PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Cancer Res. Author manuscript; available in PMC 2012 June 15.
Published in final edited form as:
PMCID: PMC3117077
NIHMSID: NIHMS293762

Enhancement of Cancer Vaccine Therapy by Systemic Delivery of a Tumor Targeting Salmonella-based STAT3 shRNA Suppresses the Growth of Established Melanoma Tumors

Abstract

Cancer vaccine therapies have only achieved limited success when focusing on effector immunity with the goal of eliciting robust tumor-specific T cell responses. More recently, there is an emerging understanding that effective immunity can only be achieved by coordinate disruption of tumor-derived immune suppression. Towards that goal, we have developed a potent Salmonella-based vaccine expressing codon-optimized survivin (CO-SVN) referred to as 3342Max. When used alone as a therapeutic vaccine, 3342Max can attenuate growth of aggressive murine melanomas overexpressing SVN. However, under more immunosuppressive conditions, such as those associated with larger tumor volumes, we found that the vaccine was ineffective. Vaccine efficacy could be rescued if tumor-bearing mice were treated initially with Salmonella encoding a shRNA targeting the tolerogenic molecule STAT3 (YS1646-shSTAT3). In vaccinated mice, silencing STAT3 increased the proliferation and granzyme B levels of intratumoral CD4+ and CD8+ T cells. The combined strategy also increased apoptosis in tumors of treated mice, enhancing tumor-specific killing of tumor targets. Interestingly, mice treated with YS1646-shSTAT3 or 3342Max alone were similarly unsuccessful in rejecting established tumors, while the combined regimen was highly potent. Our findings establish that a combined strategy of silencing immunosuppressive molecules followed by vaccination can act synergistically to attenuate tumor growth, and they offer a novel translational direction to improve tumor immunotherapy.

Keywords: shRNA, STAT3, immunosuppression, survivin, Salmonella

Introduction

Survivin (SVN) is a member of the inhibitor of apoptosis protein (IAP) family whose function is involved in prolonging cell survival and cell cycle control (1, 2). SVN is an ideal tumor-associated antigen (TAA) for therapeutic vaccination because it is overexpressed by essentially all solid tumors and is poorly expressed in normal adult tissues (3). Increased expression of SVN is also observed in endothelial cells during angiogenesis, thereby serving as an additional target for therapy (4). In animal tumor models, downregulation or inactivation of SVN has already been shown to inhibit tumor growth (57). Therefore, strategies to boost tumor-specific responses, such as using adjuvants or immunogenic vectors, will be critical to the success of therapeutic vaccination (8, 9).

Even when favorable vaccination conditions are discovered that promote robust tumor-specific immunity, these responses can eventually be compromised by expanding numbers of intratumoral regulatory T cells and myeloid-derived suppressor cells (1013). Signal transducer and activator of transcription 3 (STAT3) has been recognized as an oncogenic transcription factor in myeloid and tumor cells that, when activated, inhibits production of immunostimulatory molecules and promotes expression of immunosuppressive molecules (1416). A promising approach to inactivating STAT3 is the use of siRNA or shRNA, usually administered intratumorally, alone or conjugated to molecules that target specific cell populations (17, 18).

Advances in the generation of attenuated enteric bacterial vectors, such as Salmonella typhimurium, facilitates the highly translational tumor-specific delivery of antigens or plasmids (1921). The vector itself acts as an adjuvant to elicit innate immunity and aid in generation of adaptive immunity against recombinant antigen. The most common Salmonella vaccines employ Salmonella pathogenicity 1 (SPI1) type 3 secretion systems (T3SS), which only produce recombinant antigen in a defined timeframe as the pathogen penetrates the host cell (22). More advanced vaccine designs utilize SPI2 T3SS, which switches on recombinant antigen production when the Salmonella have entered the host cell, allowing for extended antigen production (23). Numerous studies have documented strains that colonize hypoxic regions of solid tumors weeks following intravenous injection, with no detectable bacteria in peripheral organs, making it an ideal delivery vehicle for targeting shRNA therapeutics into solid tumors (2426).

In this report, we demonstrate a novel strategy utilizing two therapeutic agents delivered systemically that are inadequate to control tumor growth as single agents but succeed as a combined therapy. Specifically, attenuated Salmonella typhimurium carrying either a STAT3-specific shRNA plasmid (YS1646-shSTAT3) or an SVN expression plasmid (3342Max) were administered consecutively and observed to function synergistically leading to effective tumor rejection. The combined approach improves the prospects for successful vaccination against cancer by altering the tumor microenvironment to be less antagonistic to tumor infiltrating T cells such as those stimulated by vaccine-encoded TAAs.

Materials and Methods

Animals, tumor lines, and bacterial strains

C57BL/6 mice (Jackson, 6–8 weeks) were obtained from breeding colonies housed at the City of Hope (COH) Animal Research Center (Duarte, CA). The B16F10 murine melanoma line was a kind gift from Drs. Hua Yu and Marcin Kortylewski (COH, Duarte, CA). Cells were maintained in DMEM containing 10% FBS. S. typhimurium strains MVP728 (purD-/htrA-) and YS1646 (ATCC#202165) were cultured by shaking at 37°C in LB or LB-O media.

