PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
J Neurosci. Author manuscript; available in PMC Oct 6, 2011.
Published in final edited form as:
PMCID: PMC3113725
NIHMSID: NIHMS286463
A requirement for NF-κB in developmental and plasticity-associated synaptogenesis
Matthew C. H. Boersma,1* Erica C. Dresselhaus,2* Lindsay M. De Biase,1 Anca B. Mihalas,2 Dwight E. Bergles,1 and Mollie K. Meffertcorresponding author1,2
1 The Solomon H. Snyder Department of Neuroscience, The Johns Hopkins University School of Medicine, Baltimore, MD 21205, USA
2 Department of Biological Chemistry, The Johns Hopkins University School of Medicine, Baltimore, MD 21205, USA
corresponding authorCorresponding author.
Mollie K. Meffert: mkm/at/jhmi.edu
*These authors contributed equally
Structural plasticity of dendritic spines and synapses is a fundamental mechanism governing neuronal circuits and may form an enduring basis for information storage in the brain. We find that the p65 subunit of the NF-κB transcription factor, which is required for learning and memory, controls excitatory synapse and dendritic spine formation and morphology in murine hippocampal neurons. Endogenous NF-κB activity is elevated by excitatory transmission during periods of rapid spine and synapse development. During in-vitro synaptogenesis, NF-κB enhances dendritic spine and excitatory synapse density and loss of endogenous p65 decreases spine density and spine head volume. Cell-autonomous function of NF-κB within the postsynaptic neuron is sufficient to regulate the formation of both pre- and post-synaptic elements. During synapse development in-vivo, loss of NF-κB similarly reduces spine density and also diminishes the amplitude of synaptic responses. In contrast, after developmental synaptogenesis has plateaued, endogenous NF-κB activity is low and p65-deficiency no longer attenuates basal spine density. Instead, NF-κB in mature neurons is activated by stimuli that induce demand for new synapses, including estrogen and short-term bicuculline, and is essential for upregulating spine density in response to these stimuli. p65 is enriched in dendritic spines making local protein-protein interactions possible; however, the effects of NF-κB on spine density require transcription and the NF-κB-dependent regulation of PSD-95, a critical postsynaptic component. Collectively, our data define a distinct role for NF-κB in imparting transcriptional regulation required for the induction of changes to, but not maintenance of, excitatory synapse and spine density.
6 Keywords: Synaptogenesis, Neural development, Synaptic plasticity, Nuclear factor kappa B, RelA, Structural plasticity
Changes in the strength and connectivity of synapses within neural circuits underlie developmental and experience-dependent plasticity. Structural change at the level of synapses and dendritic spines, the primary postsynaptic sites for excitatory input, can impart endurance to these forms of plasticity(Bonhoeffer and Yuste, 2002; Bhatt et al., 2009). Spine morphology and the formation or retraction of dendritic spines is activity-responsive to potentiating or depressing stimuli, respectively (Matsuzaki et al., 2004; Nagerl et al., 2004; Zhou et al., 2004; Kopec et al., 2007). Recent in vivo work indicates that changes in dendritic spine density outlast experience and may provide a structural basis for long-term information storage(Hofer et al., 2009; Restivo et al., 2009). In addition, diseases associated with developmental disorders of cognitive function, such as autism, trisomy 21 and fragile × syndrome, are characterized by altered dendritic spine density and morphology (Nimchinsky et al., 2002).
Endogenous transcriptional pathways capable of coordinating the essential upregulation of dendritic spine and excitatory synapse density during development and plasticity remain largely uncharacterized. The nuclear factor kappa B (NF-κB) transcription factor family is required for synaptic plasticity and learning in multiple organisms (Freudenthal and Romano, 2000), drosophila (Heckscher et al., 2007); (Meffert et al., 2003; Kaltschmidt et al., 2006; O’Riordan et al., 2006; Ahn et al., 2008) and genes containing NF-κB regulatory elements are selectively enhanced by learning (Levenson et al., 2004; O’Sullivan et al., 2007), further indicating the significance of transcriptional regulation by NF-κB during plasticity. Nonetheless, relatively little is known regarding cellular pathways that could underlie this function of NF-κB.
NF-κB transcription factors function as dimers containing one or more of five mammalian subunits and can be activated by degradation of the inhibitor of NF-κB, IκB. Three NF-κB family members, including p50(Kassed et al., 2002), c-Rel(Levenson et al., 2004; O’Riordan et al., 2006; Ahn et al., 2008), and RelA or p65(Meffert et al., 2003) are implicated in learning and memory. The p65:p50 heterodimer of NF-κB is localized in the cytoplasm and synapses of hippocampal neurons where it can be activated by excitatory stimulation (Kaltschmidt et al., 1993; Suzuki et al., 1997; Wellmann et al., 2001; Meffert et al., 2003). p65-deficient mice lack synaptic NF-κB and demonstrate significant deficits in hippocampal-dependent learning (Meffert et al., 2003).
We now report a requirement for the p65 subunit of NF-κB in regulating dendritic spine and synapse density in hippocampal neurons both during development and in response to stimuli that increase the demand for new synapses in mature neurons. These findings demonstrate a conserved endogenous regulatory pathway employed for both initial spinogenesis and later structural plasticity. Our data also indicate that NF-κB positively regulates dendritic spine head size and the amplitude of synaptic responses. The specialized scaffold protein, post-synaptic density protein-95 (PSD-95) is a critical NF-κB target gene. These findings expand our understanding of NF-κB functions in learning and other forms of adaptive plasticity and reveal a novel pathway driving transcriptional regulation of spine and excitatory synapse density.
The care and use of animals met all guidelines of the local IACUC (JHUSOM).
Expression constructs and lentiviral preparation
Wildtype and mutant human p65 expression constructs were cloned by in-frame insertion into the Clontech C1 vector at the C-terminus of either GFP or mCherry (gift of R. Tsien). The p65ΔTAD construct encodes p65 residues 2 – 442 fused to GFP; the p65 DNA binding domain mutant (p65R33,35A) was made using site-directed mutagenesis of full length p65 by PCR amplification with primers (F-GCAGCGGGGCATGGCCTTCGCCTACAAGTGCGAGG, R-CCTCGCACTTGTAGGCGAAGGCCATGCCCCGCTGC). EBFP2(Ai et al., 2007) followed by an F2A sequence(Szymczak et al., 2004) and an inducible Cre recombinase fused to a mutant estrogen receptor fragment (CreERT2) responding specifically to OHT(Feil et al., 1997) were inserted into a replication-incompetent lentiviral vector to produce EBFP2-F2A-CreERT2 (Fig. S2); the F2A sequence causes the ribosome to skip the formation of a peptide bond producing a 1:1 ratio of EBFP2 and CreERT2. Lentiviral stocks were prepared as previously described(Lois et al., 2002). Cre-IRES-dsRed plasmid was a gift of A. Kolodkin and GFP-PSD-95 was a gift of R. Huganir.
siRNA oligos (Dharmacon) targeting PSD-95 (Elias et al., 2006) used the sense sequence: 5′ TCACGATCATCGCTCAGTATA 3′ or control oligo with every fourth base replaced with adenosine: TCAAGATAATCACTCAGTAAA.
Hippocampal cultures and stimulation
Dissociated hippocampal cultures were prepared from postnatal day 0 (P0) male and female mice as previously described (Meffert et al., 2003)and plated onto poly-L-lysine coated glass-bottomed dishes (MatTek) at a density of 100,000 cell/cm2 (low-density) or 280,000 cell/cm2 (high-density). Cultures were maintained in Neurobasal A medium (Gibco, 10888) with B27 Supplement (Gibco 17504–44). Neurons were transiently transfected with Lipofectamine 2000 according to the manufacturer’s instructions (Invitrogen) 16–48 hours before experimentation. Cultures from RelAF/F mice were infected at a multiplicity of infection (MOI) of 5 – 10 on DIV2 with EBFP2-F2A-CreERT2 expressing lentivirus. CreERT2 was activated by OHT (400 nM, Sigma H6278) addition at DIV5 or as required. This interval ensured that neurons did not experience toxicity due to concomitant viral infection and p65 loss.
