assignments, each cycle having 10,000 steps of torsion-angle dynamics with a simulated annealing protocol. A set of 100 structures was calculated, and the 20 structures with the lowest target function values were chosen for analysis. Structures were visualized using the programs PyMOL (http://www.pymol.org) and MOLMOL.77
Yeast expression plasmids and immunoprecipitation assays
NHP2 full-length constructs were PCR-amplified for insertion into the centromeric plasmids pUG34 and pUG3678 by the addition of XbaI and EcoRI sites at the 5′ and 3′ end, respectively, of the oligonucleotide primers. The sequence for a FLAG epitope tag flanked by glycine residues (GGCGATTACAAGGATGACGACGATAAGGGT) was inserted at the C-terminus of the NHP2 constructs by inclusion of the complementary sequence in the oligonucleotide 3′ primer. Cloning of the NHP2 constructs into pUG34 and pUG36 with XbaI and EcoRI resulted in removal of eGFP but maintained the MET25-P. Constructs were confirmed by sequencing.
Yeast media and manipulations were as described.79 NHP2 plasmid constructs were transformed in BY4741 and Cbf5TAP (Open Biosystems). NHP2 was disrupted using the KanMX6 marker from pFA6a-kanMx680 amplified with a forward primer containing 49 nt of NHP2 sequence upstream of the 5′ end and a reverse primer containing 56 nt of NHP2 sequence downstream of the 3′ end. The amplified DNA was transformed into strains containing NHP2 full-length FLAG tagged wild-type and mutant constructs, plated on YPD overnight and replica-plated on YPD-G418 (200 μg/ml). Deletion of NHP2 was confirmed by PCR. We found that the low levels of expression of Nhp2p from the MET25 promoter when strains were grown in methionine-containing medium (basal levels of transcription from the MET25 promoter) were sufficient to complement the deletion of the NHP2 gene. Therefore, to avoid any issues linked to overexpression of Nhp2p, strains were grown in the presence of methionine to keep the expression of Nhp2p to minimal levels.
Immunoprecipitations, western and northern blots
Immunoprecipitations of Nhp2pFLAG were carried out by growing strains in appropriate selective media at 30°C to OD600 between 0.4 and 0.6, washed once with H2O, and resuspended in NET-2 (40 mM Tris-HCl pH 7.5, 150 mM NaCl, 0.05% IGEPAL) and protease inhibitor cocktail (complete EDTA-free, Roche). Cell disruption was done by addition of glass beads and vortexing. Samples were sedimented at 2500 r.p.m. in a micro-centrifuge followed by supernatant sedimentation at 16,000 g for 20 min in a micro-centrifuge. Lysates were added to anti-FLAG M2 agarose beads (Sigma) with NET-2 at a final concentration of 150 mM or 500 mM NaCl for immunoprecipitations and incubated at 4°C for 1 hr. Beads were washed in NET-2 with either 150 mM or 500 mM NaCl final concentration. RNAs were extracted by phenol, ethanol precipitated and resuspended in H2O. RNAs were fractionated in 5% polyacrylamide/8 M urea gels. Northern blots and snoRNA probes were as described.81
Immunoprecipitations of Cbf5pTAP strains were carried out as above but cells were resuspended in IPP150 without EDTA (10 mM β-Me, 10 mM Tris HCl pH 8.0, 150 mM NaCl, 1 mM MgAcetate, 1 mM Imidizole, and 0.1% IGEPAL) and pull-downs were carried out with Calmodulin Sepharose 4B (GE Healthcare). After washing, beads were split in half for RNA and protein sample extraction. Protein samples were heated at 100°C for 10 min in SDS-sample buffer. For western blots, anti-FLAG monoclonal antibodies (Sigma) at 1:5000 with goat anti-mouse HRP linked IgG at 1:10000 and Peroxidase anti-peroxidase at 1:1000 were used and revealed by Super Signal West Femto (Thermo Scientific) ECL system.
Accession numbers
Coordinates and restraints for the 20 lowest energy structures of Nhp2p-WT (residues 36–156) and Nhp2p-S82W (residues 35–156) have been deposited in the Protein Data Bank with accession numbers 2LBX and 2LBW, respectively. NMR assignments have been deposited in the Biological Magnetic Resonance Bank (accession numbers 17579 and 17578).