Salmonella SPI2 expression vectors, shRNA plasmids, and generation of recombinant Salmonella

pWSK29 constructs containing the SPI2 expression cassettes for LisA (2810) or SVN (3342) are described elsewhere (23). For construction of pWSK29 encoding Salmonella codon optimized survivin (CO-SVN), 2810 was digested with XbaI/EcoRV and the gel purified pWSK29 backbone was used to clone the CO-SVN gene (Genscript, Piscataway, NJ) engineered with XbaI/EcoRV sites for in frame fusion with the sseF gene. shRNA constructs against STAT3 (Origene, Rockville, MD) were tested for silencing by stable transfection of B16F10 cells followed by western blot (WB) analysis using polyclonal rabbit antibody against STAT3 (Santa Cruz Biotech, Santa Cruz, CA). The pGFP-V-RS vector containing the 29-mer shRNA sequence ACCTGAAGACCAAGTTCATCTGTGTGACA (ID#GI556360) exhibited >70% STAT3 knockdown and was selected for generation of recombinant YS1646. SPI2 expression vectors and shRNA plasmids were electroporated into MVP728 or YS1646, respectively, with a BTX600 electroporator (BTX, San Diego, CA).

Western blot analysis

WB for Salmonella expression of SVN was carried out as described previously (23). Briefly, 3342 and 3342Max were grown overnight in MOPS based media (Sigma) at 37oC containing either low phosphate (113 uM) to induce SPI2 expression or high phosphate (25 mM). Bacterial pellets were boiled in SDS loading buffer and equal amounts of lysate were loaded. Blots were probed using a monoclonal rabbit antibody (ab76424) against SVN (Abcam, Cambridge, MA).

Tumor challenge, vaccination, and shRNA therapy

For tumor challenge, 105 B16F10 cells were injected subcutaneously into C57BL/6 mice. Tumor growth was monitored daily or every other day using a caliper. For testing vaccination alone, MVP728 carrying 2810, 3342 or 3342Max were administrated by gavage twice, 4 days apart, when tumors reached 3.5–4 mm in diameter at 108 cfu. For combined therapy, PBS, YS1646-STAT3 or -scrambled was first injected at 107 cfu in C57BL/6 mice when tumor volumes were ≥50 mm3 (7–8 mm in diameter) followed by gavage with PBS or 107 cfu MVP728-2810 or -3342Max.

Quantitative PCR for detection of STAT3 levels

Mice bearing B16F10 tumors (≥50mm3) were i.v. injected with 107 cfu of YS1646-scrambled, -shSTAT3, or PBS twice, 4 days apart. At days 3, 7, and 10, mice (n=3) were sacrificed and RNA was extracted from tumor homogenates for generation of single stranded cDNA (Fermentas, Glen Burnie, MD). To quantitate STAT3 levels, SYBR®-Green qPCR analysis (BD Biosciences, Franklin Lakes, NJ) using primers specific for STAT3 (Forward: 5′-CATGGGCTATAAGATCATGGATGCGAC-3′, Reverse: 5′-AGGGCTCAGCACCTTCACCGTTATTTC-3′) was carried out using GAPDH (Forward: 5′-CAAGGTCATCCATGACAACTTTG-3′, Reverse: 5′-GTCCACCACCCTGTTGCTGTAG-3′) for normalization.

Immunofluorescence staining

For detection of intracellular SVN expression from recombinant Salmonella, RAW264.7 macrophages seeded on coverslips were infected for 30 minutes at an MOI of 10 with wildtype MVP728, 3342, or 3342Max. Cells were incubated overnight in DMEM-10 containing 10 μg/mL gentamicin. Cells were fixed/permeabilized with 1:1 acetone:methanol and stained with conjugated antibodies FITC-LPS (Santa Cruz Biotech, Santa Cruz, CA) and PE-HA (Covance, Princeton, NJ) overnight at 4°C followed by DAPI. Cells were imaged on an Axiovert 200 using live imaging software (Axiovision, Skokie, IL). Images shown are representative of cells observed within multiple fields.

Flow cytometry

Conjugated mAbs directed to PECy7-CD8, PerCP-CD45, and PE-phospho-STAT3 were purchased from BD Pharmingen (San Diego, CA) and mAb to APC-Cy7-CD4, APC-F4/80, FITC-Ki-67, PE-Granzyme B, and FITC-Annexin V were purchased from eBioscience (San Diego, CA). Intracellular phosphor-STAT3, Granzyme B, Ki-67 and Annexin V staining were performed following the manufacturer’s protocol (eBioscience). Samples were run on a FACS-Canto (Becton Dickinson, La Jolla, CA) and analyzed using FlowJo software (TreeStar, Ashland, OR).

Cytotoxicity assay

Cytotoxicity against B16F10 melanoma cells in treated mice was determined using a standard 51Cr release assay (27). Briefly, effectors were derived from spleens of B16F10-bearing C57BL6 mice (n=4) i.v. injected with either PBS, 107 cfu of YS1646-shSTAT3 or -scrambled followed by gavage with PBS or 107 cfu of 3342Max or 2810 4 days later. Mice were sacrificed ~1 week post-gavage and splenocytes were co-incubated with RMA-S cells loaded with human SVN library (27). Effectors were then co-incubated for 4 hours with 5,000 Cr51-loaded B16F10 targets in 96-well plates at ratios of 100:1, 20:1, and 4:1 (in triplicate). Radioactivity released into the supernatant was measured using a Cobra Quantum gamma counter (PerkinElmer). Percent specific lysis: (experimental release − spontaneous release)/(maximum release − spontaneous release) × 100.