To induce demand for new synapses, neurons were incubated for 24 hours with 25 μM bicuculline methobromide (Enzo Life Sciences 550-040-M050) in growth media or 48–72 hours with 0.3–1.7 μM of 17β–estradiol (E2, Sigma Aldrich E4389) in growth media with reduced B27. Neurons were imaged in Tyrodes buffer (in mM: 119 NaCl, 4.5 KCl, 2 CaCl2, 0.5 MgCl2, 25 Glucose, 10 Hepes,.01 Glycine, pH 7.33) with or without bicuculline and E2. NF-κB reporter assays were conducted as previously described (Pomerantz et al., 2002; Meffert et al., 2003) and neurons were stimulated with bicuculline (25, 50 μM), or 17 β–estradiol (0.3, 1.7 μM).
Imaging and quantification
Confocal images of pyramidal neurons (determined by morphology) in 0.4 – 1.0μm Z sections were acquired using a 63x, 1.4NA, oil immersion lens and 0.7× or 4× optical zoom on a LSM5 Pascal system (Carl Zeiss) at 37°C in Tyrodes buffer (as above with the addition of 2 mM EGTA). GFP was excited at 488 nm and emissions collected at 505–530 nm; mCherry was excited at 543 nm and emissions collected above 560 nm. Laser power and gain were adjusted to minimize phototoxicity and avoid saturation. All experiments were from a minimum of three independent cultures, with at least 2 dishes per condition per day and no more than 5 neurons per dish; the experimenter was blinded to conditions during acquisition and analysis.
Z-stacks containing the entire neuron or process of interest were analyzed using Pascal and ImageJ software. Sholl anaylsis from Z-compressed projections began with a circle of 45 μm diameter with subsequent dendritic intersections counted using circles of increasing 30 μm diameter increments. Spines were defined as protrusions 0.4–2.5 μm in length with or without a head. Secondary or tertiary dendritic branch segments were chosen to ensure a uniform population. Spine-associated synapses were defined as bassoon punctae that co-localized in x, y, and z dimensions with a dendritic spine from the transfected neuron. Soma area was measured by tracing the outline of the soma from a Z-compressed stack. Automated analysis of dendritic spine morphology (Imaris 6.3, Bitplane) determined spine head size by measuring a terminal-fitted sphere. A 0.15 μm threshold was used for the lower limit of spine diameter to avoid artifactual measurements.
Neurons expressing Cre recombinase constructs were binned by fluorescent intensity from the associated fluorophore. Neurons infected with EBFP2-F2A-CreERT2 were only included in analysis if a cytoplasmic or nuclear ROI returned a green fluorescence value of 50 or greater. Neurons transfected with Cre-IRES-dsRed were included in the analysis if they had a red fluorescence value greater than 300. Imaging conditions for fluorophores co-expressed with Cre were kept constant to permit comparison of Cre expression levels across experiments.
Analysis of spine density in p65 rescue experiments was only conducted on neurons expressing low (nontoxic) levels of p65 or p65 mutants as monitored by ROI and by lack of concentration in the nucleus relative to the cytoplasm.
Analysis of p65 concentration in dendritic spines was conducted on low expressing neurons with fluorescence intensity determined using region of interest (ROI) measurement in confocal images of the spine head and adjacent dendritic segment. Enrichment was determined using the ratio of GFP (alone or fused to p65) and mCherry fluorescent intensities according to the following equations:
equation M1
equation M2
Reporter Assays
NF-κB-dependent transcription was assayed by transient transfection of an NF-κB luciferase reporter (Igκ2-IFN-LUC) containing two or three copies of the immunoglobulin light chain κB-site, or a mutant reporter with four residues of the NF-κB consensus binding sites mutated as previously described. Co-transfection of the pCSK-lacZ vector, which constitutively expresses b-galactosidase and is not regulated by NF-κB, served to normalize transfection efficiency and extract recovery for each sample in all reporter assays. Each reporter experiment included extracts from cells transfected with pcDNA3 alone as a reference control. Cultures were lysed using 1× lysis buffer (reporter lysis buffer, Promega), and luciferase (Promega) and chemiluminescent β-gal (Roche) reporter assays were conducted 46 hours after transfection and 3 4 h after stimulation according to manufacturer instructions using a plate-reading luminometer (Perkin Elmer). Samples were compared by subtracting the background activity of the reference control, and then normalizing the luciferase activity of each sample to its β-gal activity. When required, fold induction was calculated by dividing normalized stimulated samples by normalized unstimulated samples.
Immunocytochemistry and immunoblotting
Immunoblotting
Primary neuronal cultures were lysed in buffer containing 1% Triton X-100, 0.5% sodium deoxycholic acid, and 0.1% SDS, subjected to Bradford protein assay, and equivalent total protein amounts resolved on SDS-PAGE gels, transferred to PDVF membrane and probed using the following primary antibodies: anti-p65 (Santa Cruz, sc372, 1:4000), anti-PSD-95 (NeuroMab, K28/43, 1:500) anti-IκBα (Santa Cruz, sc374, 1:3000), anti-EIF4E (Cell Signaling, 9742, 1:1000), anti-GFP (NeuroMab, N86/8, 1:500), anti-GAPDH (Calbiochem, CB1001, 1:50,000), anti-β-tubulin (U. Iowa DSHB, E-7, 1:500).
Immunocytochemistry
DIV 16 neurons were fixed with 4% paraformaldehyde with 4% sucrose for 30 minutes, permeabilized with 0.2 % Triton X-100 for 30 min, blocked for 1 hr in 10 % BSA and incubated with primary antibodies: anti-GFP (Molecular Probes, A11120, A11122, 1:500), anti-dsRED (Clontech, 632496, 1:600), anti-Bassoon (Stressgen, VAM-PS003, 1:600), anti-VGAT (Synaptic Systems, 151003, 1:1000). Alexa Fluor 488 and 568 secondary antibodies (Invitrogen, 1:1000), were incubated for 1 hr at room temperature in 10% BSA and mounted with 0.1M n-propyl gallate in 50 % glycerol.
In Vivo Spine Analysis and Electrophysiology
The RelAF/F mouse line was crossed to the SLICK-V line which exhibits sparse neuronal labeling of YFP and CreERT2 from bicistronic Thy1 promoters (Young et al., 2008). Mice were maintained as homozygous for the RelAF/F locus and heterozygous for SLICK-V. OHT (0.25mg) was delivered to mice by subcutaneous injection for five consecutive days starting at P7 or P8. Control mice for spine analysis received vehicle (sunflower seed oil) alone.
Immunofluorescence
At P12, brains were removed and fixed with 4% paraformaldehyde with 4% sucrose in PBS for 4 hours at 4°C. Brains were then cryo-protected in 4% sucrose in PBS at 4°C O/N or until brains sank and then were embedded in Tissue-Tek OCT (Sakura, 4583) and frozen. 40 mm coronal hippocampal cryostat sections were mounted on slides and post-fixed with 4% paraformaldehyde with 4% sucrose for 5 minutes, followed by blocking and overnight incubation at 4°C with chicken anti-GFP antibody (Aves, GFP-1020. Secondary detection was by a goat anti-chicken Alexa Fluor 488 antibody (Invitrogen, A11039, 1:5000) and slides were then mounted with 2.5% DABCO (SIGMA, D2522) in Fluoromount G (Beckman Coulter, 731604). The experimenter was blinded during data analysis.
Electrophysiology
Hippocampal slices were prepared from P11-13 OHT-treated mice as previously described (De Biase et al.). Whole-cell recordings on YFP positive or control hippocampal pyramidal neurons were performed using a 2.5–3.3 MΩ glass electrodes filled with (in mM): 100 CsMeS, 20 tetraethylammonium (TEA) chloride, 20 HEPES, 1 MgCl2, 10 EGTA, 2 sodium ATP, and 0.2 sodium GTP (pH 7.3, 295 mOsm). mEPSC recordings were made without series resistance compensation and were performed in the presence of: TTX (1 μM), gabazine (5 μM), and RS-CPP (NMDA receptor antagonist; 5 μM). Responses were recorded using a MultiClamp 700A amplifier (Molecular Devices), filtered at 3 kHz, digitized at 50 kHz and recorded to disk using pClamp9.2 software (Molecular Devices). Data were analyzed off-line using Clampfit (Molecular Devices), Origin (OriginLab), and Mini analysis (Synaptosoft) software. Input resistance and membrane capacitance were calculated from a 2 mV hyperpolarizing step from a holding potential of −70 mV. The frequency of mEPSC (>5 pA amplitude, <1 ms rise time) was quantified by monitoring activity during continuous recording for at least 8 minutes. The experimenter was blinded during data analysis.
