PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Nature. Author manuscript; available in PMC Aug 2, 2011.
Published in final edited form as:
PMCID: PMC3148807
NIHMSID: NIHMS96496
E2F1 represses β-catenin transcription and is antagonized by both pRB and CDK8
Erick J. Morris,1* Jun-Yuan Ji,1* Fajun Yang,1,2 Luisa Di Stefano,1 Anabel Herr,1 Nam-Sung Moon,1 Eun-Jeong Kwon,3 Kevin M. Haigis,1,4 Anders M. Näär,1,2 and Nicholas J. Dyson1
1Massachusetts General Hospital Cancer Center and Harvard Medical School, Laboratory of Molecular Oncology, 13th Street, Building 149, Charlestown, MA, 02129, USA
2Department of Cell Biology, Harvard Medical School, Boston, MA, 02115, USA.
3Massachusetts General Hospital and The Vincent Center for Reproductive Biology, 55 Fruit Street, Their 901, Boston, MA , 02114, USA.
4Massachusetts General Hospital Cancer Center and Harvard Medical School, Laboratory of Molecular Pathology, 13th Street, Building 149, Charlestown, MA, 02129, USA
Correspondence and requests for materials should be addressed to NJD (dyson/at/helix.mgh.harvard.edu)
*These authors contributed equally to this work.
The E2F1 transcription factor can promote proliferation or apoptosis when activated, and is a key downstream target of the retinoblastoma tumor suppressor protein (pRB). Here we show that E2F1 is a potent and specific inhibitor of β-catenin/T-cell factor (TCF)-dependent transcription, and that this function contributes to E2F1-induced apoptosis. E2F1 deregulation suppresses β- catenin activity in an adenomatous polyposis coli (APC)/glycogen synthase kinase-3 (GSK3)-independent manner, reducing the expression of key β-catenin targets including c-MYC. This interaction explains why colorectal tumors, which depend on β-catenin transcription for their abnormal proliferation, keep RB1 intact. Remarkably, E2F1 activity is also repressed by cyclin-dependent kinase-8 (CDK8), a colorectal oncoprotein1. Elevated levels of CDK8 protect β-catenin/TCF-dependent transcription from inhibition by E2F1. Thus, by retaining RB1 and amplifying CDK8, colorectal tumor cells select conditions that collectively suppress E2F1 and enhance the activity of β-catenin.
Keywords: apoptosis, E2F1, β-catenin, CDK8, pRB, retinoblastoma, TCF, Wnt
E2F1 is generally dispensable for cell proliferation but is selectively activated in response to specific cues, such as DNA damage, where it drives the expression of pro-apoptotic genes. Ectopic expression of Drosophila E2F1 (dE2f1) in the developing wing causes apoptosis, giving a visible, dosage-sensitive phenotype that we have used to screen for in vivo regulators of E2F-dependent apoptosis2. Using this strategy, we found a novel interaction between dE2f1 and the Wnt signaling pathway (Fig. 1). An apoptotic, gnarled wing phenotype (Fig. 1b), caused by elevated dE2f1 in newly-eclosed wing epithelial cells, was strongly suppressed by co-expression of the Drosophila β-catenin ortholog armadillo (arm) (Fig. 1d), and partially suppressed by co-expression of pangolin (pan) (Fig. 1e), which encodes dTCF, the transcription factor partner of arm. Moreover, expression of dominant-negative, amino-terminally truncated pan (dTCF ΔN) phenocopied the dE2f1 wing phenotype (Fig. 1f), and ectopic expression of shaggy (sgg; the GSK3 ortholog and negative regulator of Arm protein stability) strongly enhanced the effects of dE2f1 (Fig. 1g, h). Using a stable and activated-mutant form of arm (arm*; S44Y mutation in sgg/GSK3 phosphorylation site3), we tested whether dE2f1 expression could modify an arm-dependent phenotype. Expression of arm* under the GMR eye specific promoter causes a rough eye phenotype (Fig. 1k) that was partially suppressed by co-expression of dE2f1/dDp (Fig. 1l). Together, these genetic interactions shows a strong functional antagonism between elevated dE2F1/dDP and Arm/β-catenin signaling in vivo.