Statistical analysis

Statistical significance for comparisons between two or more groups was calculated with the Graphpad Prism Software v4.03 using the Student’s t test or one-way ANOVA, respectively. A p value <0.05 was considered significant. All experiments were typically performed at least in duplicate, and all data are presented as mean ± SEM. *p<0.05, **p<0.01, and ***p<0.001.

Results

Construction and evaluation of SVN expression vectors

Previous work using the MVP728 bacterial vector transformed with plasmid 3342, which expresses SVN, demonstrated partial success in rejecting murine models of colon carcinoma and glioblastoma (23). We found that SVN expression from 3342 was suboptimal when compared to LisA expression from 2810 (data not shown). We hypothesized that codon optimization (CO) of SVN to Salmonella preferred codons would allow for increased stability and protein expression leading to greater anti-tumor effects (28, 29). To test this hypothesis, a Salmonella typhimurium CO-SVN sequence was generated using an online algorithm (30) and then synthesized (Genscript). As shown in Fig. 1A, the low copy plasmid pWSK29 was engineered to encode the SPI2 chaperone protein sscB (31) and sseF protein fused to either LisA (2810), SVN (3342), or CO-SVN (3342Max) for expression and secretion by MVP728. Ultimately, expression of these genes would be regulated by the SPI2 specific promoter for sseA.

Fig. 1
Construction and validation of SVN expression vectors

We determined whether CO actually increased SVN expression by growing the recombinant Salmonella in SPI2-inducing conditions (32) (Fig. 1B). Under non-inducing conditions (PCN+P), we found no significant expression of SVN. Surprisingly, under inducing conditions (PCN-P), we observed much greater SVN expression from 3342Max compared to the non-optimized 3342. To further evaluate SVN expression and secretion by 3342Max, we infected RAW264.7 murine macrophages with either 3342 or 3342Max to determine intracellular expression of SVN by immunofluorescence. As shown in Fig. 1C (HA-SVN panel), we observed greater SVN expression (characterized by more foci) compared to 3342. As expected, mAb staining for both the LPS (LPS-St panel) and HA (HA-survivin panel) localized to the cytoplasm and overlapped in the Merge panel, independent of the nuclear DAPI staining. These data suggest that optimization of SVN tailored to preferred Salmonella codons greatly improves recombinant antigen expression.

CO-SVN enhances suppression of tumor growth

We next evaluated whether enhanced expression of SVN by 3342Max translated into a more efficacious vaccine using a B16F10 melanoma, which naturally overexpresses SVN (inset of Fig. 2A). Subcutaneously injected tumor cells were allowed to grow until a palpable tumor was present, generally 3.5–4 mm in diameter (<10mm3). Mice were then gavaged twice (4 days apart) with either PBS or MVP728 harboring 2810, 3342, or 3342Max constructs. As shown in Fig. 2A, 3342Max vaccination was superior to all other experimental treatments in attenuating tumor growth (p<0.01). We then determined the lymphocyte subsets that were most responsible for the attenuation by carrying out in vivo antibody depletions of CD8+, CD4+, or NK populations in tumor bearing mice vaccinated with 3342Max as in Fig. 2A. We observed that depletion of CD8+ T lymphocytes resulted in significant loss of tumor growth control with an intermediate effect of NK depletion, which has been described previously (17). These data suggest that vaccination with 3342Max elicits superior CD8+ T cell responses that limit tumor growth, likely a result of enhanced SVN expression.

Fig. 2
Codon optimization of SVN enhances suppression of B16F10 melanoma growth

Attenuation of STAT3 mRNA levels using shRNA

When subcutaneous B16F10 tumors were grown to larger volumes before treatment (7–8 mm in diameter, ≥50mm3), we discovered that 3342Max vaccination had no efficacy to attenuate growth (data not shown). Since we demonstrated that 3342Max works efficiently in less demanding circumstances (Fig. 2), we presumed that failure under more stringent conditions was likely the result of greater levels of tumor-derived immunosuppression (33). To determine if we could rescue the efficacy of the vaccine, we sought to manipulate the tumor microenvironment by silencing the tolerogenic molecule STAT3 (15, 34, 35). We chose to inactivate STAT3 mRNA expression using an shRNA expression plasmid carried by the tumor-targeting Salmonella strain YS1646 (36). We first tested several commercially available shRNA plasmids (Origene) to silence the expression of STAT3 in stably transfected B16F10 tumor lines. As shown in Fig. 3A, shSTAT3#60 showed dramatic silencing (>70%) of endogenous STAT3 when compared to scrambled shRNA control plasmid. Other shSTAT3 plasmids had intermediate to no effect on endogenous STAT3 expression.