RNA analysis
Total RNA was extracted from murine hippocampi or hippocampal cultures throughout development using Tri-Reagent (Molecular Research Center, Inc.). RNase Protection Assay was performed with 5 ug RNA using a custom Riboquant MultiProbe set (Pharmingen) according to the manufacturers instructions. For qRT-PCR, RNA was reverse transcribed with oligo(dT) primers into cDNA and subjected to analysis with TaqMan (Applied Biosystems) probes for IL-6 and GAPDH using a Stratagene Mx3000P. Each sample was analyzed in triplicate and normalized to its GAPDH control; 2 or more mice were used for each developmental time point.
Statistical and Bioinformatics Analysis
Neuron dishes were randomly assigned to treatment conditions and the experimenter was blinded during data acquisition and analysis. Graphs illustrate the arithmetic mean and error bars are standard error of the mean. For statistical analyses, two-tailed T-tests were used (paired or unpaired) with α = 0.05, unless otherwise noted. Data for spine density is not normally distributed (Fmax test), therefore analyses were conducted with correction for unequal variance. To maintain an αexperimentwise = 0.05 with multiple pairwise comparisons for spine density experiments, α = 0.01 was set for each T-test. The α level was calculated by equation M3, where c is the number of pairwise comparisons. Statistical significance for mEPSC amplitudes was determined using the Kolmogorov-Smirnov (KS) test.
Putative consensus NF-κB binding sites in the promoter region of Dlg4 were determined using TESS: Transcriptional Element Search System (http://www.cbil.upenn.edu/tess/) and analyzed for conservation between Mus musculus, Rattus norvegicus, and Homo sapiens.
NF-κB regulates dendritic spine and excitatory synapse number
The potential for NF-κB-dependent regulation of dendritic spines and synapses in the mammalian brain was initially evaluated by testing the effect of exogenous p65 expression in hippocampal neurons. Enhanced green fluorescent protein (GFP) tagged p65 (GFPp65) or GFP was expressed in low-density hippocampal cultures at 16 days in vitro (DIV16) for 24 hours prior to immunostaining for GFP and the presynaptic marker bassoon, and confocal imaging of dendritic spines and synapses. Expression of exogenous p65, and GFPp65 activates NF-κB and induces NF-κB-dependent gene expression ((Meffert et al., 2003) and Fig. 5A), presumably by overwhelming endogenous production of the inhibitor of NF-κB, IκB. GFPp65 expression in pyramidal neurons increased the density of dendritic spines by 46 % in comparison to GFP (GFPp65: 4.1 ± 0.15 spines/10 μm, n = 95 dendrites; GFP: 2.8 ± 0.09, n = 183 dendrites; P = 1.3 × 10−11). Spine-associated synapses, which are predominantly glutamatergic and excitatory, were increased 106 % by GFPp65 expression in comparison to GFP (GFPp65: 3.3 ± 0.21 synapses/10 μm; GFP: 1.6 ± 0.16; P = 1.8 × 10−9) (Fig. 1A,C). While p65 expression increased both spine and excitatory synapse density, the proportionally larger increase in synapses was accounted for by an increase in the average number of presynaptic punctae on spines participating in synapses (GFPp65: 1.32 punctae/spine; GFP: 1.17 punctae/spine; P = .001) as well as an increase in the percentage of dendritic spines opposed by presynaptic punctae (GFP: 49.1 % ± 3.7; GFPp65: 66.1 ± 2.6, P = 6.8 × 10−5).
Figure 5
Figure 5
Requirement for NF-κB-dependent gene expression
Figure 1
Figure 1
Exogenous expression of NF-κB increases spine and excitatory synapse density. (A,B) Confocal projections of dendrites and dendritic spines from DIV 16 murine hippocampal pyramidal neurons plated at low-density and immunostained for GFP and either (more ...)
In contrast to the marked effects on dendritic spines and associated excitatory synapses, p65 did not regulate inhibitory synapse density. Quantification of inhibitory synapse number by immunostaining for the vesicular γ-aminobutyric acid (GABA) transporter (VGAT) revealed no significant differences in hippocampal pyramidal neurons expressing either GFP or GFPp65 (Fig. 1B,C).
Endogeous NF-κB regulates dendritic spine development
To determine whether NF-κB was required at endogenous levels for regulating dendritic spine and synapse growth we used a previously characterized mouse strain carrying a loss of function allele of the RelA gene (encoding p65) in which exons 7 – 10 are flanked by loxP sites (Geisler et al., 2007) (RelAF/F). Effective recombination at the RelA site was achieved by infecting hippocampal cultures with lentivirus encoding 4-hydroxy tamoxifen (OHT)-inducible Cre recombinase (CreERT2) coupled to the expression of equivalent levels of enhanced blue fluorescent protein 2 (EBFP2(Ai et al., 2007)) by a picornavirus-derived F2A sequence (Szymczak et al., 2004)(Figure S1, 2A). Increasing titers of viral infection resulted in dose-dependent loss of p65 protein in the presence, but not in the absence, of OHT (Fig. 2A). CreERT2-mediated loss of endogenous p65 significantly diminished the induction of NF-κB-dependent gene expression in hippocampal cultures stimulated with bicuculline (50 μM) to enhance excitatory activity; NF-κB reporter activity in stimulated cultures lacking p65 was not significantly different from unstimulated p65-deficient conditions (Fig. 2B, n = 4, P = 0.707).
Figure 2
Figure 2
Endogenous NF-κB regulates spine density and morphology during spinogenesis. (A) Dose-dependent excision of p65 by CreERT2 in the presence of OHT. The indicated μl of lentivirus coexpressing CreERT2 and EBFP2 was added to DIV 9 cultured (more ...)
NF-κB transcription factors regulate aspects of cell growth and proliferation in many tissues. To examine potential roles for NF-κB in growth and metabolism of hippocampal neurons, the effect of p65-deficiency on cell soma size and dendrite arbor complexity was evaluated at distinct time points that span the early stages of rapid dendritic spine and synapse formation, concluding with relatively mature neurons in which changes in spine and synapse density have stabilized. Cultures were infected at DIV 2 with CreERT2 lentivirus, treated ± OHT at DIV 5, and transfected with mCherry fluorophore for morphological visualization 24 hours prior to confocal imaging. Loss of p65 did not significantly affect cell soma size or dendrite complexity of pyramidal neurons at any tested culture DIV (Fig. 2C,D). In contrast, analysis of dendritic spine density showed significantly fewer spines in neurons lacking p65 at all tested time points until ≥ DIV 19 (Fig. 2E,F)(DIV 12: n = 68(−OHT), 38 (+OHT), P = 7.3 × 10−4; DIV 14: n = 82(−OHT), 82 (+OHT), P = 2.0 × 10−5; DIV 16: n = 67(−OHT), 44 (+OHT), P = .006). While spine density did increase during DIV 12 – DIV 19 in p65-deficient neurons, it lagged behind the spine density of p65 wild type neurons with ~ 32 % fewer spines/10μm at DIV 14 and DIV 16 (Fig. 2E).
The possibility that the lack of p65 effect on spine density in older cultures could be due to a longer period available for compensation was evaluated by comparison of spine density in cultures made p65-deficient at either early or late time points. Cultures made p65-deficient by OHT addition at either DIV 5 – 8 (early) or DIV 13 – 16 (late) time points showed no difference in spine density, compared to p65 wild-type controls, when evaluated at DIV19-20 (Fig. 2G); this finding further supports differential regulation of basal spine density by p65 during neuronal maturation.
Dendritic spine regulation is cell-autonomous
Lentiviral infection was highly efficient and achieved Cre recombinase expression in ≥ 95 % of cultured hippocampal cells. To determine whether the effects of p65-deficiency on dendritic spine density were cell autonomous or, alternatively, due to potential effects on either the network activity of cultures or loss of p65 in glial cells, isolated neurons in cultures from RelAF/F mice were made p65-deficient by transient transfection. Cultures were co-transfected with GFP and either mCherry or constitutively active Cre recombinase co-expressing the dsRed fluorophore (Cre-IRES-dsRed) and were analyzed for spine density 48 hours later. Transient transfection achieved expression in 1 – 2 % of cells and readily permitted analysis of single isolated neurons. This duration of Cre expression was sufficient to cause a loss of NF-κB dependent gene expression as monitored by luciferase assay (data not shown). The loss of dendritic spines generated by p65-deficiency in either a population (lentiviral) or individual cell (transfection) was not significantly different (Fig. 2H, 30.7 ± 7.5; 34.0 ± 4.5 % loss of spines, respectively). This indicates that cell-autonomous actions in the postsynaptic neuron can mediate p65-dependent regulation of dendritic spine density.