Figure 1
Figure 1
Functional antagonism between E2F1 and β-catenin/TCF-signaling
Wnt/β-catenin signaling is important during development and regulates diverse aspects of cell function including proliferation, differentiation and survival4,5. The genetic interactions suggested that E2F1 might inhibit Arm/β-catenin-dependent transcription. To test this, and to ask whether the interaction was conserved in human cells, we examined the effects of E2F1 on activation of a TCF-luciferase reporter (pTopFLASH) by a stable, tumor-derived form of β-catenin (S33Y6). In human Saos2 cells, a p53- and Rb-deficient cell line that exhibits low basal Wnt activity, expression of E2F1 strongly inhibited S33Y-β-catenin transcription (Fig. 1m). Control experiments showed that the inhibition was not an indirect consequence of E2F1-induced apoptosis or cell cycle progression (Fig. 1 and Supplementary Fig. 2). Inhibition by E2F1 was comparable to the effects of dominant-negative forms of TCF1 or TCF4, enhanced by co-expression of the E2F1-dimerization partner DP1, and abrogated by mutation of DP1- or DNA-binding domains of E2F1 (Supplementary Fig. 2 and Supplementary Fig 3). Remarkably, as little as 10 ng of E2F1 expression plasmid repressed pTopFLASH activity ten-fold when co-transfected with DP1 (Supplementary Fig. 2c). E2F1 activated transcription from a canonical E2F-luciferase reporter (pE2F4B) in these cells (Fig. 1m, n), indicating that it has context-dependent effects. Inhibition of β-catenin was a specific property of E2F1, as other activator E2Fs had little effect (Fig. 1n). Using E2F1/3 chimeras7, we mapped the inhibitory region to the Marked Box and adjacent domains of E2F1 (Supplementary Fig. 3), regions that allow selective interactions with other transcription factors and that determine the differences between the transcriptional signatures of E2F1 and E2F38.
The pro-apoptotic activity of E2F1 has been linked to the TP53 and TP73 tumor suppressors; intriguingly, both of these also affect β-catenin-dependent transcription from the pTopFLASH reporter9,10,11. p53, like E2F1, inhibited pTopFLASH transcription, whereas p73, a p53-related gene that is a transcriptional target of E2F1, activated pTopFLASH (Fig. 1o). In TP53-deficient Saos2 cells, E2F1 repressed β-catenin-mediated pTopFLASH activity and dominantly suppressed the stimulatory effects of p73 (Fig. 1o). Thus, E2F1 is a potent inhibitor of β- catenin/TCF activated transcription that acts independently of p53 and is dominant over p73.
To determine the effects of E2F1 on endogenous β-catenin-regulated genes we first examined c-MYC, one of the best-studied targets of β-catenin and a key mediator of the pro-proliferative effects of deregulated β-catenin during tumorigenesis12. Levels of c-MYC mRNA and protein rapidly decreased following E2F1 induction in Saos2-TR-E2F1 cells (Fig. 2a, c).PPARδ and CD44, two other well-studied Wnt targets showed similar changes (Fig. 2c). As a control, E2F1 strongly activated the well known E2F targets genes, CCNE1 (Cyclin E) and TP73 (Fig. 2b). Similar effects on Wnt target genes were observed when E2F1 was expressed in colorectal cancer cells (Fig. 2f).
Figure 2
Figure 2
E2F1 abrogates Wnt signaling by modulating β-catenin target gene expression and inducing the GSK3-independent degradation of β-catenin
The list of known Wnt targets includes genes that control β-catenin degradation, such as AXIN1 and AXIN2. Interestingly, the expression of AXIN1 and AXIN2, as well as SIAH1, a p53-inducible, GSK3-independent promoter of β-catenin degradation13,14, were all significantly activated by E2F1 (Fig. 2d, e), consistent with previous studies suggesting that AXIN2 and SIAH1 are E2F-target genes15,16. Accordingly, the level of β-catenin protein decreased at later time points following E2F1 expression, a change that preceded apoptosis (Fig. 2g and Supplementary Fig. 4). Similarly, ectopic expression of Drosophila dE2F1/dDP reduced Arm protein levels (Supplementary Fig. 4h).
The mechanism of E2F1-dependent β-catenin downregulation is likely to be distinct from the changes observed during epithelial-mesenchymal transition, or following the disruption of adherens junctions or focal-adhesions, as markers for these processes were unperturbed by E2F1 expression (Supplementary Fig. 4i). Instead, E2F1 induced the post-translational degradation of β-catenin in a GSK3- and caspase-independent fashion (Fig. 2h and Supplementary Fig. 4g). E2F1-mediated degradation of β-catenin is functionally significant since re-expression of stable, tumor-derived mutants of β-catenin, or treatment with GSK3-inhibitors, partially abrogated E2F1-dependent apoptosis (Fig. 2i). Taken together, these results show that E2F1 inhibits β-catenin activity via transcriptional antagonism and β-catenin degradation, and that this inhibition contributes to E2F1-induced apoptosis.
β-catenin-dependent transcription is crucially important for cell proliferation in colorectal cancer cells. Mutations in APC or CTNNB1 (β-catenin) occur early in colorectal tumorigenesis, leading to pre-malignant polyps. Additional mutations contribute to the transition to malignant adenocarcinoma4,5. An unusual feature of colorectal cancer cells is that they rarely (if ever) acquire mutations in the RB1 tumor suppressor gene. Paradoxically, RB1 copy gains are frequently found in colorectal cancer cells, often resulting in protein overexpression17. Conditional inactivation of murine Rb by Villin-Cre leads to aggressive tumors in various tissues, but rarely in the GI tract18,19, and the knockdown of pRB reduces cell proliferation and anchorage-independent growth of human colon cancer cell lines20. Accordingly, we found elevated levels of pRB and β-catenin co-localized within the epithelium of ApcMin colonic tumors in mice (Fig. 3a, b). We hypothesized that colorectal tumor cells might select for mechanisms that limit the activity of E2F1, and that in this context the pRB tumor suppressor might act to sustain high levels of β-catenin/TCF-dependent transcription.