Fig. 3
Targeted silencing of STAT3 using YS1646-shSTAT3 results in significant suppression of tumor growth when combined with 3342Max

Targeted silencing of STAT3 combined with 3342Max results in significant suppression of tumor growth in a more advanced melanoma tumor model

We next generated YS1646 carrying the shSTAT3#60 plasmid (YS1646-shSTAT3) to test whether systemic delivery of Salmonella by i.v. route could silence STAT3 expression in situ in the tumor. Mice bearing subcutaneous B16F10 tumors (≥50 mm3) were injected twice i.v. with 107 cfu of YS1646-shSTAT3, -scrambled, or PBS 4 days apart. Post-treatment, no significant attenuation of tumor growth was observed for mice treated with YS1646-shSTAT3 alone compared to control groups (data not shown). These same results were also observed in less stringent conditions where initial tumor volumes were <10mm3 (data not shown). Nonetheless, tumors were isolated, homogenized, and total RNA extracted for quantitative PCR. Surprisingly, there was significant silencing of STAT3 three days after YS1646-shSTAT3 administration compared to mice administered YS1646-scrambled or PBS (Fig. 3B). STAT3 silencing continued to increase on day 7 in the shSTAT3 group, which is consistent with the continued effectiveness of the therapeutic strategy (see below). On day 10, STAT3 silencing moderated, but was still lower than the control groups. Confirmation that YS1646-shSTAT3 succeeded in specifically silencing STAT3 mRNA but failed to reject tumors as a single agent motivated us to combine delivery of shSTAT3 and 3342Max vaccination in mice with significantly larger B16F10 tumors. Therefore, mice bearing B16F10 tumors ≥50 mm3 were i.v. injected with 107 cfu of YS1646-shSTAT3, -scrambled, or PBS. Four days later, mice were gavaged with 107 cfu of 3342Max, 2810, or PBS. As shown in Fig. 3C, the combination of shSTAT3+3342Max rescues the activity of the vaccination to attenuate tumor growth significantly better than control groups. These results suggest that combining shSTAT3 therapy and SVN vaccination is a powerful synergistic approach to attenuate tumor growth.

Decreased phospho-STAT3 levels are observed in tumor macrophages following shSTAT3 and 3342Max treatment

We hypothesized that the success of the combined treatment was in part due to suppression of phospho-STAT3 levels in specific immune populations. Therefore, we used flow cytometry to determine the levels of activated STAT3 in specific immune subsets present in the tumor following treatment. We found no significant changes in phospho-STAT3 levels for CD4+, CD8+, CD11c+, or Gr1+CD11b+ cells in all treatment groups (Supplemental Fig. 1). However, we did observe significantly decreased phospho-STAT3 levels (p<0.05) in F4/80+ macrophages for the shSTAT3+3342Max treated group (Fig. 4A). Surprisingly, no significant decreases of phospo-STAT3 were observed for the shSTAT3+2810 group. These results suggest that only the shSTAT3+3342Max treatment is able to prevent activation of STAT3 in the F4/80+ subset, likely a result of early STAT3 silencing followed by tumor growth control, whereas shSTAT3+2810 is unable to do so regardless of early STAT3 silencing due to uncontrolled tumor growth.

Fig. 4
YS1646-shSTAT3 treatment followed by 3342Max vaccination attenuates STAT3 activation in resident tumor macrophages and enhances infiltration of T lymphocytes

Combined shSTAT3 and 3342Max administration enhances infiltration of T lymphocytes

Since it was known that ablation of STAT3 increases intratumoral immune function (14, 17, 35), we first examined the frequency and functional status of intratumoral CD4+ and CD8+ T cells in vaccinated mice. The percentage of B16F10 intratumoral CD4+ and CD8+ T cells was statistically greater in mice treated with shSTAT3+3342Max than in the scrambled+3342Max or shSTAT3+2810 treatment groups (Fig. 4B). We next evaluated the proliferative index of these intratumoral CD4+ and CD8+ T cells by determining Ki67+ expression levels. Both CD4+ and CD8+ populations expressed higher levels of Ki67+ in the shSTAT3+3342Max group compared to control groups (Fig. 4C and D). The markedly higher proliferation potential suggests that the combined shRNA and vaccination treatments allow for a proliferative expansion of intratumoral T cells, and the increased frequency may therefore not solely be explained by a redistribution of existing T cells from other sites.

YS1646-shSTAT3 enhances tumor-specific cytotoxic responses and tumor cell apoptosis

We addressed tumor cell death by evaluating the extent of apoptosis using Annexin V staining of gated CD45 cells, mainly tumor cells (37), from all of the treatment groups. The CD45 cells revealed significantly higher apoptotic frequencies in mice treated with shSTAT3+3342Max than the control groups (Fig. 5A). The increased apoptosis of tumor cells could either be explained by the cytotoxic activity of immune cells or possibly by a shSTAT3-based mechanism to enhance apoptotic signal transduction. To address immune-based mechanisms, we investigated function of the CD8+ T cell subset by evaluating granzyme B levels in B16F10 tumor-bearing mice (≥50mm3) treated with shSTAT3+3342Max versus groups treated with scrambled+3342Max or shSTAT3+2810 (Fig. 5B). The proportion of CD8+ T cells expressing granzyme B in the mouse group treated with shSTAT3+3342Max was dramatically higher than both control groups. These results suggested a potential cytotoxic mechanism for tumor growth control, which we further assessed using a direct in vitro cytotoxicity assay.

