PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Exp Cell Res. Author manuscript; available in PMC 2012 July 15.
Published in final edited form as:
PMCID: PMC3118859
NIHMSID: NIHMS290295

Short form of α9 promotes α9β1 integrin-dependent cell adhesion by modulating the function of the full-length α9 subunit

Abstract

The α9β1 integrin is a multifunctional receptor that interacts with a variety of ligands including vascular cell adhesion molecule 1, tenascin-C and osteopontin. A 2.3-kb truncated form of α9 integrin subunit cDNA was identified by searching the Medline database. This splice variant, which we called the short form of α9 integrin (SFα9), encodes a 632-aa isoform lacking transmembrane and cytoplasmic domains, and its authentic expression was verified by PCR and western blotting. SFα9 is expressed on the cell surface, but cannot bind ligand in the absence of the full-length α9 subunit. Over-expression of SFα9 in cells expressing full-length α9 promotes α9-dependent cell adhesion. This promoting effect of SFα9 requires the authentic cytoplasmic domain of the co-expressed full-length α9 subunit. Thus, SFα9 is a novel functional modulator of α9β1 integrin by inside-out signaling.

Keywords: SFα9, α9β1 integrin, cell adhesion

Introduction

Integrins are a family of heterodimeric type I transmembrane proteins composed of an α subunit and a β subunit, which are non-covalently bound [1]. At the present time, 18 different α subunits and 8 different β subunits are known, which give rise to 24 distinct αβ heterodimer [2]. They are involved in a wide range of cellular processes including cell adhesion, migration, differentiation, proliferation, apoptosis, and cancer metastasis by recognizing diverse ligands in the extracellular matrix or on the cell surface. Ligand binding is mediated by the N-terminal portions of each integrin subunit, containing seven FG-GAP repeats termed a β-propeller domain [2, 3]. The avidity modulation of integrins occurs in two directions, signaling from the extracellular microenvironment into the cell known as "outside-in signaling", and from intracellular to extracellular domains of integrins known as "inside-out signaling" [2, 4, 5].

The α9β1 integrin is widely expressed and binds to a variety of ligands, including tenascin-C, osteopontin, VCAM-1, VEGF-A, -C,-D, and several members of the ADAM family [610]. At least two proteins that directly interact with the α9 integrin subunit cytoplasmic domain have been reported to modulate α9β1 -mediated cell migration and cell spreading. SSAT (spermidine/spermin N1-acetyltransferase) binds to the integrin α9 cytoplasmic domain and modulates inward rectification of the Kir4.2 (inward-rectifier K+) channel to enhance α9 integrin-dependent cell migration [11, 12]. Paxillin binding to the integrin α9 cytoplasmic domain mediates inhibition of cell spreading by α9β1 [13, 14]. However no molecule has yet been identified as a specific modifier of integrin α9-dependent adhesion.

We found a sequence predicted to encode an alternative splice variant of the α9 integrin subunit on the NCBI Database. This cDNA encodes a truncated 632-aa protein, which has β-propeller domain, thigh domain, and a novel 19-aa sequence at its C-terminus. We named this isoform the short form of α9 (SFα9) and found that the predicted protein is endogenously made and expressed on the cell surface. Although expression by itself does not mediate cell adhesion to known α9β1 ligands, SFα9 enhances adhesion mediated by full-length α9 integrin, an effect that depends on the presence of sequences in the cytoplasmic domain of the full-length α9 integrin.

Materials and Methods

Cell culture and reagents

CHO cells, MEF cells, SW480 cells, human Phoenix-E ([var phi]E) cells (from Gary Nolan, Stanford University, Stanford, CA) [15], A549 cells (derived from human lung adenocarcinoma), LN-229 cells (derived from human glioblastoma), G361 cells (derived from human melanoma), RD cells (derived from a human rhabdomyosarcoma), MDA-MB-435s cells (derived from human melanoma cells, although originally described as of breast cancer origin) (American Type Culture Collection) were cultured in DMEM containing 10% FBS (HyClone). Anti-α9 integrin antibodies Y9A2 [16], A9A1[7], or B9A1 for flow cytometry or immunoprecipitation were generated and characterized in our laboratory. Anti-α9 integrin monoclonal antibody NC7 for western blotting was generated by immunizing mice with a peptide derived from the C-terminal domain of mouse α9, EAEKNRKENEDGWDWVQKNQ. Anti-FLAG antibody M2, and anti-Myc antibody 9E10, were obtained from Sigma-Aldrich and Roche Applied Science, respectively. Anti-β1 integrin antibody (AB1952) was obtained from Chemicon. Anti-mouse osteopontin antibody (O–17) and anti-β-actin antibody (ab8226) used as loading controls were obtained from IBL and Abcam, respectively. The mutant form of the third fibronectin type III repeat in tenascin-C (TNfn3RAA) has been described [17, 18]. Human plasma fibronectin was obtained from Sigma-Aldrich.