Figure 3
Figure 3
pRB inactivation abrogates β-catenin/TCF-dependent transcription
To test this hypothesis, we utilized a stable line of U2OS osteosarcoma cells containing a doxycycline (Dox)-inducible short-hairpin RNA targeting Rb (U2OS-shRb)21. Depletion of pRB increased transcription from an E2F reporter and inhibited transcription from the pTopFLASH reporter (Fig. 3c, d). In SW480 colorectal cancer cells that contain mutant APC and have deregulated β-catenin22, the expression of E2F1 sufficed to activate the E2F-luciferase reporter and to inactivate basal pTopFLASH transcription (Fig. 3e). Moreover, a shRNA vector that targets pRB inhibited the activity of endogenous β-catenin/TCF (Fig. 3f) and strongly inhibited cell proliferation (Fig. 3g), an effect partially rescued by co-expression of S33Y-β-catenin/TCF, but not Bcl-2 (Fig. 3g). Together, these observations provide a molecular explanation for why colorectal tumor cells maintain the expression of pRB.
Because E2F1 is a potent inhibitor of β-catenin, we reasoned that tumor cells might select for additional ways to limit its activity. We generated transgenic flies that allowed us to knock-down dE2F1 in a tissue-specific manner (dE2f1RNAi; Fig. 4 and Supplementary Fig 5). This approach reduced dE2F1 activity in vivo and generated phenotypes that were used to screen for factors that were rate-limiting for dE2F1-dependent proliferation in vivo (see Methods). We identified dCdk8c01804, a hypomorphic mutant allele of Drosophila Cdk8, as a strong and specific suppressor of dE2f1RNAi phenotypes in both the eye and wing (Fig. 4a–c and Supplementary Fig. 5). CDK8, Cyclin C, MED12 and MED13 form a sub-module of the Mediator complex, a large multi-subunit regulator of transcription23,24. We observed increased expression of dE2F1-regulated genes in dCdk8 or dCycC mutant larvae (Fig. 4d). RNAi-mediated depletion of dCDK8 or dCycC in Drosophila SL2 cells caused similar changes (Supplementary Fig. 6a). In addition, RNAi-mediated depletion of dCDK8, or other components of the CDK8 sub-module, partially suppressed the cell proliferation defects caused by depletion of dE2F1 (Supplementary Fig. 6b–c).
Figure 4
Figure 4
CDK8 antagonizes E2F1 activity
GST-pulldown assays demonstrated a strong physical interaction between dCDK8 and dE2F1 (Fig. 4e) that mapped to the dE2F1 transactivation domain (Supplementary Fig. 7). The physical interaction between E2F1 and CDK8 is conserved between species: human E2F1 co-immunoprecipitated with CDK8 from Saos2 cell extracts (Fig. 4f). Moreover, E2F1 was specifically phosphorylated by CDK8 when complexes were incubated in kinase buffer (Fig. 4g). Thus, CDK8 physically interacts with E2F1 and is a conserved negative regulator of E2F1-dependent transcription.
The interaction between CDK8 and E2F1 is particularly notable, as a concurrent study has found significant CDK8 copy number gains in colorectal cancers; approximately 40% of tumors have copy number gains in both CDK8 and RB11. Chromatin immunoprecipitation (ChIP) experiments on SW480 colorectal cancer cells confirmed that CDK8 and E2F1 are both present at E2F-regulated promoters as well as the c-MYC promoter (Supplementary Fig. 8), suggesting an interplay between E2F1, CDK8, and β-catenin/TCF. In Saos2 cells, which contain low basal Wnt activity, expression of CDK8 enhanced β-catenin activation from the pTopFLASH reporter, while expression of kinase-dead CDK8 (CDK8KD) had no effect (Fig. 4h). Moreover, expression of CDK8, but not CDK8KD, suppressed the inhibitory effect of E2F1 on the pTopFLASH reporter (Fig. 4h). Similar results were observed for CDK8 expression in HCT116 colorectal cancer cells (Supplementary Figure 8). Hence, CDK8 and E2F1 have antagonistic effects on β-catenin-mediated transcription, and increasing the levels of CDK8 protects β-catenin from inhibition by E2F1. In agreement with this, the expression of CDK8KD reduced pTopFLASH activity in APC-deficient SW480 colorectal cancer cells, and enhanced the inhibition caused by short-hairpin targeting of pRB (Figure 4i).