NF-κB deficiency decreases dendritic spine head size
The size of dendritic spines at glutamatergic synapses is highly variable with a robust positive correlation between spine size and both receptor content and excitatory synapse strength (Bonhoeffer and Yuste, 2002; Holtmaat and Svoboda, 2009). A comparison of spine morphology in control or p65-deficient (OHT) DIV16 pyramidal neurons revealed that NF-κB modestly shortens dendritic protrusion length (spines and filopodia, Fig. 2I) while enhancing the diameter and volume of dendritic spine heads (Fig. 2J, K). Loss of p65 decreased average spine head volume by 33.9 % (Fig. 2K; Control (− OHT): 0.081± 0.0028 μm3, n= 1133; p65-deficient (OHT): .0537 ± 0.0034, n = 516, P = 4.7 × 10−10). There was a left shift in the cumulative distribution of spine head diameter (Fig. 2J), indicating that all classes of dendritic spines in p65-deficient pyramidal neurons have smaller head diameters. Collectively these data show that loss of NF-κB function leads to a decrease in dendritic spine density while the remaining spines are longer in length and have diminished spine head size. These effects are consistent with weakened excitatory synaptic connectivity and fewer mature dendritic spines in the absence of p65.
NF-κB regulates dendritic spine density and mEPSC amplitude in vivo
In order to examine the role of NF-κB in vivo, we generated a conditional transgenic line by crossing RelAF/F mice with the SLICK-V line that expresses YFP and CreERT2 from bicistronic Thy1 promoters in a subset neurons (~ 5 % by positional variagation) of hippocampal pyramidal neurons (Young et al., 2008). Recombination could then be induced in vivo by treating animals with OHT (Figure S2). This allowed morphology of individual neurons to be distinguished and for individual neurons to be manipulated in a wildtype background.
Endogenous NF-κB regulates spine density in the hippocampus during periods of rapid synapse formation. The time course of synaptogenesis in our cultures resembled the rate and duration of synaptogenesis in vivo as has been previously described (Steward and Falk, 1991). RelAF/F × SLICK-V pups were treated with OHT or vehicle several days prior to spine analysis at post-natal day 12 (P12) and successful recombination verified by PCR assay (Figure S2). Consistent with our in vitro studies, loss of p65 in hippocampal pyramidal neurons significantly reduced spine density by 32.8% in vivo (Control: 11.6 ± 0.39 spines/10mm, n = 35 dendrites; OHT: 7.8 ± 0.33, n = 36) (Figure 3A, B). This experiment indicates that NF-κB regulates spine density during a period of rapid synaptogenesis in vivo as well as in a culture system.
Figure 3
Figure 3
Endogenous NF-κB regulates spine formation and mEPSC amplitude during synaptogenesis in vivo (A) Representative confocal projections of dendrites from YFP/CreERT2 expressing pyramidal neurons from hippocampal sections of RelAF/F × SLICK-V (more ...)
To directly test if the structural changes in spine density and morphology correlate with reduced synaptic function, we performed whole-cell voltage clamp recordings from hippocampal pyramidal neurons in acute brain slices from OHT-treated RelAF/F × SLICK-V mice during a developmental period of active hippocampal synaptogenesis. Miniature excitatory post-synaptic current (mEPSC) recordings in the presence of TTX, gabazine (GABA receptor antagonist), and RS-CPP (NMDA receptor antagonist) were made from SLICK-V YFP/CreERT2 positive neurons (p65-deficient; n = 15) and YFP/CreERT2 negative neurons (p65-wildtype; n = 12) within the same brains. The amplitude of mEPSCs recorded from YFP/CreERT2 positive neurons was significantly reduced compared to the amplitude of mEPSCs from YFP/CreERT2 negative neurons (P = 3.7 × 10−17) (Figure 3C – E), indicating that endogenous NF-κB positively regulates AMPA receptor responses. The observed enhancement of synaptic function is consistent with our data that NF-κB positively regulates spine head volume (Figure 2K).
Given that a decrease in spine density was observed in OHT-treated YFP/CreERT2 positive neurons, a reduction in the frequency of mEPSCs might also be anticipated. Recorded YFP/CreERT2 positive neurons demonstrated a trend toward reduced mEPSC frequency, but these results did not reach significance. One potential explanation for this finding lies in the pronounced cell to cell variability of mEPSC frequency in acute brain slices at this developmental age. Indeed, the coefficient of variation for mEPSC frequency within control (YFP/CreERT2 negative) neurons (CV = 0.90) far exceeds that for mEPSC amplitude (CV = 0.31), indicating that experimental sensitivity for changes in amplitude is much greater.
Basal NF-κB activity is highest before and during rapid synapse development
Under our culture conditions, the rate of new spine formation was greatest prior to DIV 17 and increases in spine density began to plateau after DIV 18. To determine whether and how endogenous NF-κB activity changed throughout spine and synapse development, we assayed the activity of an NF-κB responsive reporter, Igκ2-IFN-LUC, during culture maturation at DIV 3, 5, 7, 10, 16, and 20 (Fig. 4A). Specificity for NF-κB was demonstrated with a reporter containing mutant κB sites (mtκB) which did not undergo significant change in activity during culture maturation. Basal NF-κB-dependent reporter activity was lowest at DIV 20 and reporter values for all other days were normalized to the DIV 20 value (set as one) for comparison. During the period of rapid new spine and synapse formation, DIV 7, 10, and 16, NF-κB activity was 8.2, 4.6, and 4.9 times higher, respectively, than at DIV 20 (n = 3 independent culture timecourses each with 3 wells per condition, P = 0.018, 0.006 and 0.047, respectively). Interestingly, relative NF-κB activity was highest at DIV 5, prior to the detection of visible dendritic spines in the period leading up to rapid synaptic development. Immunoblot of whole cell lysates demonstrated no significant change in either p65 or IκBα protein content during culture development (Fig. 4B), indicating that the developmental changes in NF-κB-dependent gene expression likely result from increased posttranslational activation of the transcription factor. As IκBα is a gene target of NF-κB, activated NF-κB regenerates steady-state levels of the IκB inhibitor over time.
Figure 4
Figure 4
Response to increased synaptic demand in mature neurons requires NF-κB. (A) NF-κB activation was monitored by luciferase assay at time points in culture maturation preceeding (DIV 3, 5), during (DIV 7, 10, 16) and at the conclusion of (more ...)
Excitatory neurotransmission is a major NF-κB-activating stimulus in healthy brain, however, the elevated NF-κB levels at DIV 3 and DIV 5 occur prior to robust excitatory synapse formation. Inhibiting excitatory glutamatergic transmission decreasd NF-κB activation at DIV 16 but not at DIV 5 (Figure 4C). These results show that NF-κB activity is elevated during synaptogenesis (at DIV 16) by excitatory neurotransmission.
Increased synaptic demand re-instates the requirement for NF-κB
Loss of NF-κB function during the period of rapid dendritic spine and synapse development significantly attenuated basal dendritic spine density (DIV 12 – 16, Fig. 2E,F), while no effect was observed in mature cultures when dendritic spine density had largely plateaued (Fig. 2F,G, −OHT: n = 102, OHT: n = 65). Under conditions of plasticity, such as during learning, mature neurons can significantly increase the number of dendritic spines and excitatory synapses from basal levels. To test whether increasing the demand for new synapses might re-instate a requirement for NF-κB in mature neurons, DIV 20 cultures were exposed to low-dose bicuculline (25 μM, 24 hr.s, −OHT: n = 163, OHT: n = 32) or 17β–estradiol (E2, 0.3 μM, 48 – 72 hr.s, −OHT: n = 33, OHT: n = 32). Short-term bicuculline exposure(Papa and Segal, 1996) and E2 (Murphy and Segal, 1996; Liu et al., 2008) have both been previously characterized to enhance dendritic spine and synapse numbers in hippocampal neurons. Increased demand for new synapses by exposure to either E2 or bicuculline resulted in robust increases in dendritic spine density in DIV 20 pyramidal neurons (Fig. 4D,S3), similar in magnitude to spine density increases observed during experience-dependent plasticity in adult mammals(Holtmaat and Svoboda, 2009). Increases in spine density caused by E2 and bicuculline were both entirely absent in p65-deficient neurons (Fig. 4D,S3). These results indicate that the observed structural plasticity of dendritic spines in response to both E2 and bicuculline requires NF-κB.