Fig. 5
YS1646-shSTAT3 enhances tumor-specific cytotoxic responses

Tumor-specific cytotoxicity contributes to control of established subcutaneous B16F10 tumors

We determined if T cells obtained from B16F10 tumor-bearing mice treated with shSTAT3+3342Max possessed functional capacity to kill survivin-expressing tumor cells in vitro by conducting a chromium release assay (Fig. 5C). Splenocytes harvested from B16F10 tumor-bearing mice (n=3) treated as in Fig. 5A were in vitro stimulated with a human SVN peptide library, then evaluated for in vitro cytotoxic recognition and killing of chromium-loaded B16F10 tumor targets. Mice treated with either scrambled+3342Max or shSTAT3+2810 could not effectively kill B16F10 tumor cells. In contrast, splenocytes from all mice receiving shSTAT3+3342Max treatment were very effective at killing B16F10 tumor targets (0.001<p<0.01) at all effector ratios (Fig. 5D). These results further suggest that a potential mechanism of tumor growth attenuation is by tumor-specific T cells, stimulated through SVN vaccination or SVN peptide stimulation, directly killing tumor cells, though only when mice are pre-treated with shSTAT3 and then vaccinated with 3342Max.

Discussion

The goal of these studies was to discover a translational approach that would provide durable control of solid tumor growth. Our initial hypothesis was that SVN as a ubiquitously expressed TAA would provide the widest versatility for vaccination. In contrast to Salmonella-based SVN vaccines used in previous studies, which have been relatively ineffective when used alone, the goal was to find a vaccine strategy that would not require additional cytokine or chemokine components for effectiveness (8, 9, 23). A simplified one component regimen based on Salmonella delivery of SVN was the initial goal of this study. Our use of oral systemic administration of Salmonella transformed with SVN expression plasmids was similar to other reports describing Salmonella routes of administration. The advantage to this approach is that Salmonella are efficiently recognized by antigen processing macrophages in the gut or other mucosal sites (38, 39).

Initial trials using 3342 were only partially successful against small tumors that had just a few days to develop vascularization (Fig. 2). By investigating the expression levels of SVN from 3342 and bacterial LisA from 2810, we discovered significantly lower levels of SVN by WB analysis compared to the bacterial LisA protein under identical conditions (data not shown). Since the bacterial LisA protein was so heavily expressed in Salmonella, we theorized that changing the sequence of SVN from human to Salmonella typimurium preferred codons might achieve the same goal. In preliminary experiments, we found a gradation of effectiveness against growth of established subcutaneous tumors dependent on expression levels (data not shown). The predictability of the increasing effectiveness to reject established tumors made it unnecessary to continue to simultaneously evaluate all forms, and the most effective form (3342Max) was exclusively used in all further comparisons. Ultimately, we found that control of B16F10 tumor growth using 3342Max vaccination only worked shortly after tumor challenge, when tumors became palpable. Upon treatment of mice with larger B16F10 tumors of volumes ≥50 mm3, the vaccine was unable to attenuate tumor growth. This was not surprising as immunosuppressive mechanisms likely became more established within the growing tumor, and the single modality vaccination had no means to overcome them (11, 40).

Despite advances in therapeutic vaccines, there now exists numerous studies that support the idea of tumor-derived immunosuppression contributing to tumor evasion (41). These mechanisms include the secretion of TGF-β or IL-10 leading to Th2 polarization (4244) or production of IDO by myeloid cells to induce the generation of Tregs and T cell anergy (45, 46). The novel mechanisms by which STAT3 causes immunosuppression are just beginning to be unraveled (14, 15, 47), and with its other roles in tumor progression, has become a multi-faceted target that could potentially attenuate tumor growth on its own or enhance the anti-tumor effects of any immunotherapy. Disrupting tumor-induced immunosuppression has generally been studied in the context of its effects that are independent of antigen-specific vaccination. Only rarely has the combination of disrupting immunosuppressive mechanisms within tumors been combined with vaccination to limit tumor growth. A more recent study has examined tumor-associated stromal cells expressing fibroblast activation protein-α (FAP) as a source of immunosuppression in a model of pancreatic ductal adenocarcinoma (48). Administration of a therapeutic vaccine in the absence of FAP-expressing stromal cells showed significant increases in hypoxia-induced tumor necrosis when compared to FAP+ mice. Similarly, we have also shown modest additive effects when vaccination is combined with the drug gemcitabine (27), while others reported increased anti-tumor responses by inhibiting the tolerogenic molecule IDO (49). These studies emphasize that successful outcomes of immunotherapy will likely require overcoming tumor-induced immunosuppression.

In several genetic models of conditional STAT3 deletion, subsequent immune-enhancement enabled dramatic inhibitory effects on tumor growth. Mechanism-based studies revealed changes in cytokine profile, T cell subsets, and signal transduction modifiers that all contributed to the blunting of tumor growth as a result of a reduction or elimination of STAT3 expression (14, 34, 35). These elegant studies have lead to preliminary therapeutic strategies employing small molecule inhibitors and RNA interference by a variety of approaches that have in common direct intratumoral administration. These approaches have shown moderate efficacy, but in every case there is tumor breakthrough within 20–25 days post-administration. An alternative strategy has been the approach of tumor-targeting Salmonella delivery of shRNA eukaryotic expression plasmids by i.v. injection. In contrast to our findings, others have found efficacy through intratumoral administration of shSTAT3 alone (18). Nonetheless, the growth attenuation was transient and its translational potential, as an intratumoral therapy, remains in doubt. Although systemic administration of YS1646-shSTAT3 may require more diligent efforts to determine its specific cell targets, this obstacle does not detract from the translational feasibility of the approach for treatment of solid tumors. Our Salmonella approach and work published by others was similar in that the STAT3-specific shRNA sequence only had a single target. In contrast, a CpG DNA chimera with an RNAi sequence that was administered intratumorally had multiple off-target sequences >100 in the mouse genome that temper the interpretation of the results (17).