Supplementary Material
01
Acknowledgments
This work was supported by NIH grants GM37254 and GM48123 to J.F. and by grants ACS RSG-06-040 and NIH GM61518 to G.C. The authors thank Joel Mackay for helpful advice on making the proline to alanine mutations.
Footnotes
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
1. Terns M, Terns R. Noncoding RNAs of the H/ACA family. Cold Spring Harb Symp Quant Biol. 2006;71:395–405. [PubMed]
2. Rozhdestvensky TS, Tang TH, Tchirkova IV, Brosius J, Bachellerie JP, Huttenhofer A. Binding of L7Ae protein to the K-turn of archaeal snoRNAs: a shared RNA binding motif for C/D and H/ACA box snoRNAs in Archaea. Nucleic Acids Res. 2003;31:869–77. [PMC free article] [PubMed]
3. Heiss NS, Knight SW, Vulliamy TJ, Klauck SM, Wiemann S, Mason PJ, Poustka A, Dokal I. X-linked dyskeratosis congenita is caused by mutations in a highly conserved gene with putative nucleolar functions. Nat Genet. 1998;19:32–8. [PubMed]
4. Meier UT, Blobel G. NAP57, a mammalian nucleolar protein with a putative homolog in yeast and bacteria. J Cell Biol. 1994;127:1505–14. [PMC free article] [PubMed]
5. Ganot P, Caizergues-Ferrer M, Kiss T. The family of box ACA small nucleolar RNAs is defined by an evolutionarily conserved secondary structure and ubiquitous sequence elements essential for RNA accumulation. Genes Dev. 1997;11:941–56. [PubMed]
6. Balakin AG, Smith L, Fournier MJ. The RNA world of the nucleolus: two major families of small RNAs defined by different box elements with related functions. Cell. 1996;86:823–34. [PubMed]
7. Dennis PP, Omer A. Small non-coding RNAs in Archaea. Curr Opin Microbiol. 2005;8:685–94. [PubMed]
8. Tang TH, Bachellerie JP, Rozhdestvensky T, Bortolin ML, Huber H, Drungowski M, Elge T, Brosius J, Huttenhofer A. Identification of 86 candidates for small non-messenger RNAs from the archaeon Archaeoglobus fulgidus. Proc Natl Acad Sci U S A. 2002;99:7536–41. [PubMed]
9. Thebault P, de Givry S, Schiex T, Gaspin C. Searching RNA motifs and their intermolecular contacts with constraint networks. Bioinformatics. 2006;22:2074–80. [PubMed]
10. Muller S, Leclerc F, Behm-Ansmant I, Fourmann JB, Charpentier B, Branlant C. Combined in silico and experimental identification of the Pyrococcus abyssi H/ACA sRNAs and their target sites in ribosomal RNAs. Nucleic Acids Res. 2008;36:2459–75. [PMC free article] [PubMed]
11. Zebarjadian Y, King T, Fournier MJ, Clarke L, Carbon J. Point mutations in yeast CBF5 can abolish in vivo pseudouridylation of rRNA. Mol Cell Biol. 1999;19:7461–72. [PMC free article] [PubMed]
12. Ni J, Tien AL, Fournier MJ. Small nucleolar RNAs direct site-specific synthesis of pseudouridine in ribosomal RNA. Cell. 1997;89:565–73. [PubMed]
13. Wu H, Feigon J. H/ACA small nucleolar RNA pseudouridylation pockets bind substrate RNA to form three-way junctions that position the target U for modification. Proc Natl Acad Sci U S A. 2007;104:6655–60. [PubMed]
14. Jin H, Loria JP, Moore PB. Solution structure of an rRNA substrate bound to the pseudouridylation pocket of a box H/ACA snoRNA. Mol Cell. 2007;26:205–15. [PubMed]
15. Girard JP, Lehtonen H, Caizergues-Ferrer M, Amalric F, Tollervey D, Lapeyre B. GAR1 is an essential small nucleolar RNP protein required for pre-rRNA processing in yeast. EMBO J. 1992;11:673–82. [PubMed]
16. Henras A, Henry Y, Bousquet-Antonelli C, Noaillac-Depeyre J, Gelugne JP, Caizergues-Ferrer M. Nhp2p and Nop10p are essential for the function of H/ACA snoRNPs. EMBO J. 1998;17:7078–90. [PubMed]