Under unstimulated conditions, the lack of effect of p65 loss on dendritic spine density at DIV 19 – 21 correlated with the reduced basal NF-κB-dependent transcriptional activity in mature cultures relative to cultures during the active period of spinogenesis (Fig. 4A, 2E,F). To investigate the possibility that the NF-κB-requirement for stimulated increases in dendritic spine density in mature cultures might reflect E2 and bicuculline-induced NF-κB activation, time and dose-dependent NF-κB reporter assays were conducted. Long-term E2 exposure (36 hrs) at both high and low doses (0.3, 1.7 μM) robustly activated NF-κB-dependent gene expression, while short term E2 exposure at either dose was relatively ineffective (Fig. 4E). Interestingly, E2-mediated increases in spine density are also apparent only after several days of E2 treatment (Murphy and Segal, 1996) (48 – 72 hrs, Fig. 4D,S3). Failure of E2 to activate the mtκB-reporter after either long or short-term treatment demonstrates specificity for NF-κB (Fig. 4E); given the required E2 treatment duration, the activation pathway is likely indirect. In agreement with previously published findings, bicuculline robustly activated NF-κB after short-term exposure(Meffert et al., 2003) (Fig. 2B, ,4E).4E). Long-term treatment with low-dose bicuculline (25 μM) generated weaker, but significant, activation of NF-κB-dependent transcription (Fig. 4E); long-term treatment with high dose bicuculline (50 μM) was toxic in preliminary experiments. Importantly, induction of NF-κB activity by either E2 or bicuculline depended upon the presence of the p65 NF-κB subunit (Fig. 4F, ,2B2B)
NF-κB effects on spine density require transcription
Loss of p65 in mature neurons when NF-κB activation was low (DIV 19–21) did not alter basal dendritic spine and synapse number, in contrast to the effects of p65-deficiency at earlier time points when NF-κB transcriptional activity was higher. This suggests that NF-κB-dependent gene expression could regulate dendritic spines and synapses, however, in addition to controlling transcription in the nucleus, NF-κB transcription factors are also present at synapses and could potentially function by local protein – protein interactions (Kaltschmidt et al., 1993; Suzuki et al., 1997; Meffert et al., 2003). A non-transcriptional mechanism of action has been suggested for drosophila NF-κB at the neuromuscular junction (Heckscher et al., 2007). To test whether NF-κB might regulate dendritic spine density alternatively through either transcription or through local protein – protein interactions, two transcriptionally inactive mutants of p65 were designed. Carboxy-terminal truncation deleted the two transactivation domains of p65 to make GFPp65ΔTAD; loss of the transactivation domains has been previously characterized to eliminate transcriptional activity(Schmitz and Baeuerle, 1991; Schmitz et al., 1995). The crystal structures of the p65:p50 and p65:p65 dimers bound to DNA(Chen et al., 1998a; Chen et al., 1998b) were used to design a DNA-binding domain mutant in which two DNA-contacting amino-terminal residues of p65 were changed to alanines (GFPp65R33,35A). As anticipated, expression of GFPp65, but not GFPp65ΔTAD or GFPp65R33,35A, in HEK 293T cells resulted in a dose-dependent NF-κB activation (Figure 5A). At the highest tested doses, none of the p65 constructs activated a reporter with mutant consensus NF-κB binding sites (mκB-lucif, Figure 5A).
Live confocal imaging and quantitation revealed that tagged p65 (GFPp65: n = 206, GFP: n = 158, P = 8.8 × 10−52) (mCherryp65: n = 101, mCherry: n = 137; P = 1.1 × 10−22) is not only present but is significantly enriched in the dendritic spines of hippocampal pyramidal neurons (Fig. 5B,C, see methods). GFPp65 was enriched in spines relative to dendritic shafts by 42 ± 2.2 % in comparison to non-tagged GFP. p65 tagged with an alternative fluorophore, mCherry (mCherryp65) was similarly, but slightly less, enriched in dendritic spines relative to non-tagged mCherry (Figure 5B,C). To test that mutations with loss of transcriptional activity did not inadvertently affect spine localization, the percent enrichment in dendritic spines of the p65 mutants was quantitated and found not significantly different from GFPp65 (Figure 5B,C) (GFPp65R33,35A: 43.9 ± 7.5 %, n = 88 spines, P = 0.811; and GFPp65ΔTAD: 40.8 ± 4.9 %, n = 147, P = 0.813). Transfections were titrated to express equivalent amounts of each p65 variant. These findings indicated that the two structurally distinct transcriptionally inactive mutants of p65 could be used to test whether NF-κB might control dendritic spines through local actions or by transcriptional regulation.
Cultured hippocampal pyramidal neurons from RelAF/F mice were made p65-deficient by transient transfection of Cre-IRES-dsRed in combination with low levels of GFP, GFPp65, GFPp65R33,35A, or GFPp65ΔTAD, and spine density at DIV 16 was compared to pyramidal neurons co-expressing mCherry and GFP. Loss of endogenous p65 produced a deficiency in dendritic spine density that was rescued only by co-expression of transcriptionally active p65 (Fig. 5D; mCherry alone: 4.5 ± 0.28 spines/10 μm, n = 27 dendrites; GFPp65 + Cre: 4.6 ± 0.24, n = 26 dendrites). Spine densities in cells expressing Cre with either GFPp65R33,35A or GFPp65ΔTAD were not significantly different from the densities in cells expressing Cre alone. Low levels of expression and the use of high-density cultures prevented GFPp65 from substantially increasing spine density above controls. These results indicate that transcriptional activity is required for the function of p65 in regulating spine density.
PSD-95 is a critical transcriptional target of NF-κB
To begin to identify critical NF-κB targets in excitatory synaptogenesis, we considered the regulation of genes previously known to be important in this process. The gene for postsynaptic density-95 (PSD-95) was initially identified as a potential NF-κB target in unpublished results of a microarray-based screen using nfκb1−/−rela−/− doubly-deficient murine embryonic fibroblast cell lines(Hoffmann et al., 2003). Analysis of the 5′ upstream region of mouse Dlg4 (encoding PSD-95, see methods) reveals multiple potential κB sites, including 2 conserved tandem consensus κB-sites at 213 bp and 350 bp (just outside the predicted transcriptional start site) upstream of the ATG, respectively. The effect of p65-deficiency on PSD-95 protein levels was evaluated in lysates of cultured mouse hippocampal neurons during (DIV 16) and after (DIV 21) the most active period of synaptogenesis (Fig. 6A). Loss of p65 significantly decreased PSD-95 protein levels at DIV 16 (n = 3 independent cultures with 2 wells per condition, P = 0.005) when basal NF-κB is active, and insignificantly decreased PSD-95 protein in mature neurons (DIV 21) when basal NF-κB activity is low. The effects of p65-deficiency on levels of PSD-95 mRNA was assessed using ribonuclease protection assays. Consistent with results for PSD-95 protein, mRNA levels for PSD-95 were significantly decreased by p65-deficiency during periods of elevated basal NF-κB activity (DIV 14, Fig. 6B), but not in mature neurons when basal NF-κB activity is relatively low (DIV 21, Fig. 6C). Enhancing excitatory synaptic activity (bicuculline, 50 μM) in mature neurons activates NF-κB and p65-dependent transcription of PSD-95 mRNA (DIV 21, Fig. 6C).
Figure 6
Figure 6
NF-κB dependent increase in spine density involves the novel gene target, PSD-95. (A) p65-deficient neurons have significantly decreased levels of PSD-95 at DIV16 (P = 0.005), but not at DIV 21 (P = 0.09). Representative immunoblot (left) and (more ...)