SFα9 cDNA cloning

The cDNAs for the alternative splicing variant of α9 integrin (SFα9), FLAG-tagged SFα9 and Myc-tagged SFα9 cDNA were PCR amplified from G361 human melanoma cells using the following primers; 5'-CGGTACACCTACCTGGGCTA-3' (sense) and 5'-AGGAGTCGACAAAGGGAGACCCAGAGAGGA-3' (antisense for SFα9), 5'-CCGTCGTCGACCTATTTATCGTCATCATCTTTGTAGTCTTTCTGCTCTGTGCAGC TGCC-3' (antisense for FLAG-tagged SFα9), and 5'-CCGTCGTCGACTTACAGGTCTTCCTCAGAGATGAGTTTCTGCTCTGTGCAGCT GCC-3' (antisense for Myc-tagged SFα9). PCR products were digested with BglII and SalI, then inserted into BglII and SalI-digested α9 integrin expressing vector, α9-pBabepuro. A fragment digested with BglII and SalI from Myc-tagged SFα9-pBabepuro was inserted into BglII and SalI-digested α9 integrin expressing vector, α9-pWZLblast.

Generation of stable cell lines

MEF cells expressing α9 integrin subunit or SFα9 were generated as follows. α9-pBabepuro, or SFα9-pBabepuro were transfected into [var phi]E packaging cells by Lipofectamine2000 (Invitrogen). 3 days after transfection, virus-containing supernatants were harvested and filtered through a 0.45-µm filter and then added to 50% confluent MEF cells in the presence of 8 µg/ml polybrene and cultured for 18–20 h. The virus-containing medium was removed and the cells were cultured in 10% FCS DMEM supplemented with 10 µg/ml puromycin (Sigma-Aldrich). For generation of MEF cells co-expressing α9 integrin subunit and SFα9, retroviruses were generated by transfecting α9-pWZLblast, then added to SFα9/MEF, SFα9-Myc/MEF, or SFα9-FLAG/MEF cells. MEF cells transduced by this virus were cultured in 10% FCS DMEM supplemented with 10 µg/ml puromycin and 10 µg/ml Blasticidin (Invitrogen). MEF cells expressing the α9 integrin subunit and/or SFα9 were identified by flow cytometry with the anti-α9 antibody Y9A2, and western blotting with anti-α9 antibody (NC7 or AF3827 from R&D Systems), anti-Myc antibody and anti-FLAG antibody. α9-, α9α5, α9α4 integrin-expressing CHO cells, and α9-expressing SW480 cells were previously generated in our lab [13] [17]. FLAG-tagged SFα9 was transfected into CHO cells or α9-expressing SW480 cells. Stable clones were obtained by limiting dilution and screened with flow cytometry and western blotting.

Cell adhesion assay

The 96-well plates were coated with a mutant fragment of tenascin-C (TNfn3RAA) or plasma fibronectin overnight at 4°C, followed by blocking with 0.5% BSA in PBS for 1 hr at room temperature. Cells were suspended in DMEM containing 0.25% BSA and 200 µl of cell suspension (at a cell density of 5 × 104 cells/well) was applied to 96-well plates and incubated for 1 hr at 37°C. The medium was removed and all wells were washed twice. Adherent cells were fixed and stained by 0.5% crystal violet in 20% methanol for 30 min. Wells were rinsed three times with water, and adherent cells were then lysed with 20% acetic acid. The resulting supernatants from each well were analyzed by an immunoreader (Bio-Rad Laboratories), and the absorbance at 595 nm was measured to determine the relative number of adherent cells.

Immunoprecipitation and western blot analysis

CHO cells, SW480 cells co-expressing α9 integrin and SFα9 or various tumor cell lines were lysed on ice for 30 min in lysis buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1% Triton X-100 and 1× protease inhibitors (1× Complete mini protease inhibitor cocktail, Roche Molecular Biochemicals)). Lysates were clarified by centrifugation at 16,000 g for 10 min at 4°C, and were then incubated with protein G-Sepharose coated with anti-α9 antibody NC7, anti-FLAG antibody (for CHO cells), or anti-α9 antibody Y9A2, A9A1, or B9A1 (for SW480 or various tumor cell lines) at 4°C 1hr. The beads were washed with the same buffer five times, and precipitated polypeptides were extracted in Laemmli sample buffer, separated by SDS-PAGE under reducing conditions, probed with NC7, anti-FLAG antibody or anti-integrin β1 antibody (for CHO cells) or anti-α9 integrin (R&D) antibody (for SW480 or tumor cell lines), and detected by Plus-ECL (PerkinElmer).

Cell surface protein biotinylation

Labeling of surface proteins was performed using the lysine-directed, membrane-impermeant biotinylating reagent sulfo-NHS-SS-biotin (Thermo Scientific). Cells were washed twice with PBS at 4°C and incubated with 1.2 mg/ml sulfo-NHS-SS-biotin in PBS for 30 min at 4°C. After the sulfo-NHS-SS-biotin incubation, quenching solution was added to quench the reaction. The quenching buffer was removed, a lysis buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1% Triton X-100 and 1× protease inhibitors) was applied, and the mixture was rotated for 30 min at 4°C. Supernatants were cleared of insoluble material by pelleting at 15,000 rpm for 10 min at 4°C. ImmunoPure-immobilized streptavidin beads (Thermo Scientific) was added to supernatant, and gently mixed for 1 h at room temperature. Streptavidin beads were then washed four times with lysis buffer and the biotinylated proteins were eluted from the beads with lysis buffer containing 50 mM DTT. Eluted samples were used for western blotting.