17. Watkins NJ, Gottschalk A, Neubauer G, Kastner B, Fabrizio P, Mann M, Luhrmann R. Cbf5p, a potential pseudouridine synthase, and Nhp2p, a putative RNA-binding protein, are present together with Gar1p in all H BOX/ACA-motif snoRNPs and constitute a common bipartite structure. RNA. 1998;4:1549–68. [PubMed]
18. Baker DL, Youssef OA, Chastkofsky MI, Dy DA, Terns RM, Terns MP. RNA-guided RNA modification: functional organization of the archaeal H/ACA RNP. Genes Dev. 2005;19:1238–48. [PubMed]
19. Rashid R, Liang B, Baker DL, Youssef OA, He Y, Phipps K, Terns RM, Terns MP, Li H. Crystal structure of a Cbf5-Nop10-Gar1 complex and implications in RNA-guided pseudouridylation and dyskeratosis congenita. Mol Cell. 2006;21:249–60. [PubMed]
20. Wang C, Meier UT. Architecture and assembly of mammalian H/ACA small nucleolar and telomerase ribonucleoproteins. EMBO J. 2004;23:1857–67. [PubMed]
21. Lukowiak AA, Narayanan A, Li ZH, Terns RM, Terns MP. The snoRNA domain of vertebrate telomerase RNA functions to localize the RNA within the nucleus. RNA. 2001;7:1833–44. [PubMed]
22. Mitchell JR, Cheng J, Collins K. A box H/ACA small nucleolar RNA-like domain at the human telomerase RNA 3′ end. Mol Cell Biol. 1999;19:567–76. [PMC free article] [PubMed]
23. Pogacic V, Dragon F, Filipowicz W. Human H/ACA small nucleolar RNPs and telomerase share evolutionarily conserved proteins NHP2 and NOP10. Mol Cell Biol. 2000;20:9028–40. [PMC free article] [PubMed]
24. Egan ED, Collins K. Specificity and stoichiometry of subunit interactions in the human telomerase holoenzyme assembled in vivo. Mol Cell Biol. 2010;30:2775–86. [PMC free article] [PubMed]
25. Trahan C, Dragon F. Dyskeratosis congenita mutations in the H/ACA domain of human telomerase RNA affect its assembly into a pre-RNP. RNA. 2009;15:235–43. [PubMed]
26. Vulliamy T, Beswick R, Kirwan M, Marrone A, Digweed M, Walne A, Dokal I. Mutations in the telomerase component NHP2 cause the premature ageing syndrome dyskeratosis congenita. Proc Natl Acad Sci U S A. 2008;105:8073–8. [PubMed]
27. Walne AJ, Vulliamy T, Marrone A, Beswick R, Kirwan M, Masunari Y, Al-Qurashi FH, Aljurf M, Dokal I. Genetic heterogeneity in autosomal recessive dyskeratosis congenita with one subtype due to mutations in the telomerase-associated protein NOP10. Hum Mol Genet. 2007;16:1619–29. [PMC free article] [PubMed]
28. Duan J, Li L, Lu J, Wang W, Ye K. Structural mechanism of substrate RNA recruitment in H/ACA RNA-guided pseudouridine synthase. Mol Cell. 2009;34:427–39. [PubMed]
29. Liang B, Zhou J, Kahen E, Terns RM, Terns MP, Li H. Structure of a functional ribonucleoprotein pseudouridine synthase bound to a substrate RNA. Nat Struct Mol Biol. 2009;16:740–6. [PubMed]
30. Charpentier B, Muller S, Branlant C. Reconstitution of archaeal H/ACA small ribonucleoprotein complexes active in pseudouridylation. Nucleic Acids Res. 2005;33:3133–44. [PMC free article] [PubMed]
31. Kiss T, Fayet-Lebaron E, Jady BE. Box H/ACA small ribonucleoproteins. Mol Cell. 2010;37:597–606. [PubMed]
32. Hamma T, Reichow SL, Varani G, Ferre-D’Amare AR. The Cbf5-Nop10 complex is a molecular bracket that organizes box H/ACA RNPs. Nat Struct Mol Biol. 2005;12:1101–7. [PubMed]
33. Li L, Ye K. Crystal structure of an H/ACA box ribonucleoprotein particle. Nature. 2006;443:302–7. [PubMed]
34. Nolivos S, Carpousis AJ, Clouet-d’Orval B. The K-loop, a general feature of the Pyrococcus C/D guide RNAs, is an RNA structural motif related to the K-turn. Nucleic Acids Res. 2005;33:6507–14. [PMC free article] [PubMed]