PSD-95 promotes dendritic spine and excitatory postsynaptic formation and can modulate and recruit presynaptic components (El-Husseini et al., 2000; Futai et al., 2007). The coordination of both pre and post-synaptic development by NF-κB (Fig. 1), as well as the pattern of NF-κB-dependent expression (Fig. 6A–C), are consistent with PSD-95 as an endogenous gene target for the regulation of spine and excitatory synapse formation by p65. To test a requirement for PSD-95 in mediating the effects of NF-κB, experiments to rescue loss of p65 were performed in the presence or absence of PSD-95 knockdown. Cre recombinase was co-transfected in DIV 16 neurons with small interfering RNA (siRNA) oligos for PSD-95 (Elias et al., 2006) or control mutant RNA oligos in the presence or absence of co-transfected p65. siRNA against PSD-95 successfully knocked-down co-transfected GFP-PSD-95 (Fig. S4). Loss of endogenous p65 by Cre transfection reduced spine density (Fig. 6D) comparably to levels observed in the rescue experiments of Figure 5D. In the presence of the mutant RNA oligos, expression of p65 produced a robust rescue of dendritic spine density. In contrast, expression of p65 was unable to rescue dendritic spine density when elevations of endogenous PSD-95 were prevented by siRNA targeting PSD-95 (Figure 6D). PSD-95 knockdown did not further reduce dendritic spine number below that seen with loss of p65 alone (Figure 6D, Cre + mutsiPSD95 compared to Cre + siPSD-95). These results indicate that PSD-95 is regulated by NF-κB in a developmental and activity-dependent manner and that PSD-95 is required for the transcriptionally-mediated enhancement of dendritic spine density by NF-κB.
Despite the characterization of many molecules involved in the development, function, and plasticity of excitatory synapses, a striking deficit remains in knowledge of the endogenous mechanisms controlling the coordinated expression of these molecules. Few transcription factors have been implicated in dendritic spine and excitatory synapse formation and the relationship between pathways regulating initial synapse development and adult synaptic plasticity is also unclear. This study demonstrates that a subunit of the NF-κB transcription factor, p65, regulates dendritic spine morphology and spine and excitatory synapse density both during developmental synaptogenesis and during increased demand for new synapses in mature neurons.
NF-κB activity is highly regulated during development with activity peaking before and during rapid synaptogenesis and dropping to low levels in mature neurons. Developmental changes in NF-κB activity do not appear to result from changes in the expression of NF-κB components, and are instead attributed to the post-translational activation pathway characteristic of this transcription factor. During developmental synaptogenesis, NF-κB activation can be blocked by the acute inhibition of glutamate receptors, indicating a dependence on excitatory neurotransmission.
In mature neurons, basal NF-κB activity is low and loss of p65 no longer attenuates basal spine density. Instead, stimuli such as estrogen and short-term bicuculline that induce demand for new synapses, both activate NF-κB and require NF-κB in order to upregulate spine density in mature neurons. Collectively, this data reveals that NF-κB may fulfill a unique function in the regulation of excitatory synapse number and function. Other transcription factors, such as Cux1 and Cux2, have been reported to regulate the basal density of spine and excitatory synapses in the mature nervous system (Cubelos et al.). In contrast, NF-κB does not appear to affect the maintenance of basal spine density in mature neurons and is instead specifically required for stimulus-induced upregulation of dendritic spine density during this period. This role is consistent with the requirement for NF-κB in behavioral learning paradigms and in vitro assays of plasticity, as well as the absence of reported brain structural defects in mice lacking subunits of the NF-κB transcription factor.
Structural plasticity of dendritic spines and synapses is increasingly appreciated as a candidate for an enduring memory trace or engram (Hubener and Bonhoeffer). The magnitude of changes in spine density induced by p65-deficiency, near 30 % loss both in vitro and in vivo, closely approximates structural plasticity associated with both learning and regulation by estrogen. Neurons from control animals have been reported to have between 10 – 40 % fewer spines than neurons from animals undergoing learning paradigms or estrogen exposure (Gould et al., 1990; Moser et al., 1994; Restivo et al., 2009). Structural plasticity also encompasses changes in dendritic spine morphology, where spine head size is highly responsive to activity. In p65-deficient neurons, we observe a reduction in spine head volume as well as reduced mEPSC amplitudes carried by AMPA receptors. These findings are consistent with previous reports that larger spine heads and larger synapses correlate with increased numbers of AMPA receptors and increased AMPA receptor-mediated currents (Nusser et al., 1998; Matsuzaki et al., 2001). NF-κB specifically regulates the density of excitatory, but not inhibitory, synapses and influences spine head volume and, to a lesser extent, spine length (Figures 1,,22).
Remarkably, the p65 subunit of NF-κB is enriched in the dendritic spines whose structural plasticity it regulates. Our data clearly demonstrate, however, that p65-mediated regulation of spine density absolutely depends on the ability of p65 to bind DNA and activate transcription of target genes rather than being mediated by local protein-protein interactions. Point mutation of the DNA-binding domain of p65 as well as deletion of the transactivation domain both eliminate NF-κB transcriptional activity and regulation of dendritic spines, while leaving spine enrichment unaffected. The importance of spine enrichment for initial NF-κB activation or other cellular functions is not precluded by these data. In fact, other studies indicate that NF-κB can be activated locally at the synapse and that retrograde motor transport can mediate NF-κB-dependent gene expression in response to synaptic stimulation (Wellmann et al., 2001; Meffert et al., 2003; Mikenberg et al., 2007; Shrum et al., 2009). The p65 subunit thus appears to be both localized in spines and able to provide feedback to control spine density and morphology and the recruitment of presynaptic elements in a cell autonomous manner.
Other subunits of mammalian NF-κB, including p50 and c-Rel, have also been implicated in synaptic plasticity and may have additional uncharacterized mechanisms in the regulation of synapse structure and function. A role for the drosophila homologs of NF-κB and IκB, Dorsal and Cactus, in regulating postsynaptic glutamate receptor clustering at the neuromuscular junction has been reported (Heckscher et al., 2007). Another component of the NF-κB pathway, the IκB-kinase (IKK) was recently reported to alter spine number in medium spiny neurons of the nucleus accumbens in a cocaine reward model (Russo et al., 2009). IKK can activate NF-κB as well as carry out NF-κB-independent functions, including chromatin remodeling (Perkins, 2007). While a requirement for IKK-induced chromatin remodeling during plasticity has been demonstrated (Lubin and Sweatt, 2007), downstream NF-κB activation by this kinase could also regulate nucleus accumbens plasticity in response to cocaine. Additional studies will be required to evaluate a generalized role of NF-κB in promoting dendritic spine and excitatory synapse formation in brain regions outside of the hippocampus.
We identify PSD-95 as a transcriptional target that is critical for NF-κB enhancement of dendritic spine density and is regulated in a p65-dependent manner both during neuronal development and in response to synaptic activity in mature neurons (Figure 6). PSD-95 is a key component of the postsynaptic density with an ability to organize both post- and presynaptic machinery (El-Husseini et al., 2000; Futai et al., 2007; de Wit et al., 2009) that might permit postsynaptic NF-κB activation to recruit excitatory presynaptic components as observed in our data (Figure 1). Through its many binding partners, PSD-95 also influences glutamate receptor trafficking and synaptic strength (Fitzjohn et al., 2006), making it a highly relevant target. PSD-95 is reported to regulate spine and synapse density during periods of rapid synaptogenesis (El-Husseini et al., 2000; Ehrlich et al., 2007), but not after synaptogenesis has plateaued (Elias et al., 2006). These studies phenocopy NF-κB manipulations and further support a functional link between NF-κB and PSD-95. Nonetheless, it is likely that complex functions, such as regulating synaptic networks, will be achieved by the coordinated control of multiple gene targets. NF-κB-dependent genes remain incompletely characterized within the mammalian CNS, but several reported target genes that could act in concert with PSD-95 are: GluR1, BDNF, NGF, nNOS, and several adhesion molecules (e.g. NCAM, P-selectin and ephrin-A1) (Deregowski et al., 2002; Shrum and Meffert, 2008). The regulation of diffusible targets such as nitric oxide and neurotrophins could be speculated to contribute to the capacity of postsynaptic NF-κB manipulations to influence presynaptic elements.