Flow cytometry

For GFP expression, cells were trypsinized, washed, resuspended in 100 µl of PBS, and analyzed with a FACScan flow cytometer (Becton Dickinson). For α9 integrin or SFα9 expression, cells were blocked by normal goat serum, then sequentially incubated with Y9A2 and phycoerythrin-labeled goat anti-mouse antibody before analysis.

SFα9 small hairpin RNA (shRNA) cloning, lentivirus generation, and transduction

The lentiviral vectors pSicoR, as well as the methods of shRNA cloning and lentiviral generation, were used as described [19]. Two shRNAs were designed against SFα9 using pSicoOligomaker software from Tyler Jacks (Massachusetts Institute of Technology, Cambridge, MA). The target sequences of two shRNA are as follows; shRNA1 target sequence: GAACCTTAAAGCTCATACT, shRNA2 target sequence: GCTGCACAGAGCAGAAATA, Oligonucleotides were ligated into the HpaI/XhoI-digested pSicoR plasmid and used to generate lentivirus as described [19].

Analysis of mRNA expression

Total RNA from various tumor cell lines was extracted by RNeasy (Qiagen). The following primers were used for RT-PCR and real-time PCR; 5'-ACCACAGTCCATGCCATCAC-3' (sense for G3PDH) and 5'-TCCACCACCCTGTTGCTGTA-3' (antisense for G3PDH), 5'-GGGTCAGGTCACAGAGAAGC-3' (sense for α9 integrin) and 5'-ACAGTCCTCTGAACGGCAAT-3' (antisense for α9 integrin), and 5'-GGGTCAGGTCACAGAGAAGC-3' (sense for SFα9) and 5'-CCACCTTGGGTGCTGAGTAT-3' (antisense for SFα9). Real-time PCR was performed by ABI Prism 7700 (Applied Biosystems). Amplified cDNA was detected with SYBR Green (Invitrogen) and standardized to ROX dye levels. cDNA concentrations were expressed as the number of cycles to threshold (Ct). Ct numbers were normalized to GAPDH in the same samples. The absolute copy numbers of particular transcripts in RD cells were calculated from standard curves generated with a 10-fold dilution series of precisely quantified cloned template DNA.

Statistical analysis

Data are presented as means ± SEM and are representative of at least three independent experiments. The statistical significance of differences between groups was calculated with a 2-tailed Student’s t test. Differences were considered to be significant when P < 0.05 (*) or 0.005 (**).

Results

SFα9 is an alternative splicing valiant of α9 integrin

A potential splice variant of the α9 integrin subunit is shown on NCBI (Genbank ID: BC030198). This variant would encode a truncated isoform containing only the β-propeller domain and thigh domain (Fig.1A). The truncation occurs after Gln 613, which the last amino acid of the predicted thigh domain. The truncated α9 integrin cDNA contains an additional 19 amino acids present in an intron in full-length α9 integrin and a stop codon after exon 15 (we named this region as Ex15b) at its 3' end of the mRNA (Fig.1B).We named this variant short form of α9 (SFα9).

Fig. 1
Short form of α9 structure. (A) Schematic representation of α9 integrin and SFα9 protein. The β-propeller, thigh, genu, calf-1, calf-2, transmembrane (TM), and cytoplasmic (CYT) domains are indicated. The SFα9 protein ...

Expression of authentic SFα9 mRNA in various cancer cell lines

Full-length α9 integrin is expressed in various tumor cell lines including LN-229 cells [20], G361 [21], and RD cells [17]. Using these cell lines and 3 additional cell lines in which full-length α9 mRNA is expressed, RT-PCR was performed to see the expression of authentic SFα9 mRNA. We found that SFα9 mRNA is detected in LN-229, G361, RD, and MDA-MB-435s cells (Fig.2A). The mRNA expression levels of full-length α9 integrin or SFα9 in these cell lines were analyzed by real-time PCR. Abundant full-length α9 integrin and SFα9 mRNA were expressed in RD cells as detected by RT-PCR (Fig.2B). To compare the ratio between full-length α9 integrin and SFα9 mRNA in RD cells, absolute copy number was calculated. The absolute copy number/µg of total RNA of full-length α9 integrin or SFα9 is 1,991,000 ± 245000 or 247,000 ± 37,300 (Fig.2C). Thus, at least 8 times more mRNA of α9 integrin is expressed than SFα9 in RD cells. Next, we used flow cytometry to analyze surface expression of α9 integrin on various tumor cells using antibody Y9A2 against the extracellular domain of α9 integrin. We found that LN-229, G361, RD, or MDA-MB-435s, but not A549 cells, express α9 integrin on the cell surface. To confirm whether α9 integrin on tumor cell surface is functionally active, cell adhesion assays were performed using the α9β1 specific substrate, TNfn3RAA, a recombinant form of the third fibronectin type III repeat in chicken tenascin-C mutated from the normal RGD sequence to RAA to prevent RGD-dependent interaction with RGD-recognizing integrins. Surprisingly, only LN-229, G361, or RD cells but not A549 or MDA-MB-435s adhered to TNfn3RAA (Fig.2E). RD cells adhered strongly to TNfn3RAA, whereas LN-229 or G361 showed weak-binding.