35. Liang B, Xue S, Terns RM, Terns MP, Li H. Substrate RNA positioning in the archaeal H/ACA ribonucleoprotein complex. Nat Struct Mol Biol. 2007;14:1189–1195. [PubMed]
36. Reichow SL, Varani G. Nop10 is a conserved H/ACA snoRNP molecular adaptor. Biochemistry. 2008;47:6148–56. [PubMed]
37. Henras A, Dez C, Noaillac-Depeyre J, Henry Y, Caizergues-Ferrer M. Accumulation of H/ACA snoRNPs depends on the integrity of the conserved central domain of the RNA-binding protein Nhp2p. Nucleic Acids Res. 2001;29:2733–46. [PMC free article] [PubMed]
38. Nottrott S, Hartmuth K, Fabrizio P, Urlaub H, Vidovic I, Ficner R, Luhrmann R. Functional interaction of a novel 15.5kD [U4/U6. U5] tri-snRNP protein with the 5′ stem-loop of U4 snRNA. EMBO J. 1999;18:6119–33. [PubMed]
39. Vidovic I, Nottrott S, Hartmuth K, Luhrmann R, Ficner R. Crystal structure of the spliceosomal 15.5kD protein bound to a U4 snRNA fragment. Mol Cell. 2000;6:1331–42. [PubMed]
40. Watkins NJ, Segault V, Charpentier B, Nottrott S, Fabrizio P, Bachi A, Wilm M, Rosbash M, Branlant C, Luhrmann R. A common core RNP structure shared between the small nucleoar box C/D RNPs and the spliceosomal U4 snRNP. Cell. 2000;103:457–66. [PubMed]
41. Hamma T, Ferre-D’Amare AR. The box H/ACA ribonucleoprotein complex: interplay of RNA and protein structures in post-transcriptional RNA modification. J Biol Chem. 2010;285:805–9. [PubMed]
42. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol. 1990;215:403–10. [PubMed]
43. Holm L, Sander C. Alignment of three-dimensional protein structures: network server for database searching. Methods Enzymol. 1996;266:653–62. [PubMed]
44. Soss SE, Flynn PF. Functional implications for a prototypical K-turn binding protein from structural and dynamical studies of 15.5K. Biochemistry. 2007;46:14979–86. [PubMed]
45. Dobbyn HC, McEwan PA, Krause A, Novak-Frazer L, Bella J, O’Keefe RT. Analysis of pre-mRNA and pre-rRNA processing factor Snu13p structure and mutants. Biochem Biophys Res Commun. 2007;360:857–62. [PubMed]
46. Suryadi J, Tran EJ, Maxwell ES, Brown BA., 2nd The crystal structure of the Methanocaldococcus jannaschii multifunctional L7Ae RNA-binding protein reveals an induced-fit interaction with the box C/D RNAs. Biochemistry. 2005;44:9657–72. [PubMed]
47. Charron C, Manival X, Charpentier B, Branlant C, Aubry A. Purification, crystallization and preliminary X-ray diffraction data of L7Ae sRNP core protein from Pyrococcus abyssii. Acta Crystallogr D Biol Crystallogr. 2004;60:122–4. [PubMed]
48. Hamma T, Ferre-D’Amare AR. Structure of protein L7Ae bound to a K-turn derived from an archaeal box H/ACA sRNA at 1.8 A resolution. Structure. 2004;12:893–903. [PubMed]
49. Jakob RP, Schmid FX. Molecular determinants of a native-state prolyl isomerization. J Mol Biol. 2009;387:1017–31. [PubMed]
50. Gell DA, Feng L, Zhou S, Jeffrey PD, Bendak K, Gow A, Weiss MJ, Shi Y, Mackay JP. A cis-proline in alpha-hemoglobin stabilizing protein directs the structural reorganization of alpha-hemoglobin. J Biol Chem. 2009;284:29462–9. [PubMed]
51. Jakob RP, Schmid FX. Energetic coupling between native-state prolyl isomerization and conformational protein folding. J Mol Biol. 2008;377:1560–75. [PubMed]
52. Reimer U, Scherer G, Drewello M, Kruber S, Schutkowski M, Fischer G. Side-chain effects on peptidyl-prolyl cis/trans isomerisation. J Mol Biol. 1998;279:449–60. [PubMed]