Cancer cells acquire multiple mutations during tumorigenesis and it is a major challenge to explain how each change contributes to malignancy. However, the absence of mutations can also give new insights. It has long been known that colorectal tumor cells fail to mutate RB1 and typically express elevated levels of this tumor suppressor. The discovery that E2F1 is a potent inhibitor of β-catenin-dependent transcription provides an unexpected and simple explanation to this conundrum. This interaction may also explain why colorectal tumors frequently overexpress c-myc-induced micro-RNAs that target E2F125,26. The discovery by Firestein and colleagues1 showing significant RB1 and CDK8 copy number gains in colorectal cancers is especially intriguing given the evidence that CDK8 is an important modulator of both β-catenin and E2F1. Whereas CDK8 enhances the activity of β-catenin, it represses the activity of E2F1. Consequently, the amplification of CDK8 may act as a switch, allowing increased β-catenin-dependent transcription that is also resistant to E2F1 inhibition (see model in Supplementary Fig. 1). Reversing this process, such as the inhibition of CDK8 combined with the activation of E2F1, may be useful as a two-pronged strategy to target cancer cells that are driven by deregulated β-catenin activity.
Unless otherwise noted, all fly crosses were conducted at 25°C and phenotypes are depicted in female progeny. Transgenic dE2f1-dsRNA (dE2f1RNAi) flies were created using a system developed previously27. SW480 (Antony Burgess), DLD1 (William Hahn), U2OS-shRb (Scott Lowe), and Saos2-TR-E2F1 cells2 were cultured in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum. Drosophila Schneider line 2 (SL2) cells were maintained as previously described2. Transient transfections were performed using Fugene-6 reagent (Roche), and in some cases with CellFectin (Invitrogen), according to the manufacturers instructions. For SW480 survival and DLD1 qPCR experiments, high efficiency (approximately 70%) gene transfer was accomplished by using Amaxa nucleofection according to the manufacturer’s protocol (Program T-020; Kit-T and Kit-L, respectively). All Drosophila RNAi in SL2 cells was performed as described2, using 50 µg double-stranded RNA (dsRNA) synthesized with T7 RiboMax (Promega) with all conditions normalized using luciferase-dsRNA. Luciferase reporter assays were performed as previously described for SL2 cells2 and mammalian cells28. MTT viability assay was performed as previously described2. Western blot and immunohistochemical analysis was performed using standard techniques. Dissected third instar larval discs immunohistochemistry was performed using anti-dE2F1 antibody (Terry Orr-Weaver). Immunohistochemical staining of ApcMin mouse tumors was performed as described19 using anti-Rb (Santa Cruz, sc-50) and β-catenin antibodies (BD Biosciences, 610054). ChIP and data analysis were carried out as previously described29. Gel shift assays were performed as described30. Detailed information on antibodies, fly stocks, and plasmids, as well as qPCR, GST-pulldown assay, co-immunoprecipitation, and IP-kinase assay conditions are all described in Supplementary Methods.
Fly stocks, transgenes, and genetic crosses
The following stocks were used for these studies: GMR-Gal4, ptc-Gal4, UAS-arm (S2; 4783); UAS-dTCF/pan (4837); UAS-dTCF ΔN/pan (4784); UAS-GSK3/sgg (5361) (Bloomington Stock Center); GMR-arm* (Y55;Mariann Bienz); dCdk8K185 (null) and dCycCY5 (null) (Henri-Marc Bourbon); GMR-wIR (Richard Carthew); and PCNA-GFP (Bob Duronio). The dE2f1RNAi primer sequence (sub-cloned inverted into the pWIZ vector) was 5’-TTATTTCAAACGCCCTACCG-3’ and 5’-GAATTGCATCTGCAGTGAGC-3’ (verified by sequencing). All transgenic fly embryo injections were performed by the CBRC Transgenic Fly Core. Approximately thirty different transgenic lines carrying one or multiple transgenes were balanced and recombined with different Gal4 lines using standard Drosophila genetic methods. Since the dE2f1RNAi phenotypes in both the Drosophila eye (GMR-Gal4,UASdE2f1RNAi #10) and wing (ptc-Gal4,UAS-dE2f1RNAi #3) could be modified by known factors that interact with the RB-E2F pathway (JYJ and NJD, unpublished observation), we designed and carried out a dominant modifier genetic screen. We screened ~6500 piggyBac transposon insertion lines of the Exelixis mutant collection (JYJ, AH and NJD, unpublished results) that was maintained at the Harvard Drosophila Collection (Spyros Artavanis-Tsakonas). A detailed description of the genetic screen will be presented elsewhere.