We show for the first time that an intravenously administered shRNA against STAT3 acts synergistically with an oral Salmonella-based vaccine against SVN in a therapeutic setting, resulting in suppression of subcutaneous B16F10 melanoma growth. We conclude that the in vivo suppression of B16F10 tumor growth is the result of increased tumor cell apoptosis, as determined by Annexin V staining, possibly caused by an increased level of tumor-specific CD8+ T cells within the tumor. We saw no changes in tumor-expressed SVN during the treatments (Supplemental Figure 2) that might explain the increase in apoptosis or eventual escape from control (50). The higher Ki67+ levels also indicated that these intratumoral T cells were actively proliferating, thereby supporting the notion that shRNA against STAT3 attenuated immunosuppression within the tumor microenvironment. Moreover, the fact that neither the vaccine nor shRNA against STAT3 alone was effective to control tumor growth suggests that the combined treatments acted synergistically. These data support that implementing successful immunotherapy may be futile without a receptive tumor microenvironment generated through additional modalities such as shRNA to inhibit immunosuppression.

Supplementary Material

Acknowledgments

Financial Support: This work was supported by 5P01-CA030206-28-Prj3, NIH-RAID Administrative Supplement of 3P01-CA030206-28S2 and ThinkCure Foundation (DJD). A Minority Supplement of 3P01-CA030206-28S3 (EM). COH Cancer Center is supported by 5P30-CA033572-27.

The authors thank D. Castanotto and M. Kortylewski for advice on shRNA and STAT3.