Fig.2
Expression of full-length α9 integrin subunit or SFα9 in various tumor cells. RT-PCR analysis (A) or real-time PCR analysis (B) of full-length α9 integrin or SFα9 expresion in various tumor cells. (C) Absolute copy number ...

SFα9 is expressed on the cell surface and, by itself does not mediate adhesion to tenascin-C

Since SFα9 is truncated in the extracellular domain of α9 integrin, we first hypothesized that SFα9 might be a soluble protein. Cell lysate and culture medium from MEF cells expressing SFα9 (SFα9/MEF), Myc-tagged SFα9 (SFα9-Myc/MEF), FLAG-tagged SFα9 (SFα9-FLAG/MEF), full-length α9 (α9/MEF), or transfected with empty pBabe vector (Mock/MEF) were analyzed by western blot. As expected, NC7 antibody, raised against a C-terminal peptide of full-length α9, only detected a 150kDa protein in α9/MEF cell lysate. A 70kDa of SFα9 was detected in lysates of all SFα9-expressing MEF cells by anti-α9 integrin (R&D) polyclonal antibody, raised against the extracellular domain of α9 integrin. A similar band was detected by anti-Myc antibody in lystaes of SFα9-Myc/MEF and by anti-FLAG antibody in lysates of SFα9-FLAG/MEF. No immunoreactive bands were detected culture supernatant of any SFα9-expressing cell lines (Fig.3A), indicating that SFα9 is not secreted as a soluble protein. Anti-osteopontin antibody was used as a loading control in culture supernatant because MEF cells secrete osteopontin [22]. We then performed flow cytometry with anti-α9 integrin antibody Y9A2 and found surface expression of SFα9 in all SFα9-expressing MEF cells (Fig.3B). To confirm surface expression of SFα9, we labeled cell surface proteins with a thiol-cleavable amine-reactive biotinylation reagent, sulfo-NHS-SS-Biotin. Biotin-labeled cells were lysed and captured with streptavidin agarose and labeled proteins were eluted by reduction and analyzed by immunoblotting. SFα9, like full-length α9 integrin was detectable in the avidin binding fraction (Fig.3C).

Fig. 3
Expression and adhesion of SFα9. (A) SFα9 is not secreted as a soluble protein. Western blot analysis of full-length α9 integrin subunit and SFα9 in cell lysates and culture supernatant from MEF cells transduced with retroviruses ...

Having shown that SFα9 is expressed on the cell surface we assessed its ability to support cell adhesion to TNfn3RAA. SFα9/MEF, SFα9-Myc/MEF and SFα9-FLAG/MEF cells did not bind to TNfn3RAA. α9/MEF cells, expressing full-length α9, were used as positive control. Cell adhesion on the irrelevant substrate, plasma fibronectin, was similar among all 5 cell lines (Fig.3D). These findings indicated that SFα9 by itself neither supports α9-dependent cell adhesion, nor modulates RGD-dependent cell adhesion.

SFα9 enhance adhesion mediated by full-length α9 integrin

To test hypothesis that SFα9 modulates α9β1 integrin function, we established MEF cells stably expressing both full-length α9 integrin and SFα9 (SFα9/α9/MEF, SFα9-Myc/α9/MEF or SFα9-FLAG/α9/MEF). Flow cytometry demonstrated similar surface levels of α9 integrin (Fig.4A). Full-length α9 integrin subunit and SFα9 expression levels were estimated by western blot using anti-α9 integrin antibody NC7, R&D, anti-Myc antibody or anti-FLAG antibody. We detected similar levels of α9 integrin subunit in all MEF cells and SFα9 in SFα9/MEF, SFα9-Myc/MEF, or SFα9-FLAG/MEF cells (Fig.4B). These data suggest that co-expression of SFα9 does not change full-length α9 integrin expression. MEF cells expressing both SFα9 and full-length α9 integrin demonstrated enhanced cell adhesion compared to MEF cells only expressing full-length α9 integrin (Fig.4C), suggesting that SFα9 promotes α9-dependent cell adhesion.

Fig. 4
SFα9 promotes α9-dependent cell adhesion. (A) Flow cytometric evaluation of cell surface expression of α9 integrin subunit on MEF cells co-transduced with α9 integrin subunit and two different-tagged or non-tagged SFα9. ...