Cell Culture and Gene Transfer
Plasmids used include pCMV-E2F1, pCMV-DP1, pCMV-E2F2, pCMV-E2F3, pCMV-E2F4, pCMV-E2F1 ΔX, pCMV-E2F1-121, pCMV-E2F1-143, pCMV-E2F1- 144, pGST-E2F1, pGST-E2F4, pGST-DP1 (Kristian Helin); pSFFV-p53 (Stanley Korsmeyer); pCMV-neoBam, pCMV-β-gal4, pCMV-pRB, pE2F4B (Fred Dick); pCMV-DNDP1(Δ103–126) (Marie Classon); 8xSuperTop, 8xSuperFop, pCMV-CDK8, pCMV-CDK8KD, pLKO-shCDK8- 1, pLKO-shGFP (William Hahn); pCMV-E2F1/3 chimeras (Joe Nevins); pcDNA3- DNTCF1, pcDNA3-DNTCF4 (Hans Clevers); pEVR-TCF1E (Marian Waterman); pGL3OT, pGL3OF (Elizabeth Hay); pEGFP-N1 (BD Biosciences); pLPC-empty, pLPC-TAp73, pClneo-Δ45-β-catenin, pClneo-S33Y-β-catenin, pClneo-β-catenin, LLP-shGFP, and LLP-shRbCD (targeting sequence GGTTGTGTCGAAATTGGATCA) (James Rocco). Inhibitors and chemical reagents include LiCl GSK3 inhibitor (Fisher, 121–500), SB216763 GSK3β inhibitor (Sigma, S3442), BOC-Aspartyl-FMK caspase inhibitor (Enzyme Systems Products, FK-011), MG101 (Sigma, A6185), and MG132 (Sigma, C2211).
Luciferase Reporter and EGFP viability assays
For pTopFLASH assays, Saos2 cells were transfected in 6-wells with 100–200 ng pTopFLASH reporter plus 100 ng S33Y-β-catenin expression construct, along with 100 ng pCMV-β-gal as normalization control following β-gal assay and, unless otherwise specified, luciferase assays were performed 48 hours after transfection (data is expressed at mean ± SD, N = 3). The S33Y-β-catenin construct was omitted for pTopFLASH assays in colorectal cancer cells. For EGFP co-transfection viability assay, 100 ng of pEGFP-N1 was co-transfected along with the indicated plasmids. Whole cell lysates were prepared with GFP homogenizing buffer and assayed fluorometrically 48 hours after transfection (excitation/emission λ 488/511 nm). Tet-induced survival experiments were done under low serum (0.5%) conditions.
Western Analysis, Antibodies, and Immunohistochemistry
Other antibodies used include dE2F1 (polyclonal anti-rabbit, Carol Seum), E2F1 (Santa Cruz, sc-193), E2F4 (Santa Cruz, sc-1082), DP1 (Santa Cruz, sc-610), CRSP70 (Santa Cruz, sc-9426), c-myc (Santa Cruz, sc-40), TCF1 (Santa Cruz, sc-8589), TCF4 (Santa Cruz, sc-8632; Upstate, 05–511 for ChIP), Cyclin E (Santa Cruz, sc-247), Cyclin A (Santa Cruz, sc-596), pan-MAPK (BD Biosciences, 612641), β-catenin (Cell Signaling, 9562), CDK8 (Santa Cruz, sc-1521), pRB (Santa Cruz, sc-50), Arm (N27A1; Developmental Studies Hybridoma Bank), β1-integrin (BD Biosciences, 610467), E-cadherin (BD Biosciences, 610181), N-cadherin (BD Biosciences, 610920), α-catenin (BD Biosciences 610193), FAK (BD Biosciences 610087), phospho-FAK Tyr397 (BD Biosciences, 611806), GSK3 (Cell Signaling, 9315), phospho-GSK3 (Upstate, 05–413), Src (Cell Signaling, 2108), phospho-Src Tyr416 (Cell Signaling, 2101), STAT3 (Cell Signaling, 9132), phospho-STAT3 Tyr705 (Cell Signaling, 9131), phospho-STAT3 Ser727 (Cell Signaling, 9134), STAT5 (Cell Signaling, 9310), phospho-STAT5 Tyr694 (Cell Signaling, 9356), SHC (BD Biosciences, 610081), anti-HA-epitope (Sigma, H6908), and GFP (Sigma, G1544).
Real-time quantitative PCR (qPCR)
Total RNA was prepared using RNeasy extraction Kit (Qiagen). Reverse transcription PCR (RT-PCR) was performed using Taq Man® Reverse Transcription (PE Applied Biosystems) according to manufacture specification. Real-time PCR was performed using an ABI prism 7900 HD Sequence Detection system. Relative mRNA level were determined using the SYBR Green I detection chemistry system (Applied Biosystems, Foster City, CA). Quantification was performed using the comparative CT method as described in the manufacturer manual and GAPDH or 18S rRNA was used as normalization control.All primers were designed with Primer Express 1.0 software (Applied Biosystems, Foster City, CA) following the manufacturer’s suggested conditions.