Given the fundamental role of dendritic spines and associated synapses in information acquisition and retention, understanding the mechanisms responsible for their transcriptional regulation could provide insights to control points during development and learning and potential sources of synaptic pathology in disorders such as Alzheimer’s and Parkinson’s disease where NF-κB activation is dysregulated (Mattson and Meffert, 2006). The data presented here demonstrate a conserved pathway requiring the p65 subunit of NF-κB to coordinately regulate excitatory synapse formation both during initial synaptogenesis and in mature neurons in response to increased demand for new synapses. This underscores the capacity of neurons to employ the same downstream pathway in the context of both developmental and mature stimulus-dependent upregulation of excitatory synapses. These findings also present a novel pathway regulating PSD-95 expression to mediate structural plasticity of dendritic spines and highlight transcription factor-specific roles in excitatory synapse regulation. NF-κB-dependent regulation of the density, size, and function of dendritic spines and excitatory synapses provides a potential cellular mechanism to underlie the importance of this transcription factor in learning and memory(Shrum and Meffert, 2008).
Supplementary Material
Supp1
Acknowledgments
We thank R. Schmid for creating and providing the RelAF/F mouse line that was critical to our experiments. We thank A. Cho for assistance with experiments, J. Pomerantz and members of the Meffert laboratory for discussion and critical reading of the manuscript, and M. Caterina, and R. Huganir for scientific suggestions. This work was supported by the Braude Foundation, an American Cancer Society Research Scholar Grant, and NIMH R01MH080740 to M.K.M.
  • Ahn HJ, Hernandez CM, Levenson JM, Lubin FD, Liou HC, Sweatt JD. c-Rel, an NF-kappaB family transcription factor, is required for hippocampal long-term synaptic plasticity and memory formation. Learn Mem. 2008;15:539–549. [PubMed]
  • Ai HW, Shaner NC, Cheng Z, Tsien RY, Campbell RE. Exploration of new chromophore structures leads to the identification of improved blue fluorescent proteins. Biochemistry. 2007;46:5904–5910. [PubMed]
  • Bhatt DH, Zhang S, Gan WB. Dendritic spine dynamics. Annu Rev Physiol. 2009;71:261–282. [PubMed]
  • Bonhoeffer T, Yuste R. Spine motility. Phenomenology, mechanisms, and function. Neuron. 2002;35:1019–1027. [PubMed]
  • Chen FE, Huang DB, Chen YQ, Ghosh G. Crystal structure of p50/p65 heterodimer of transcription factor NF-kappaB bound to DNA. Nature. 1998a;391:410–413. [PubMed]
  • Chen YQ, Ghosh S, Ghosh G. A novel DNA recognition mode by the NF-kappa B p65 homodimer. Nat Struct Biol. 1998b;5:67–73. [PubMed]
  • Cubelos B, Sebastian-Serrano A, Beccari L, Calcagnotto ME, Cisneros E, Kim S, Dopazo A, Alvarez-Dolado M, Redondo JM, Bovolenta P, Walsh CA, Nieto M. Cux1 and Cux2 regulate dendritic branching, spine morphology, and synapses of the upper layer neurons of the cortex. Neuron. 66:523–535. [PMC free article] [PubMed]
  • De Biase LM, Nishiyama A, Bergles DE. Excitability and synaptic communication within the oligodendrocyte lineage. J Neurosci. 30:3600–3611. [PMC free article] [PubMed]
  • de Wit J, Sylwestrak E, O’Sullivan ML, Otto S, Tiglio K, Savas JN, Yates JR, 3rd, Comoletti D, Taylor P, Ghosh A. LRRTM2 interacts with Neurexin1 and regulates excitatory synapse formation. Neuron. 2009;64:799–806. [PMC free article] [PubMed]
  • Deregowski V, Delhalle S, Benoit V, Bours V, Merville MP. Identification of cytokine-induced nuclear factor-kappaB target genes in ovarian and breast cancer cells. Biochem Pharmacol. 2002;64:873–881. [PubMed]
  • Durand GM, Kovalchuk Y, Konnerth A. Long-term potentiation and functional synapse induction in developing hippocampus. Nature. 1996;381:71–75. [PubMed]
  • Ehrlich I, Klein M, Rumpel S, Malinow R. PSD-95 is required for activity-driven synapse stabilization. Proc Natl Acad Sci U S A. 2007;104:4176–4181. [PubMed]
  • El-Husseini AE, Schnell E, Chetkovich DM, Nicoll RA, Bredt DS. PSD-95 involvement in maturation of excitatory synapses. Science. 2000;290:1364–1368. [PubMed]
  • Elias GM, Funke L, Stein V, Grant SG, Bredt DS, Nicoll RA. Synapse-specific and developmentally regulated targeting of AMPA receptors by a family of MAGUK scaffolding proteins. Neuron. 2006;52:307–320. [PubMed]
  • Feil R, Wagner J, Metzger D, Chambon P. Regulation of Cre recombinase activity by mutated estrogen receptor ligand-binding domains. Biochem Biophys Res Commun. 1997;237:752–757. [PubMed]
  • Fitzjohn SM, Doherty AJ, Collingridge GL. Promiscuous interactions between AMPA-Rs and MAGUKs. Neuron. 2006;52:222–224. [PubMed]
  • Freudenthal R, Romano A. Participation of Rel/NF-kappaB transcription factors in long-term memory in the crab Chasmagnathus. Brain Res. 2000;855:274–281. [PubMed]
  • Futai K, Kim MJ, Hashikawa T, Scheiffele P, Sheng M, Hayashi Y. Retrograde modulation of presynaptic release probability through signaling mediated by PSD-95-neuroligin. Nat Neurosci. 2007;10:186–195. [PubMed]
  • Geisler F, Algul H, Paxian S, Schmid RM. Genetic inactivation of RelA/p65 sensitizes adult mouse hepatocytes to TNF-induced apoptosis in vivo and in vitro. Gastroenterology. 2007;132:2489–2503. [PubMed]
  • Gould E, Woolley CS, Frankfurt M, McEwen BS. Gonadal steroids regulate dendritic spine density in hippocampal pyramidal cells in adulthood. J Neurosci. 1990;10:1286–1291. [PubMed]
  • Heckscher ES, Fetter RD, Marek KW, Albin SD, Davis GW. NF-kappaB, IkappaB, and IRAK control glutamate receptor density at the Drosophila NMJ. Neuron. 2007;55:859–873. [PMC free article] [PubMed]
  • Hofer SB, Mrsic-Flogel TD, Bonhoeffer T, Hubener M. Experience leaves a lasting structural trace in cortical circuits. Nature. 2009;457:313–317. [PubMed]
  • Hoffmann A, Leung TH, Baltimore D. Genetic analysis of NF-kappaB/Rel transcription factors defines functional specificities. Embo J. 2003;22:5530–5539. [PubMed]
  • Holtmaat A, Svoboda K. Experience-dependent structural synaptic plasticity in the mammalian brain. Nat Rev Neurosci. 2009;10:647–658. [PubMed]
  • Hubener M, Bonhoeffer T. Searching for engrams. Neuron. 67:363–371. [PubMed]
  • Iliopoulos D, Hirsch HA, Struhl K. An epigenetic switch involving NF-kappaB, Lin28, Let-7 MicroRNA, and IL6 links inflammation to cell transformation. Cell. 2009;139:693–706. [PMC free article] [PubMed]
  • Kaltschmidt B, Ndiaye D, Korte M, Pothion S, Arbibe L, Prullage M, Pfeiffer J, Lindecke A, Staiger V, Israel A, Kaltschmidt C, Memet S. NF-kappaB regulates spatial memory formation and synaptic plasticity through protein kinase A/CREB signaling. Mol Cell Biol. 2006;26:2936–2946. [PMC free article] [PubMed]
  • Kaltschmidt C, Kaltschmidt B, Baeuerle PA. Brain synapses contain inducible forms of the transcription factor NF-kappa B. Mech Dev. 1993;43:135–147. [PubMed]
  • Kassed CA, Willing AE, Garbuzova-Davis S, Sanberg PR, Pennypacker KR. Lack of NF-kappaB p50 exacerbates degeneration of hippocampal neurons after chemical exposure and impairs learning. Exp Neurol. 2002;176:277–288. [PubMed]