To further investigate the importance of endogenous SFα9 for α9-dependent cell adhesion, we examined endogenous SFα9 expression in various tumor cell lines whose expression of full-length α9 integrin or SFα9 was tested by PCR and flow cytometry (Fig.2A–D). Endogenous SFα9 protein was evaluated by first determining that of the 3 monoclonal antibodies we generated against human α9 integrin A9A1 was most efficient for SFα9 immunoprecipitation (Fig.5A). A9A1 was then used to immunoprecipitate lysates of SFα9/α9/SW480 cells or various tumor cell lines. Two bands of 150kDa and 70kDa that correspond to full-length α9 integrin and SFα9, respectively, were detected by immunoblotting in SFα9/α9/SW480 cells (Fig.5B). The band representing full-length α9 integrin was detected in all cell lines but not A549 cell, whereas SFα9 was detected in only RD cells. RD cells strongly bind to TNfn3RAA (Fig.2E) [17]. Therefore, we knocked down endogenous SFα9 in RD cells with lentiviral vectors expressing small hairpin RNAs (shRNAs) based on the unique 3' sequence of SFα9 derived from exon15b, which is not contained in full-length α9 integrin mRNA, to investigate the importance of endogenous SFα9 for α9-dependent cell adhesion. Lentiviral transduction efficiency was monitored by GFP expression. Over 95% of RD cells transduced with each of two shRNAs were GFP+ (Fig.5C). Real-time PCR showed that SFα9 shRNA 1 or 2 caused >80% or >40 reduction, respectively, in SFα9 mRNA (Fig.5D) with no effect on full-length α9 integrin mRNA expression. Western blotting confirmed that the expression of SFα9 protein was substantially reduced in the cells transduced with SFα9 shRNA1 with no effect on protein expression of full-length α9 integrin (Fig.5E). RD cells transduced with shRNA1 manifested decreased cell adhesion on TNfn3RAA compared to RD cells transduced with empty pSicoR vector (Fig.5F), with noted no effect on adhesion to the irrelevant substrate, plasma fibronectin.

Fig. 5
Endogenously expressed SFα9 promotes α9-dependent cell adhesion. (A)A9A1 is useful antibody for SFα9 immunoprecipitation. Lysates from SFα9-FLAG/α9/SW480 cells were immunoprecipitated by anti-α9 integrin ...

SFα9 promotes full-length α9 integrin-dependent cell adhesion via the authentic α9 subunit cytoplasmic domain

To determine whether the authentic α9 cytoplasmic domain is critical for SFα9-dependent enhancement of cell adhesion, we transfected FLAG-tagged SFα9 into CHO cells stably expressing wild type or chimeric α9 subunits containing the α9 extracellular and transmembrane domains and either authentic α9 or α4 or α5 integrin cytoplasmic domains. SFα9 expression did not change the expression level of α9 integrin subunits in any of these CHO cell lines (Fig.6A). SFα9-FLAG/α9/CHO cells demonstrated enhanced cell adhesion on TNfn3RAA compared to Mock/α9/CHO cells. However, SFα9-FLAG/α9α5/CHO or SFα9-FLAG/α9α4/CHO cells had no enhancement of cell adhesion (Fig.6B). As expected, expression of SFα9 had no effect on cell adhesion to plasma fibronectin in any cell line (Fig.6B). Thus, SFα9 specifically promotes α9 integrin-dependent cell adhesion through a mechanism that requires the α9 subunit cytoplasmic domain.

Fig. 6
Effect of α9 integrin subunit cytoplasmic domain on promoting α9-dependent cell adhesion by SFα9. (A) Flow cytometry of cell surface expression of α9 integrin subunit on α9-, α9α5-, α9α4-expressing ...

SFα9 binds to neither full-length α9 subunit nor β1 subunit

The full-length α9 integrin subunit associates with the β1 subunit. SFα9 promotes full-length α9-dependent cell adhesion. Therefore, we asked whether SFα9 associates with α9 or β1 subunits to analyze the mechanism of cell surface expression and function of SFα9. Lysates from Mock/α9/CHO cells or SFα9-FLAG/α9/CHO cells were immunoprecipitated with anti-FLAG antibody or anti-α9 antibody NC7, and immunoblotted with anti-FLAG antibody, anti-α9 antibody NC7 or anti-β1 integrin antibody. We found that neither the α9 integrin subunit nor the β1 subunit could be co-immunoprecipitated with anti-FLAG antibody (Fig.7). Thus, SFα9 does not bind full-length α9 or β1 integrin subunits.

Fig. 7
SFα9 binds to neither full-length α9 integrin subunit nor β1 integrin subunit. Lysates from CHO cells co-expressing full-length α9 integrin subunit and FLAG-tagged SFα9 or control were immunoprecipitated by anti-FLAG ...

Discussion

In the present study, we report the expression and function of a novel alternatively spliced variant of α9 integrin, SFα9. Whereas SFα9 by itself does not mediate cell adhesion to the α9β1 ligand, TNfn3RAA (Fig.3D), it does enhance adhesion in cells co-expressing full-length α9 integrin (Fig.4C and and6B).6B). Surprisingly, this effect requires the presence of specific sequences in the α9 cytoplasmic domain (Fig.6B).