References

1. Altieri DC, Marchisio PC. Survivin apoptosis: an interloper between cell death and cell proliferation in cancer. Lab Invest. 1999;79:1327–1333. [PubMed]
2. Zhou H, Luo Y, Kaplan CD, Kruger JA, Lee SH, Xiang R, Reisfeld RA. A DNA-based cancer vaccine enhances lymphocyte cross talk by engaging the NKG2D receptor. Blood. 2006;107:3251–3257. [PubMed]
3. Altieri DC. Validating survivin as a cancer therapeutic target. Nat Rev Cancer. 2003;3:46–54. [PubMed]
4. Tran J, Rak J, Sheehan C, Saibil SD, LaCasse E, Korneluk RG, Kerbel RS. Marked induction of the IAP family antiapoptotic proteins survivin and XIAP by VEGF in vascular endothelial cells. Biochem Biophys Res Commun. 1999;264:781–788. [PubMed]
5. Yin K, Liu Q, Zhu S, Yan G. Adenovirus-mediated siRNA inhibited survivin gene expression induces tumor cell apoptosis in nude mice. Biosci Trends. 2008;2:231–234. [PubMed]
6. Zhang Y, Chen ZD, Du CJ, Xu G, Luo W. siRNA targeting survivin inhibits growth and induces apoptosis in human renal clear cell carcinoma 786-O cells. Pathol Res Pract. 2009;205:823–827. [PubMed]
7. Ryan BM, O’Donovan N, Duffy MJ. Survivin: a new target for anti-cancer therapy. Cancer Treat Rev. 2009;35:553–562. [PubMed]
8. Xiang R, Luo Y, Niethammer AG, Reisfeld RA. Oral DNA vaccines target the tumor vasculature and microenvironment and suppress tumor growth and metastasis. Immunol Rev. 2008;222:117–128. [PubMed]
9. Xiang R, Mizutani N, Luo Y, Chiodoni C, Zhou H, Mizutani M, Ba Y, Becker JC, Reisfeld RA. A DNA vaccine targeting survivin combines apoptosis with suppression of angiogenesis in lung tumor eradication. Cancer Res. 2005;65:553–561. [PubMed]
10. Norian LA, Rodriguez PC, O’Mara LA, Zabaleta J, Ochoa AC, Cella M, Allen PM. Tumor-infiltrating regulatory dendritic cells inhibit CD8+ T cell function via L-arginine metabolism. Cancer Res. 2009;69:3086–3094. [PMC free article] [PubMed]
11. Polak ME, Borthwick NJ, Jager MJ, Cree IA. Melanoma vaccines: The problems of local immunosuppression. Hum Immunol. 2009;70:331–339. [PubMed]
12. Gajewski TF, Meng Y, Harlin H. Immune suppression in the tumor microenvironment. J Immunother. 2006;29:233–240. [PubMed]
13. Whiteside TL. The tumor microenvironment and its role in promoting tumor growth. Oncogene. 2008;27:5904–5912. [PMC free article] [PubMed]
14. Kortylewski M, Kujawski M, Wang T, Wei S, Zhang S, Pilon-Thomas S, Niu G, Kay H, Mule J, Kerr WG, Jove R, Pardoll D, Yu H. Inhibiting Stat3 signaling in the hematopoietic system elicits multicomponent antitumor immunity. Nat Med. 2005;11:1314–1321. [PubMed]
15. Yu H, Kortylewski M, Pardoll D. Crosstalk between cancer and immune cells: role of STAT3 in the tumour microenvironment. Nat Rev Immunol. 2007;7:41–51. [PubMed]
16. Wang T, Niu G, Kortylewski M, Burdelya L, Shain K, Zhang S, Bhattacharya R, Gabrilovich D, Heller R, Coppola D, Dalton W, Jove R, Pardoll D, Yu H. Regulation of the innate and adaptive immune responses by Stat-3 signaling in tumor cells. Nat Med. 2004;10:48–54. [PubMed]
17. Kortylewski M, Swiderski P, Herrmann A, Wang L, Kowolik C, Kujawski M, Lee H, Scuto A, Liu Y, Yang C, Deng J, Soifer HS, Raubitschek A, Forman S, Rossi JJ, Pardoll DM, Jove R, Yu H. In vivo delivery of siRNA to immune cells by conjugation to a TLR9 agonist enhances antitumor immune responses. Nat Biotechnol. 2009;27:925–932. [PMC free article] [PubMed]
18. Zhang L, Gao L, Zhao L, Guo B, Ji K, Tian Y, Wang J, Yu H, Hu J, Kalvakolanu DV, Kopecko DJ, Zhao X, Xu DQ. Intratumoral delivery and suppression of prostate tumor growth by attenuated Salmonella enterica serovar typhimurium carrying plasmid-based small interfering RNAs. Cancer Res. 2007;67:5859–5864. [PubMed]
19. Chen G, Wei DP, Jia LJ, Tang B, Shu L, Zhang K, Xu Y, Gao J, Huang XF, Jiang WH, Hu QG, Huang Y, Wu Q, Sun ZH, Zhang JF, Hua ZC. Oral delivery of tumor-targeting Salmonella exhibits promising therapeutic efficacy and low toxicity. Cancer Sci. 2009;100:2437–2443. [PubMed]
20. King I, Itterson M, Bermudes D. Tumor-targeted Salmonella typhimurium overexpressing cytosine deaminase: a novel, tumor-selective therapy. Methods Mol Biol. 2009;542:649–659. [PubMed]
21. Xu DQ, Zhang L, Kopecko DJ, Gao L, Shao Y, Guo B, Zhao L. Bacterial delivery of siRNAs: a new approach to solid tumor therapy. Methods Mol Biol. 2009;487:161–187. [PubMed]
22. Haraga A, Ohlson MB, Miller SI. Salmonellae interplay with host cells. Nat Rev Microbiol. 2008;6:53–66. [PubMed]
23. Xiong G, Husseiny MI, Song L, Erdreich-Epstein A, Shackleford GM, Seeger RC, Jackel D, Hensel M, Metelitsa LS. Novel cancer vaccine based on genes of Salmonella pathogenicity island 2. Int J Cancer. 126:2622–2634. [PMC free article] [PubMed]
24. Theys J, Barbe S, Landuyt W, Nuyts S, Van Mellaert L, Wouters B, Anne J, Lambin P. Tumor-specific gene delivery using genetically engineered bacteria. Curr Gene Ther. 2003;3:207–221. [PubMed]
25. Rosenberg SA, Spiess PJ, Kleiner DE. Antitumor effects in mice of the intravenous injection of attenuated Salmonella typhimurium. J Immunother. 2002;25:218–225. [PMC free article] [PubMed]
26. Luo X, Li Z, Lin S, Le T, Ittensohn M, Bermudes D, Runyab JD, Shen SY, Chen J, King IC, Zheng LM. Antitumor effect of VNP20009, an attenuated Salmonella, in murine tumor models. Oncol Res. 2001;12:501–508. [PubMed]
27. Ishizaki H, Manuel ER, Song GY, Srivastava T, Sun S, Diamond DJ, Ellenhorn JD. Modified vaccinia Ankara expressing survivin combined with gemcitabine generates specific antitumor effects in a murine pancreatic carcinoma model. Cancer Immunol Immunother [PMC free article] [PubMed]