Forward and reverse primer sequences include:
  • E2F1-f (CATCCCTCACCACAGATCCC), E2F1-r (AACAGCGGTTCTTGCTCCAG)
  • c-MYC-f (CGGATTCTCTGCTCTCCTCG), c-MYC-r (CCACAGAAACAACATCGATTTCTT)
  • AXIN1-f (ACAGCATCGTTGTGGCGTACT), AXIN1-r (CACAGTCAAACTCGTCGCTCAC)
  • AXIN2-f (ATTCGGCCACTGTTCAGACG), AXIN2-r (GACAACCAACTCACTGGCCTG)
  • SIAH1-f (ATGGTCATAGGCGACGATTGAC), SIAH1-r (AAGCTGTGCAATGCTGGTGTC)
  • CD44-f (CTGCAAGGCTTTCAATAGCACC), CD44-r (CGTGCCCTTCTATGAACCCAT)
  • PPARδ-f (CTTCCACTACGGTGTTCATGCA), PPARδ-r (GCACTTGTTGCGGTTCTTCTTC)
  • CCNE1-f (TGCAGAGCTGTTGGATCTCTGTG), CCNE1-r (GGCCGAAGCAGCAAGTATACC)
  • CDC25-f (TGAATACGAGGGAGGCCACATCAA), CDC25-r (ACACGCTTGCCATCAGTAGGTACA)
  • TP73-f (CGTACTCCCCGCTCTTGAAG), TP73-r (TCCGCTTTCTTGTAAACAGGC)
  • GAPDH-f (CATGTTCGTCATGGGTGTGAACCA), GAPDH-r (GTGATGGCATGGACTGTGGTCAT)
Chromatin Immunoprecipitation
Chromatin extracts were incubated at 4°C overnight with antibodies specific for E2F1, CDK8, and anti-HA antibody as control. Immunocomplexes were recovered with protein A and G Sepharose beads. DNA was recovered and dissolved in 150 µL of water. Real-time qPCR analysis was performed as described above.
Forward and reverse primer sequences include:
  • P107-f (GGCCAAGGACAGGTCTTTCAG), P107-r (AAAGACGCCCAGAGATGCAGC)
  • CCNA1-f (CTGCTCAGTTTCCTTTGGTTTAC), CCNA1-r (AAAGACGCCCAGAGATGCAGC)
  • ACYLCOA-f (CCTTCATTGGGATCACCACG), ACYLCOA-r (GGAGATGAGTACCAGCAGGTTG)
  • MYC-EBE-f (TCCGCCTGCGATGATTTATAC), MYC-EBE-r (CAGAGTAAGAGAGCCGCATGAA)
  • MYC-TBE1-f (TCTCCCGTCTAGCACCTTTGA), MYC-TBE1-r (CACGGAGTTCCCAATTTCTCAG)
  • MYC-TBE2-f (GCTCTCCAAGTATACGTGGCAA), MYC-TBE2-r (TCAGAGCGTGGGATGTTAGTGTA)
GST-pulldown Assay
GST-fusion proteins were expressed in E. coli BL21 cells and purified from the lysates by glutathione sepharose beads (Pharmacia) with extensive washing. The amount bead-bound GST protein was determined by SDS-PAGE and Coomassie staining and normalized. The dE2F1 fragments, shown in Supplementary Fig. 7, were subcloned into pGEX-2TKN vector. To make Myc-tagged dE2F1 and HA-tagged dCDK8, full-length cDNAs were subcloned into pcDNA4TO or pcDNA3HA, respectively. Each construct was expressed in 293T cells and extracted in binding buffer (20 mM HEPES pH 7.6, 140 mM NaCl, 0.1 mM EDTA, 10% glycerol, 1 mM dithiothreitol (DTT), 1 mM Benzamidine, 0.2 mM phenylmethylsulfonyl fluoride (PMSF), and 1 µg/mL Aprotinin) with 0.5% NP-40. The whole cell extracts (WCE) were diluted 4-fold with binding buffer without detergent. S2 cell extracts were prepared similarly. WCE was applied to 50 µL of GST-fusion protein beads and incubated at 4°C for 3 hours. Beads were washed seven times with 1 mL wash buffer containing 50 mM Tris-HCl at pH 8.0, 250 mM KCl, 0.1 mM EDTA, 10% glycerol, 0.1% NP-40, 1 mM DTT, 1 mM Benzamidine, 0.2 mM PMSF, and 1 µg/mL Aprotinin. The interacting proteins were then eluted with two bead volumes of binding buffer plus 0.3% sarkosyl at 4°C for 1 hour.
Co-immunoprecipitation
Saos2-TR-E2F1 cells were collected and rinsed with 1×PBS after culture in the presence of 0.2 µg/mL of tetracycline for 12 hours. Cell pellets were re-suspended in IP buffer (50 mM Tris-HCl pH 8.0, 150 mM NaCl, 0.1 mM EDTA, 10% Glycerol, 0.1% NP-40, 1 mM DTT, 0.2 mM PMSF, 1 mM Benzamidine, and 1 µg/mL Aprotinin). WCE was prepared by passing through 20(1/2)G needle for five times followed by incubation on ice for 15 minutes and centrifugation at 12,000 × g for 20 minutes. For immunoprecipitation, whole cell extracts were incubated with 30 µL of Protein-G beads pre-coated with antibodies against CDK8 (sc-1521), E2F1 (sc-193), control normal rabbit serum (IgG), or CRSP70 (goat anti-human CRSP70, Santa Cruz sc-9426). After rotating at 4°C for 2 hours, the beads were washed five times with 1 mL IP buffer. The antigen-associated proteins were eluted with 0.3% sarkosyl in IP buffer, resolved on 10% SDS-PAGE, and visualized using standard western analysis.