One potential explanation for the adhesion enhancing effects of SFα9 would be that this variant associates with another transmembrane protein, which is not full-length α9, or β1 integrin subunits (Fig.7), and initiates signals that increase the avidity of the α9β1 integrin for its ligands, a process that has been called inside-out signaling. There are numerous precedents for integrin activation by inside-out signal. For example, CXCR2, CXCR4, CCR3, formyl peptide receptor, IgE receptor, and IL-5 receptor modulate α4β1 integrin binding [23, 24]. Platelet activators such as thrombin, and ATP modulate αIIbβ3 binding [25, 26]. Insulin-Like Growth Factor I modulates αvβ3 binding [27].

It has been reported recently that the src family kinase inhibitor PP1 inhibits α9 integrin-dependent cell adhesion, suggesting inside-out activation of this integrin is regulated by src or other tyrosine kinases that can be inhibited by PP1 [21]. However, this effect is not α9 integrin-specific because PP1 can inhibit cell adhesion to plasma fibronectin [28, 29].

Several integrin subunits have alternative splicing variants including α3, α6, α7, αIIb, β1, β3, β4, and β5 [30, 31]. At least four integrin subunits, α6, α7, αIIb and β3 have alternative splicing variant in their extracellular domains. In the α6 and α7 subunits alternative splicing inserts a new exon [32, 33], whereas in αIIb and β3 there are truncated alternative splicing variants [3436], similar to what we now describe for SFα9. Both truncated αIIb and β3 lack transmembrane and cytoplasmic domains, and have novel C-terminal amino acid sequences. However, unlike SFα9, both are secreted protein. Secreted truncated β3 inhibits cell adhesion [35]. Thus SFα9 has the unique features of cell surface expression and of promotion of cell adhesion.

Some integrins α subunits (α3, α4, α5, α6, α7, α8, αv, αE, and αIIb) undergo post-translational endoproteolytic cleavage within their extracellular domains [37]. α4, which is a structurally related to α9, is cleaved into N-terminal (80kDa) and C-terminal (70kDa) fragments at Arg 597 by furin [37]. Although the N-terminal cleaved product has no transmembrane domain, this product is expressed on the cell surface [37]. Both SFα9 and the N-terminal cleaved product of α4 are principally composed of the β-propeller and partially thigh domains, and are expressed on cell surface. In α6 and α7, the N-terminal cleaved product has β-propeller and partial thigh domains. Processing of α6 and α7 is important for inside-out signaling and enhanced cell adhesion, respectively [38, 39], similar to the results described here.

We evaluated full-length α9 integrin expression by PCR (Fig.2A, 2B), flow cytometry (Fig.2D), and western blotting (Fig.5B). LN-229, G361, RD, and MDA-MB-435s express full-length α9 integrin, but only RD cells can bind to TNfn3RAA strongly (Fig.2E). We also evaluated SFα9 expression in several cell lines by PCR (Fig.2A, 2B) and western blotting (Fig.5B). SFα9 mRNA was found in all cells expressing full-length α9 integrin protein, but SFα9 protein was found in only RD cells. These findings stimulated us to knockdown SFα9 in RD cells. Knockdown of SFα9 in RD cells decreased α9β1-mediated cell adhesion (Fig.5F). These results suggest that SFα9 modulates the function of full-length α9 integrin.

To analyze the mechanism by which SFα9 is expressed on the cell surface and modulates the function of full-length α9 integrin, we examined whether SFα9 associates with full-length α9 integrin or β1 integrin subunits. We found that SFα9 does not associate with α9 or β1. Further experiments are needed to determine how SFα9 is expressed on the cell surface and how it promotes α9-dependent cell adhesion.

In summary, SFα9, which is a truncated isoform of the α9 integrin subunit containing only the β-propeller domain, thigh domain and an additional 19 amino acids derived from an intron, is expressed on the cell surface, but cannot bind α9 integrin ligand, TNfn3RAA. Over-expression of SFα9 in cells expressing full-length α9 promotes α9-dependent cell adhesion mediated through the cytoplasmic domain of the co-expressed full-length α9 subunit. Thus, our findings suggest that SFα9 is a novel functional modulator of the α9β1 integrin.

Acknowdgements

We thank Michael McManus (University of California, San Francisco) for shRNA construction and lentiviral infection assistance. We also thank Chun Chen and Ahnika Kline for helpful suggestions and technical help. This work was supported by National Institutes of Health Grant HL64353 (to D.S.), and the Uehara memorial foundation (to SK).