  • Kawasaki Y, Zhang L, Cheng JK, Ji RR. Cytokine mechanisms of central sensitization: distinct and overlapping role of interleukin-1beta, interleukin-6, and tumor necrosis factor-alpha in regulating synaptic and neuronal activity in the superficial spinal cord. J Neurosci. 2008;28:5189–5194. [PMC free article] [PubMed]
  • Kopec CD, Real E, Kessels HW, Malinow R. GluR1 links structural and functional plasticity at excitatory synapses. J Neurosci. 2007;27:13706–13718. [PubMed]
  • Levenson JM, Choi S, Lee SY, Cao YA, Ahn HJ, Worley KC, Pizzi M, Liou HC, Sweatt JD. A bioinformatics analysis of memory consolidation reveals involvement of the transcription factor c-rel. J Neurosci. 2004;24:3933–3943. [PubMed]
  • Liu F, Day M, Muniz LC, Bitran D, Arias R, Revilla-Sanchez R, Grauer S, Zhang G, Kelley C, Pulito V, Sung A, Mervis RF, Navarra R, Hirst WD, Reinhart PH, Marquis KL, Moss SJ, Pangalos MN, Brandon NJ. Activation of estrogen receptor-beta regulates hippocampal synaptic plasticity and improves memory. Nat Neurosci. 2008;11:334–343. [PubMed]
  • Lois C, Hong EJ, Pease S, Brown EJ, Baltimore D. Germline transmission and tissue-specific expression of transgenes delivered by lentiviral vectors. Science. 2002;295:868–872. [PubMed]
  • Lubin FD, Sweatt JD. The IkappaB kinase regulates chromatin structure during reconsolidation of conditioned fear memories. Neuron. 2007;55:942–957. [PMC free article] [PubMed]
  • Matsuda S, Wen TC, Morita F, Otsuka H, Igase K, Yoshimura H, Sakanaka M. Interleukin-6 prevents ischemia-induced learning disability and neuronal and synaptic loss in gerbils. Neurosci Lett. 1996;204:109–112. [PubMed]
  • Matsuzaki M, Honkura N, Ellis-Davies GC, Kasai H. Structural basis of long-term potentiation in single dendritic spines. Nature. 2004;429:761–766. [PubMed]
  • Matsuzaki M, Ellis-Davies GC, Nemoto T, Miyashita Y, Iino M, Kasai H. Dendritic spine geometry is critical for AMPA receptor expression in hippocampal CA1 pyramidal neurons. Nat Neurosci. 2001;4:1086–1092. [PubMed]
  • Mattson MP, Meffert MK. Roles for NF-kappaB in nerve cell survival, plasticity, and disease. Cell Death Differ. 2006;13:852–860. [PubMed]
  • Meffert MK, Chang JM, Wiltgen BJ, Fanselow MS, Baltimore D. NF-kappa B functions in synaptic signaling and behavior. Nat Neurosci. 2003;6:1072–1078. [PubMed]
  • Mikenberg I, Widera D, Kaus A, Kaltschmidt B, Kaltschmidt C. Transcription factor NF-kappaB is transported to the nucleus via cytoplasmic dynein/dynactin motor complex in hippocampal neurons. PLoS ONE. 2007;2:e589. [PMC free article] [PubMed]
  • Moser MB, Trommald M, Andersen P. An increase in dendritic spine density on hippocampal CA1 pyramidal cells following spatial learning in adult rats suggests the formation of new synapses. Proc Natl Acad Sci U S A. 1994;91:12673–12675. [PubMed]
  • Murphy DD, Segal M. Regulation of dendritic spine density in cultured rat hippocampal neurons by steroid hormones. J Neurosci. 1996;16:4059–4068. [PubMed]
  • Nagerl UV, Eberhorn N, Cambridge SB, Bonhoeffer T. Bidirectional activity-dependent morphological plasticity in hippocampal neurons. Neuron. 2004;44:759–767. [PubMed]
  • Nimchinsky EA, Sabatini BL, Svoboda K. Structure and function of dendritic spines. Annu Rev Physiol. 2002;64:313–353. [PubMed]
  • Nusser Z, Lujan R, Laube G, Roberts JD, Molnar E, Somogyi P. Cell type and pathway dependence of synaptic AMPA receptor number and variability in the hippocampus. Neuron. 1998;21:545–559. [PubMed]
  • O’Riordan KJ, Huang IC, Pizzi M, Spano P, Boroni F, Egli R, Desai P, Fitch O, Malone L, Ahn HJ, Liou HC, Sweatt JD, Levenson JM. Regulation of nuclear factor kappaB in the hippocampus by group I metabotropic glutamate receptors. J Neurosci. 2006;26:4870–4879. [PubMed]
  • O’Sullivan NC, McGettigan PA, Sheridan GK, Pickering M, Conboy L, O’Connor JJ, Moynagh PN, Higgins DG, Regan CM, Murphy KJ. Temporal change in gene expression in the rat dentate gyrus following passive avoidance learning. J Neurochem. 2007;101:1085–1098. [PubMed]
  • Papa M, Segal M. Morphological plasticity in dendritic spines of cultured hippocampal neurons. Neuroscience. 1996;71:1005–1011. [PubMed]
  • Perkins ND. Integrating cell-signalling pathways with NF-kappaB and IKK function. Nat Rev Mol Cell Biol. 2007;8:49–62. [PubMed]
  • Pomerantz JL, Denny EM, Baltimore D. CARD11 mediates factor-specific activation of NF-kappaB by the T cell receptor complex. Embo J. 2002;21:5184–5194. [PubMed]
  • Restivo L, Vetere G, Bontempi B, Ammassari-Teule M. The formation of recent and remote memory is associated with time-dependent formation of dendritic spines in the hippocampus and anterior cingulate cortex. J Neurosci. 2009;29:8206–8214. [PubMed]
  • Russo SJ, Wilkinson MB, Mazei-Robison MS, Dietz DM, Maze I, Krishnan V, Renthal W, Graham A, Birnbaum SG, Green TA, Robison B, Lesselyong A, Perrotti LI, Bolanos CA, Kumar A, Clark MS, Neumaier JF, Neve RL, Bhakar AL, Barker PA, Nestler EJ. Nuclear factor kappa B signaling regulates neuronal morphology and cocaine reward. J Neurosci. 2009;29:3529–3537. [PMC free article] [PubMed]
  • Schmitz ML, Baeuerle PA. The p65 subunit is responsible for the strong transcription activating potential of NF-kappa B. Embo J. 1991;10:3805–3817. [PubMed]
  • Schmitz ML, Stelzer G, Altmann H, Meisterernst M, Baeuerle PA. Interaction of the COOH-terminal transactivation domain of p65 NF-kappa B with TATA-binding protein, transcription factor IIB, and coactivators. J Biol Chem. 1995;270:7219–7226. [PubMed]
  • Shrum CK, Meffert MK. The NF-kB family in learning and memory. In: Byrne J, editor. Learning And Memory: A Comprehensive Reference. Oxford: Elsevier Ltd; 2008. pp. 567–586.
  • Shrum CK, Defrancisco D, Meffert MK. Stimulated nuclear translocation of NF-kappaB and shuttling differentially depend on dynein and the dynactin complex. Proc Natl Acad Sci U S A. 2009;106:2647–2652. [PubMed]
  • Steward O, Falk PM. Selective localization of polyribosomes beneath developing synapses: a quantitative analysis of the relationships between polyribosomes and developing synapses in the hippocampus and dentate gyrus. J Comp Neurol. 1991;314:545–557. [PubMed]
  • Suzuki T, Mitake S, Okumura-Noji K, Yang JP, Fujii T, Okamoto T. Presence of NF-kappaB-like and IkappaB-like immunoreactivities in postsynaptic densities. Neuroreport. 1997;8:2931–2935. [PubMed]
  • Szymczak AL, Workman CJ, Wang Y, Vignali KM, Dilioglou S, Vanin EF, Vignali DA. Correction of multi-gene deficiency in vivo using a single ‘self-cleaving’ 2A peptide-based retroviral vector. Nat Biotechnol. 2004;22:589–594. [PubMed]
  • Wellmann H, Kaltschmidt B, Kaltschmidt C. Retrograde transport of transcription factor NF-kappa B in living neurons. J Biol Chem. 2001;276:11821–11829. [PubMed]
  • Young P, Qiu L, Wang D, Zhao S, Gross J, Feng G. Single-neuron labeling with inducible Cre-mediated knockout in transgenic mice. Nat Neurosci. 2008;11:721–728. [PMC free article] [PubMed]
  • Zhou Q, Homma KJ, Poo MM. Shrinkage of dendritic spines associated with long-term depression of hippocampal synapses. Neuron. 2004;44:749–757. [PubMed]