53. Andreotti AH. Native state proline isomerization: an intrinsic molecular switch. Biochemistry. 2003;42:9515–24. [PubMed]
54. Schubert M, Labudde D, Oschkinat H, Schmieder P. A software tool for the prediction of Xaa-Pro peptide bond conformations in proteins based on 13C chemical shift statistics. J Biomol NMR. 2002;24:149–54. [PubMed]
55. Henras AK, Capeyrou R, Henry Y, Caizergues-Ferrer M. Cbf5p, the putative pseudouridine synthase of H/ACA-type snoRNPs, can form a complex with Gar1p and Nop10p in absence of Nhp2p and box H/ACA snoRNAs. RNA. 2004;10:1704–12. [PubMed]
56. Ye K. H/ACA guide RNAs, proteins and complexes. Curr Opin Struct Biol. 2007;17:287–92. [PubMed]
57. Kiss T, Fayet E, Jady BE, Richard P, Weber M. Biogenesis and intranuclear trafficking of human box C/D and H/ACA RNPs. Cold Spring Harb Symp Quant Biol. 2006;71:407–17. [PubMed]
58. Moore T, Zhang Y, Fenley MO, Li H. Molecular basis of box C/D RNA-protein interactions; cocrystal structure of archaeal L7Ae and a box C/D RNA. Structure. 2004;12:807–18. [PubMed]
59. Charron C, Manival X, Clery A, Senty-Segault V, Charpentier B, Marmier-Gourrier N, Branlant C, Aubry A. The archaeal sRNA binding protein L7Ae has a 3D structure very similar to that of its eukaryal counterpart while having a broader RNA-binding specificity. J Mol Biol. 2004;342:757–73. [PubMed]
60. Marmier-Gourrier N, Clery A, Senty-Segault V, Charpentier B, Schlotter F, Leclerc F, Fournier R, Branlant C. A structural, phylogenetic, and functional study of 15.5-kD/Snu13 protein binding on U3 small nucleolar RNA. RNA. 2003;9:821–38. [PubMed]
61. Gagnon KT, Zhang X, Qu G, Biswas S, Suryadi J, Brown BA, 2nd, Maxwell ES. Signature amino acids enable the archaeal L7Ae box C/D RNP core protein to recognize and bind the K-loop RNA motif. RNA. 2010;16:79–90. [PubMed]
62. Vedadi M, Lew J, Artz J, Amani M, Zhao Y, Dong A, Wasney GA, Gao M, Hills T, Brokx S, Qiu W, Sharma S, Diassiti A, Alam Z, Melone M, Mulichak A, Wernimont A, Bray J, Loppnau P, Plotnikova O, Newberry K, Sundararajan E, Houston S, Walker J, Tempel W, Bochkarev A, Kozieradzki I, Edwards A, Arrowsmith C, Roos D, Kain K, Hui R. Genome-scale protein expression and structural biology of Plasmodium falciparum and related Apicomplexan organisms. Mol Biochem Parasitol. 2007;151:100–10. [PubMed]
63. Trahan C, Martel C, Dragon F. Effects of dyskeratosis congenita mutations in dyskerin, NHP2 and NOP10 on assembly of H/ACA pre-RNPs. Hum Mol Genet. 2010;19:825–36. [PubMed]
64. Workman H, Skalicky JJ, Flynn PF. Assignment of 1H, 13C, and 15N resonances of the RNA binding protein Snu13p from Saccharomyces cerevisiae. Biomol NMR Assign. 2008;2:1–3. [PubMed]
65. Boehr DD, Nussinov R, Wright PE. The role of dynamic conformational ensembles in biomolecular recognition. Nat Chem Biol. 2009;5:789–96. [PMC free article] [PubMed]
66. Chao JA, Prasad GS, White SA, Stout CD, Williamson JR. Inherent protein structural flexibility at the RNA-binding interface of L30e. J Mol Biol. 2003;326:999–1004. [PubMed]
67. Klein DJ, Schmeing TM, Moore PB, Steitz TA. The kink-turn: a new RNA secondary structure motif. EMBO J. 2001;20:4214–21. [PubMed]
68. Piekna-Przybylska D, Decatur WA, Fournier MJ. New bioinformatic tools for analysis of nucleotide modifications in eukaryotic rRNA. RNA. 2007;13:305–12. [PubMed]
69. Cavanagh J, Fairbrother WJ, Palmer AG, III, Rance M, Skelton NJ. Protein NMR Spectroscopy: Principles and Practice. 2. Academic Press, Inc; San Diego: 2007.