The abbreviations used are

SFα9
short form of α9 integrin
VCAM-1
vascular cell adhesion molecule-1
VEGF
vascular endothelial growth factor
ADAM
a disintegrin and metalloprotease
SSAT
spermidine/spermin N1-acetyltransferase
Kir
inward-rectifing K+ (channel)
CHO
chinese hamster ovary
MEF
mouse embryonic fibroblast
TNfn3RAA
the mutant form of the third fibronectin type III repeat in tenascin-C
BSA
bovine serum albumin
DTT
dithiothreitol
shRNA
small hairpin RNA

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

1. Hynes RO. Integrins: a family of cell surface receptors. Cell. 1987;48:549–554. [PubMed]
2. Hynes RO. Integrins: versatility, modulation, and signaling in cell adhesion. Cell. 1992;69:11–25. [PubMed]
3. Springer TA. Folding of the N-terminal, ligand-binding region of integrin alpha-subunits into a beta-propeller domain. Proc. Natl. Acad. Sci. U. S. A. 1997;94:65–72. [PubMed]
4. Diamond MS, Springer TA. The dynamic regulation of integrin adhesiveness. Curr. Biol. 1994;4:506–517. [PubMed]
5. Ginsberg MH. Integrins: dynamic regulation of ligand binding. Biochem. Soc. Trans. 1995;23:439–446. [PubMed]
6. Vlahakis NE, Young BA, Atakilit A, Hawkridge AE, Issaka RB, Boudreau N, Sheppard D. Integrin alpha9beta1 directly binds to vascular endothelial growth factor (VEGF)-A and contributes to VEGF-A-induced angiogenesis. J. Biol. Chem. 2007;282:15187–15196. [PubMed]
7. Vlahakis NE, Young BA, Atakilit A, Sheppard D. The lymphangiogenic vascular endothelial growth factors VEGF-C and -D are ligands for the integrin alpha9beta1. J. Biol. Chem. 2005;280:4544–4552. [PMC free article] [PubMed]
8. Taooka Y, Chen J, Yednock T, Sheppard D. The integrin alpha9beta1 mediates adhesion to activated endothelial cells and transendothelial neutrophil migration through interaction with vascular cell adhesion molecule-1. J. Cell Biol. 1999;145:413–420. [PMC free article] [PubMed]
9. Yokosaki Y, Matsuura N, Sasaki T, Murakami I, Schneider H, Higashiyama S, Saitoh Y, Yamakido M, Taooka Y, Sheppard D. The integrin alpha(9)beta(1) binds to a novel recognition sequence (SVVYGLR) in the thrombin-cleaved amino-terminal fragment of osteopontin. J. Biol. Chem. 1999;274:36328–36334. [PubMed]
10. Eto K, Huet C, Tarui T, Kupriyanov S, Liu HZ, Puzon-McLaughlin W, Zhang XP, Sheppard D, Engvall E, Takada Y. Functional classification of ADAMs based on a conserved motif for binding to integrin alpha 9beta 1: implications for sperm-egg binding and other cell interactions. J. Biol. Chem. 2002;277:17804–17810. [PubMed]
11. Chen C, Young BA, Coleman CS, Pegg AE, Sheppard D. Spermidine/spermine N1-acetyltransferase specifically binds to the integrin alpha9 subunit cytoplasmic domain and enhances cell migration. J. Cell Biol. 2004;167:161–170. [PMC free article] [PubMed]
12. deHart GW, Jin T, McCloskey DE, Pegg AE, Sheppard D. The alpha9beta1 integrin enhances cell migration by polyamine-mediated modulation of an inward-rectifier potassium channel. Proc. Natl. Acad. Sci. U. S. A. 2008;105:7188–7193. [PubMed]
13. Young BA, Taooka Y, Liu S, Askins KJ, Yokosaki Y, Thomas SM, Sheppard D. The cytoplasmic domain of the integrin alpha9 subunit requires the adaptor protein paxillin to inhibit cell spreading but promotes cell migration in a paxillin-independent manner. Mol. Biol. Cell. 2001;12:3214–3225. [PMC free article] [PubMed]
14. Liu S, Slepak M, Ginsberg MH. Binding of Paxillin to the alpha 9 Integrin Cytoplasmic Domain Inhibits Cell Spreading. J. Biol. Chem. 2001;276:37086–37092. [PubMed]
15. Swift S, Lorens J, Achacoso P, Nolan GP. Rapid production of retroviruses for efficient gene delivery to mammalian cells using 293T cell-based systems. Chapter 10. Curr. Protoc. Immunol. 2001 Unit 10 17C. [PubMed]
16. Wang A, Yokosaki Y, Ferrando R, Balmes J, Sheppard D. Differential regulation of airway epithelial integrins by growth factors. Am. J. Respir. Cell. Mol. Biol. 1996;15:664–672. [PubMed]
17. Yokosaki Y, Palmer EL, Prieto AL, Crossin KL, Bourdon MA, Pytela R, Sheppard D. The integrin alpha 9 beta 1 mediates cell attachment to a non-RGD site in the third fibronectin type III repeat of tenascin. J. Biol. Chem. 1994;269:26691–26696. [PubMed]
18. Yokosaki Y, Matsuura N, Higashiyama S, Murakami I, Obara M, Yamakido M, Shigeto N, Chen J, Sheppard D. Identification of the ligand binding site for the integrin alpha9 beta1 in the third fibronectin type III repeat of tenascin-C. J. Biol. Chem. 1998;273:11423–11428. [PubMed]