28. Baud D, Ponci F, Bobst M, De Grandi P, Nardelli-Haefliger D. Improved efficiency of a Salmonella-based vaccine against human papillomavirus type 16 virus-like particles achieved by using a codon-optimized version of L1. J Virol. 2004;78:12901–12909. [PMC free article] [PubMed]
29. Tsunetsugu-Yokota Y, Ishige M, Murakami M. Oral attenuated Salmonella enterica serovar Typhimurium vaccine expressing codon-optimized HIV type 1 Gag enhanced intestinal immunity in mice. AIDS Res Hum Retroviruses. 2007;23:278–286. [PubMed]
30. Grote A, Hiller K, Scheer M, Munch R, Nortemann B, Hempel DC, Jahn D. JCat: a novel tool to adapt codon usage of a target gene to its potential expression host. Nucleic Acids Res. 2005;33:W526–531. [PMC free article] [PubMed]
31. Dai S, Zhou D. Secretion and function of Salmonella SPI-2 effector SseF require its chaperone, SscB. J Bacteriol. 2004;186:5078–5086. [PMC free article] [PubMed]
32. Deiwick J, Nikolaus T, Erdogan S, Hensel M. Environmental regulation of Salmonella pathogenicity island 2 gene expression. Mol Microbiol. 1999;31:1759–1773. [PubMed]
33. Anderson MJ, Shafer-Weaver K, Greenberg NM, Hurwitz AA. Tolerization of tumor-specific T cells despite efficient initial priming in a primary murine model of prostate cancer. J Immunol. 2007;178:1268–1276. [PubMed]
34. Kortylewski M, Xin H, Kujawski M, Lee H, Liu Y, Harris T, Drake C, Pardoll D, Yu H. Regulation of the IL-23 and IL-12 balance by Stat3 signaling in the tumor microenvironment. Cancer Cell. 2009;15:114–123. [PMC free article] [PubMed]
35. Kortylewski M, Yu H. Role of Stat3 in suppressing anti-tumor immunity. Curr Opin Immunol. 2008;20:228–233. [PMC free article] [PubMed]
36. Clairmont C, Lee KC, Pike J, Ittensohn M, Low KB, Pawelek J, Bermudes D, Brecher SM, Margitich D, Turnier J, Li Z, Luo X, King I, Zheng LM. Biodistribution and genetic stability of the novel antitumor agent VNP20009, a genetically modified strain of Salmonella typhimurium. J Infect Dis. 2000;181:1996–2002. [PubMed]
37. Byrne SN, Halliday GM. High levels of Fas ligand and MHC class II in the absence of CD80 or CD86 expression and a decreased CD4+ T cell Infiltration, enables murine skin tumours to progress. Cancer Immunol Immunother. 2003;52:396–402. [PubMed]
38. Evans DT, Chen LM, Gillis J, Lin KC, Harty B, Mazzara GP, Donis RO, Mansfield KG, Lifson JD, Desrosiers RC, Galan JE, Johnson RP. Mucosal priming of simian immunodeficiency virus-specific cytotoxic T-lymphocyte responses in rhesus macaques by the Salmonella type III secretion antigen delivery system. J Virol. 2003;77:2400–2409. [PMC free article] [PubMed]
39. Catic A, Dietrich G, Gentschev I, Goebel W, Kaufmann SH, Hess J. Introduction of protein or DNA delivered via recombinant Salmonella typhimurium into the major histocompatibility complex class I presentation pathway of macrophages. Microbes Infect. 1999;1:113–121. [PubMed]
40. Deepak P, Acharya A. Anti-tumor immunity and mechanism of immunosuppression mediated by tumor cells: role of tumor-derived soluble factors and cytokines. Int Rev Immunol. 29:421–458. [PubMed]
41. Rodriguez PC, Zea AH, Ochoa AC. Mechanisms of tumor evasion from the immune response. Cancer Chemother Biol Response Modif. 2003;21:351–364. [PubMed]
42. Frumento G, Rotondo R, Tonetti M, Damonte G, Benatti U, Ferrara GB. Tryptophan-derived catabolites are responsible for inhibition of T and natural killer cell proliferation induced by indoleamine 2,3-dioxygenase. J Exp Med. 2002;196:459–468. [PMC free article] [PubMed]
43. De Vita F, Orditura M, Galizia G, Romano C, Roscigno A, Lieto E, Catalano G. Serum interleukin-10 levels as a prognostic factor in advanced non-small cell lung cancer patients. Chest. 2000;117:365–373. [PubMed]
44. Berghella AM, Pellegrini P, Del Beato T, Adorno D, Casciani CU. IL-10 and sIL-2R serum levels as possible peripheral blood prognostic markers in the passage from adenoma to colorectal cancer. Cancer Biother Radiopharm. 1997;12:265–272. [PubMed]
45. Hwu P, Du MX, Lapointe R, Do M, Taylor MW, Young HA. Indoleamine 2,3-dioxygenase production by human dendritic cells results in the inhibition of T cell proliferation. J Immunol. 2000;164:3596–3599. [PubMed]
46. Uyttenhove C, Pilotte L, Theate I, Stroobant V, Colau D, Parmentier N, Boon T, Van den Eynde BJ. Evidence for a tumoral immune resistance mechanism based on tryptophan degradation by indoleamine 2,3-dioxygenase. Nat Med. 2003;9:1269–1274. [PubMed]
47. Lee H, Pal SK, Reckamp K, Figlin RA, Yu H. STAT3: A Target to Enhance Antitumor Immune Response. Curr Top Microbiol Immunol [PMC free article] [PubMed]
48. Kraman M, Bambrough PJ, Arnold JN, Roberts EW, Magiera L, Jones JO, Gopinathan A, Tuveson DA, Fearon DT. Suppression of antitumor immunity by stromal cells expressing fibroblast activation protein-alpha. Science. 330:827–830. [PubMed]
49. Zheng X, Koropatnick J, Li M, Zhang X, Ling F, Ren X, Hao X, Sun H, Vladau C, Franek JA, Feng B, Urquhart BL, Zhong R, Freeman DJ, Garcia B, Min WP. Reinstalling antitumor immunity by inhibiting tumor-derived immunosuppressive molecule IDO through RNA interference. J Immunol. 2006;177:5639–5646. [PubMed]
50. Aoki Y, Feldman GM, Tosato G. Inhibition of STAT3 signaling induces apoptosis and decreases survivin expression in primary effusion lymphoma. Blood. 2003;101:1535–1542. [PubMed]