70. Grzesiek S, Ikura M, Clore GM, Gronenborn AM, Bax A. A 3D Triple-Resonance NMR Technique For Qualitative Measurement of Carbonyl-H-Beta J Couplings in Isotopically Enriched Proteins. J Magn Reson. 1992;96:215–221.
71. Kay LE, Ikura M, Bax A. Proton-proton correlation via carbon-carbon couplings: a three-dimensional NMR approach for the assignment of aliphatic resonances in proteins labeled with carbon-13. J Am Chem Soc. 1990;112:888–889.
72. Kay LE, Ikura M, Tschudin R, Bax A. 3-dimensional triple-resonance NMR spectroscopy of isotopically enriched proteins. J Magn Reson. 1990;89:496–514.
73. Cornilescu G, Delaglio F, Bax A. Protein backbone angle restraints from searching a database for chemical shift and sequence homology. J Biomol NMR. 1999;13:289–302. [PubMed]
74. Delaglio F, Grzesiek S, Vuister GW, Zhu G, Pfeifer J, Bax A. NMRPipe: a multidimensional spectral processing system based on UNIX pipes. J Biomol NMR. 1995;6:277–93. [PubMed]
75. Guntert P. Automated NMR structure calculation with CYANA. Methods Mol Biol. 2004;278:353–78. [PubMed]
76. Laskowski RA, Rullmannn JA, MacArthur MW, Kaptein R, Thornton JM. AQUA and PROCHECK-NMR: programs for checking the quality of protein structures solved by NMR. J Biomol NMR. 1996;8:477–86. [PubMed]
77. Koradi R, Billeter M, Wuthrich K. MOLMOL: a program for display and analysis of macromolecular structures. J Mol Graph. 1996;14:51–5. 29–32. [PubMed]
78. Niedenthal RK, Riles L, Johnston M, Hegemann JH. Green fluorescent protein as a marker for gene expression and subcellular localization in budding yeast. Yeast. 1996;12:773–86. [PubMed]
79. Sherman F. Getting started with yeast. Methods Enzymol. 1991;194:3–21. [PubMed]
80. Longtine MS, McKenzie A, 3rd, Demarini DJ, Shah NG, Wach A, Brachat A, Philippsen P, Pringle JR. Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae. Yeast. 1998;14:953–61. [PubMed]
81. Chanfreau G, Legrain P, Jacquier A. Yeast RNase III as a key processing enzyme in small nucleolar RNAs metabolism. J Mol Biol. 1998;284:975–88. [PubMed]
82. Poirot O, Suhre K, Abergel C, O’Toole E, Notredame C. 3DCoffee@igs: a web server for combining sequences and structures into a multiple sequence alignment. Nucleic Acids Res. 2004;32:W37–40. [PMC free article] [PubMed]
83. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG. Clustal W and Clustal X version 2.0. Bioinformatics. 2007;23:2947–8. [PubMed]
84. Gouet P, Courcelle E, Stuart DI, Metoz F. ESPript: analysis of multiple sequence alignments in PostScript. Bioinformatics. 1999;15:305–8. [PubMed]