19. Ventura A, Meissner A, Dillon CP, McManus M, Sharp PA, Van Parijs L, Jaenisch R, Jacks T. Cre-lox-regulated conditional RNA interference from transgenes. Proc. Natl. Acad. Sci. U. S. A. 2004;101:10380–10385. [PubMed]
20. Brown MC, Staniszewska I, Lazarovici P, P.Tuszynski G, Del Valle L, Marcinkiewicz C. Regulatory effect of nerve growth factor in alpha9beta1 integrin-dependent progression of glioblastoma. Neuro. Oncol. 2008;10:968–980. [PMC free article] [PubMed]
21. Lydolph MC, Morgan-Fisher M, Hoye AM, Couchman JR, Wewer UM, Yoneda A. alpha9beta1 Integrin in melanoma cells can signal different adhesion states for migration and anchorage. Exp. Cell. Res. 2009;315:3312–3324. [PubMed]
22. Wu Y, Denhardt DT, Rittling SR. Osteopontin is required for full expression of the transformed phenotype by the ras oncogene. Br. J. Cancer. 2000;83:156–163. [PMC free article] [PubMed]
23. Chigaev A, Blenc AM, Braaten JV, Kumaraswamy N, Kepley CL, Andrews RP, Oliver JM, Edwards BS, Prossnitz ER, Larson RS, Sklar LA. Real time analysis of the affinity regulation of alpha 4-integrin. The physiologically activated receptor is intermediate in affinity between resting and Mn(2+) or antibody activation. J. Biol. Chem. 2001;276:48670–48678. [PubMed]
24. Olson TS, Ley K. Chemokines and chemokine receptors in leukocyte trafficking. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2002;283:R7–R28. [PubMed]
25. Marguerie GA, Plow EF, Edgington TS. Human platelets possess an inducible and saturable receptor specific for fibrinogen. J. Biol. Chem. 1979;254:5357–5363. [PubMed]
26. Marguerie GA, Edgington TS, Plow EF. Interaction of fibrinogen with its platelet receptor as part of a multistep reaction in ADP-induced platelet aggregation. J. Biol. Chem. 1980;255:154–161. [PubMed]
27. Sekimoto H, Eipper-Mains J, Pond-Tor S, Boney CM. (alpha)v(beta)3 integrins and Pyk2 mediate insulin-like growth factor I activation of Src and mitogen-activated protein kinase in 3T3-L1 cells. Mol. Endocrinol. 2005;19:1859–1867. [PubMed]
28. Butler B, Blystone SD. Tyrosine phosphorylation of beta3 integrin provides a binding site for Pyk2. J. Biol. Chem. 2005;280:14556–14562. [PubMed]
29. Wang Y, Jin G, Miao H, Li JY, Usami S, Chien S. Integrins regulate VE-cadherin and catenins: dependence of this regulation on Src, but not on Ras. Proc. Natl. Acad. Sci. U. S. A. 2006;103:1774–1779. [PubMed]
30. Fornaro M, Languino LR. Alternatively spliced variants: a new view of the integrin cytoplasmic domain. Matrix Biol. 1997;16:185–193. [PubMed]
31. de Melker AA, Sonnenberg A. Integrins: alternative splicing as a mechanism to regulate ligand binding and integrin signaling events. Bioessays. 1999;21:499–509. [PubMed]
32. Delwel GO, Kuikman I, Sonnenberg A. An alternatively spliced exon in the extracellular domain of the human alpha 6 integrin subunit--functional analysis of the alpha 6 integrin variants. Cell Adhes. Commun. 1995;3:143–161. [PubMed]
33. Ziober BL, Chen Y, Kramer RH. The laminin-binding activity of the alpha 7 integrin receptor is defined by developmentally regulated splicing in the extracellular domain. Mol. Biol. Cell. 1997;8:1723–1734. [PMC free article] [PubMed]
34. Trikha M, Cai Y, Grignon D, Honn KV. Identification of a novel truncated alphaIIb integrin. Cancer Res. 1998;58:4771–4775. [PubMed]
35. Jin R, Trikha M, Cai Y, Grignon D, Honn KV. A naturally occurring truncated beta3 integrin in tumor cells: native anti-integrin involved in tumor cell motility. Cancer Biol. Ther. 2007;6:1559–1568. [PubMed]
36. Djaffar I, Chen YP, Creminon C, Maclouf J, Cieutat AM, Gayet O, Rosa JP. A new alternative transcript encodes a 60 kDa truncated form of integrin beta 3. Biochem. J. 1994;300(Pt 1):69–74. [PubMed]
37. Bergeron E, Basak A, Decroly E, Seidah NG. Processing of alpha4 integrin by the proprotein convertases: histidine at position P6 regulates cleavage. Biochem. J. 2003;373:475–484. [PubMed]
38. Liu J, Gurpur PB, Kaufman SJ. Genetically determined proteolytic cleavage modulates alpha7beta1 integrin function. J. Biol. Chem. 2008;283:35668–35678. [PubMed]
39. Delwel GO, Kuikman I, van der Schors RC, de Melker AA, Sonnenberg A. Identification of the cleavage sites in the alpha6A integrin subunit: structural requirements for cleavage and functional analysis of the uncleaved alpha6Abeta1 integrin. Biochem. J. 1997;324(Pt 1):263–272. [PubMed]