IP-kinase assay
CDK8 or control (CRSP70) proteins were immunoprecipitated from whole cell extracts of Saos2-TR-E2F1 cells as described in the Co-IP section. The beads were washed twice with 1 mL IP buffer followed by two washes with 1 mL kinase assay buffer (50 mM Tris-HCl pH 7.4, 50 mM NaCl, 10 mM MgCl2, 1 mM MnCl2, 10% Glycerol, 0.2 mM PMSF, 5 mM DTT, and 1 µg/ml Aprotinin). For kinase assays, the resulting beads were incubated in 50 µL of kinase assay buffer containing 20 µCi of 32P-γ-ATP at room temperature for 30 minutes. The reaction was terminated and the kinase-associated proteins were eluted with 0.3% sarkosyl in IP buffer. After diluted ten times with IP buffer, equal amount of the supernatant was applied to Protein-A beads pre-coated with antibodies against IgG (normal rabbit serum), E2F1 (sc-193), E2F4 (sc-1082), or DP1 (sc-610). The mixture was rocked at 4°C for 2 hours and the beads were washed four times with 1 mL with IP buffer. The samples were boiled, resolved in 12% SDS-PAGE, and then transferred to a PVDF membrane. The in-vitro-phosphorylated proteins were visualized by autoradiography.
Electrophoretic Mobility Gel Shift Assay
Briefly, 2 µg of nuclear extracts were incubated with 32P-labeled double-stranded oligonucleotides containing E2F or TCF sites site (<10 pg) for 30 minutes at 4°C in binding buffer. For supershift experiment, antibodies were preincubated for 30 minutes. Samples were then loaded on a 4% polyacrylamide gel and visualized by autoradiography.
Double-strand oligonucleotide probe sequences include:
  • MYC-wtE2F (5’-GCTTCTCAGAGGCTTGGCGGGAAAAAGAA)
  • MYC-mtE2F (5’-GCTTCTCAGAGGCTTGTAGGGAAAAAGAA)
  • MYC-TBE1 (5’-GTCTAGCACCTTTGATTTCTCCCAAACCC)
  • MYC-TBE2 (5’-CTGGGACTCTTGATCAAAGCGCGGCCCTT)
  • TOP (5’-GCCCCCTTTGATCTTACCCCCTTTGATCT)
  • Canonical wtE2F (5’-ATTTAAGTTTCGCGCCCTTTCTCAAATTT)
  • Canonical mtE2F (5’-ATTTAAGTTTCGATCCCTTTCTCAAATTT)
Supplementary Material
01
Acknowledgements
We thank many investigators for their generous gifts of cell lines, plasmids, and fly stocks (see Methods and Methods Summary), especially Spyros Artavanis-Tsakonas. We thank Doug Rennie and the CBRC Transgenic Fly Core for embryo injections and Bill Fowle for his help with SEM imaging. We thank Andi McClatchey, Jeff Settleman, Carol Seum, and Terry Orr-Weaver for their generous gifts of antibodies. We thank our colleagues at the MGH Cancer Center for helpful discussions. EJM and JYJ are supported in part by a Ruth L. Kirschstein Award and Tosteson Postdoctoral Fellowship, respectively. LDS is supported by the MGH ECOR Fund for Medical Discovery. NSM is a Leukemia and Lymphoma Society Special Fellow. KMH was supported by a Career Development award from the Harvard GI SPORE (P50-CA127003). This study was supported by grants from the NIH to NJD (GM81607, GM053203) and AMN (GM071449).
Footnotes
Author Information. Reprints and permissions information is available at npg.nature.com/reprintsandpermissions.
1. Firestein R, Bass AJ, Kim SY, Dunn IF, Silver SJ, Guney I, Freed E, Ligon AH, Vena N, Ogino S, Chheda M, Tamayo P, Finn S, Shrestha Y, Boehm JS, Jain S, Bojarski E, Barretina J, Chan JA, Baselga J, Tabernero J, Root DE, Fuchs C, Loda M, Shivdasani RA, Meyerson M, Hahn WC. CDK8 is a colorectal cancer oncogene that regulates beta-catenin activity. 2008 [PMC free article] [PubMed]
2. Morris EJ, et al. Functional identification of Api5 as a suppressor of E2F-dependent apoptosis in vivo. PLoS Genet. 2006;2:e196. [PubMed]
3. Freeman M, Bienz M. EGF receptor/Rolled MAP kinase signalling protects cells against activated Armadillo in the Drosophila eye. EMBO Rep. 2001;2:157–162. [PubMed]
4. Clevers H. Wnt/beta-catenin signaling in development and disease. Cell. 2006;127:469–480. [PubMed]
5. Kinzler KW, Vogelstein B. Lessons from hereditary colorectal cancer. Cell. 1996;87:159–170. [PubMed]
6. Morin PJ. Activation of beta-catenin-Tcf signaling in colon cancer by mutations in beta-catenin or APC. Science. 1997;275:1787–1790. [PubMed]
7. Hallstrom TC, Nevins JR. Specificity in the activation and control of transcription factor E2F-dependent apoptosis. Proc Natl Acad Sci U S A. 2003;100:10848–10853. [PubMed]
8. Black EP, Hallstrom T, Dressman HK, West M, Nevins JR. Distinctions in the specificity of E2F function revealed by gene expression signatures. Proc Natl Acad Sci U S A. 2005;102:15948–15953. [PubMed]
9. Sadot E, Geiger B, Oren M, Ben-Ze'ev A. Down-regulation of beta-catenin by activated p53. Mol Cell Biol. 2001;21:6768–6781. [PMC free article] [PubMed]
10. Rother K, et al. Identification of Tcf-4 as a transcriptional target of p53 signalling. Oncogene. 2004;23:3376–3384. [PubMed]
11. Ueda Y, et al. p73beta, a variant of p73, enhances Wnt/beta-catenin signaling in Saos-2 cells. Biochem Biophys Res Commun. 2001;283:327–333. [PubMed]
12. Sansom OJ, et al. Myc deletion rescues Apc deficiency in the small intestine. Nature. 2007;446:676–679. [PubMed]
13. Liu J, et al. Siah-1 mediates a novel beta-catenin degradation pathway linking p53 to the adenomatous polyposis coli protein. Mol Cell. 2001;7:927–936. [PubMed]
14. Matsuzawa SI, Reed JC. Siah-1, SIP, and Ebi collaborate in a novel pathway for beta-catenin degradation linked to p53 responses. Mol Cell. 2001;7:915–926. [PubMed]
15. Hughes TA, Brady HJ. E2F1 up-regulates the expression of the tumour suppressor axin2 both by activation of transcription and by mRNA stabilisation. Biochem Biophys Res Commun. 2005;329:1267–1274. [PubMed]
16. Hallstrom TC, Mori S, Nevins JR. An E2F1-dependent gene expression program that determines the balance between proliferation and cell death. Cancer Cell. 2008;13:11–22. [PMC free article] [PubMed]
17. Gope R, et al. Increased expression of the retinoblastoma gene in human colorectal carcinomas relative to normal colonic mucosa. J Natl Cancer Inst. 1990;82:310–314. [PubMed]
18. Kucherlapati MH, Nguyen AA, Bronson RT, Kucherlapati RS. Inactivation of conditional Rb by Villin-Cre leads to aggressive tumors outside the gastrointestinal tract. Cancer Res. 2006;66:3576–3583. [PubMed]
19. Haigis K, Sage J, Glickman J, Shafer S, Jacks T. The related retinoblastoma (pRb) and p130 proteins cooperate to regulate homeostasis in the intestinal epithelium. J Biol Chem. 2006;281:638–647. [PubMed]
20. Williams JP, et al. The retinoblastoma protein is required for Ras-induced oncogenic transformation. Mol Cell Biol. 2006;26:1170–1182. [PMC free article] [PubMed]
21. Dickins RA, et al. Probing tumor phenotypes using stable and regulated synthetic microRNA precursors. Nat Genet. 2005;37:1289–1295. [PubMed]
22. Faux MC, et al. Restoration of full-length adenomatous polyposis coli (APC) protein in a colon cancer cell line enhances cell adhesion. J Cell Sci. 2004;117:427–439. [PubMed]
23. Kim S, Xu X, Hecht A, Boyer TG. Mediator is a transducer of Wnt/betacatenin signaling. J Biol Chem. 2006;281:14066–14075. [PubMed]
24. Malik S, Roeder RG. Dynamic regulation of pol II transcription by the mammalian Mediator complex. Trends Biochem Sci. 2005;30:256–263. [PubMed]
25. He L, et al. A microRNA polycistron as a potential human oncogene. Nature. 2005;435:828–833. [PubMed]
26. O'Donnell KA, Wentzel EA, Zeller KI, Dang CV, Mendell JT. c-Myc-regulated microRNAs modulate E2F1 expression. Nature. 2005;435:839–843. [PubMed]
27. Lee YS, Carthew RW. Making a better RNAi vector for Drosophila: use of intron spacers. Methods. 2003;30:322–329. [PubMed]
28. Dick FA, Sailhamer E, Dyson NJ. Mutagenesis of the pRB pocket reveals that cell cycle arrest functions are separable from binding to viral oncoproteins. Mol Cell Biol. 2000;20:3715–3727. [PMC free article] [PubMed]
29. Di Stefano L, Jensen MR, Helin K. E2F7, a novel E2F featuring DP-independent repression of a subset of E2F-regulated genes. Embo J. 2003;22:6289–6298. [PubMed]
30. Hurford RK, Jr, Cobrinik D, Lee MH, Dyson N. pRB and p107/p130 are required for the regulated expression of different sets of E2F responsive genes. Genes Dev. 1997;11:1447–1463. [PubMed]