RNA was isolated from pellets containing 3 × 10⁶ cells using the Qiagen RNeasy Mini Kit and Qiagen QIAshredder (Valencia, CA). Genomic DNA was digested with DNase I (Invitrogen, Carlsbad, CA). The reverse transcriptase reaction was performed using the SuperScript III First-Strand Synthesis System (Invitrogen) with or without (negative control) reverse transcriptase. Primers specific to necdin (forward: gctggtgcagaaggcgcacga, reverse: gctggtacttcaggtaattc) were used to amplify a 455bp fragment by PCR (T_m= 58, 35 cycles).

Necdin siRNA [Santa Cruz Biotechnology, Santa Cruz, CA, Ndn siRNA(h) #sc-37318; Ndn siRNA(m) #sc-37319], p75NTR siRNA [Integrated DNA Technologies, Coralville, IA, p75 siRNA(h): gcagaacaccgugugc; Qiagen, Valencia, CA, p75(m) #SI00230230], TrkA siRNA [TrkA(h) #sc-36726], and control scrambled siRNA (Santa Cruz Biotechnology, Santa Cruz, CA, Control siRNA-A #sc-37007) were thawed at room temperature, diluted into 50 μL medium, and incubated at room temperature for 5 min. Lipofectamine 2000 (Invitrogen, Carlsbad, CA, #11668-019) was prepared in culture medium per the manufacturer's instructions and allowed to sit for 5 min at room temperature. The individual siRNA and Lipofectamine solutions were then combined and allowed to incubate at room temperature for 20 min. This mixture was then added to the cells to give a final siRNA concentration of 20 μM (necdin, p75NTR, and respective control siRNAs) or 5 μM (TrkA sRNA and respective control). The plates were incubated overnight (18-24 h) at 37°C. Sister wells of cells were then harvested for protein determination or treated with 6-hydroxydopamine (6-OHDA).

The 96-well plates of neuroblastoma cells treated with siRNA were subsequently treated with 0-500 μM 6-OHDA (Sigma-Aldrich, St. Louis, MO, #162957). Briefly, 10 mg of 6-OHDA was dissolved into 200 μL of saline containing 100 μg/mL L-ascorbate (Sigma-Aldrich, St. Louis, MO, #A-0278). This solution was then diluted into culture medium to a final concentration of between 0 and 500 μM. The resulting solution was added to the siRNA-treated cells on 96-well plates which were incubated at 37°C for 24 h.

The metabolic viability of neuroblastoma cells treated with siRNA and 6-OHDA was determined using the Alamar blue assay (Invitrogen Biosource, Carlsbad, CA, #DAL1100). Alamar blue dye was diluted to 10% v/v in cell culture medium and cells were treated for 1 h at 37°C, at which time the fluorescence in each well was determined using a Molecular Devices SpectraMax M5 plate reader at an excitation wavelength of 530 nm and an emission wavelength of 590 nm. Six fluorescence measurements were taken per well and the mean and SD were calculated.

Cells were washed with Hank's Balanced Salt Solution (Cellgro, Manassas, VA, #21-022-CV) and then trypsinized (Cellgro, Manassas, VA, #MT25-053-CI) for 5 min at 37°C. The cells were then pipetted into a conical tube and centrifuged at 250 × g for 3 min and the supernatant was removed. The pellet was resuspended in 100 μL RIPA buffer [10 mM Tris, pH 8 (MP Biomedicals, Solon, OH, #819623); 150 mM NaCl (EMD Biosciences, Madison, WI, #7760); 0.1% v/v Nonidet P-40 (Sigma-Aldrich, St. Louis, MO, #I-8896); 0.5% w/v sodium deoxycholate (Sigma-Aldrich, St. Louis, MO, #D-7650); 0.1% w/v sodium dodecyl sulfate (Bio-Rad, Hercules, CA, #161-0302)] supplemented with 4 μg/mL aprotinin (Sigma-Aldrich, St. Louis, MO, #A-6279), 1 mM phenylmethanesulphonylfluoride (G-Biosciences, Maryland Heights, MO, #786-055) and 1 mM sodium orthovanadate (Sigma-Aldrich, St. Louis, MO, #S-6508). The suspension was then sonicated through 10 cycles with a Branson Sonifier 450 on a constant output setting of 2 and incubated at 4°C for 30 min vortexing every 10 min. The resulting mixture was centrifuged at 10 000 × g for 15 min and the supernatant was removed. The protein concentration was measured with a protein assay kit (Bio-Rad, Hercules, CA, #500-0006).

Separating and stacking acrylamide gels were poured [7.5-12% separating gel: 7.5%-12% v/v acrylamide/bis (Bio-Rad, Hercules, CA, #161-0154); 375 mM Tris, pH 8.8 (MP Biomedicals, Solon, OH, #819623); 0.05% w/v ammonium persulfate (VWR, Batavia, IL, #VW1469-04); 0.05% v/v TEMED (Bio-Rad, Hercules, CA, #161-0800); 4% stacking gel: 4% v/v acrylamide/bis; 375 mM Tris, pH 6.8; 0.05% w/v ammonium persulfate; 0.1% TEMED]. Protein samples were denatured and loaded onto the gels at 50-150 μg protein/lane and were run at 60 V for 30 min and then 90 V for 2 h. Each gel was then transferred onto a nitrocellulose membrane at 90 V for 1.5 h on ice. The membrane was then blocked for 1 h at room temperature in blocking buffer [5% dry milk (Bio-Rad, Hercules, CA, #170-6404); 1x PBS (Sigma-Aldrich, St Louis, MO, D-5652)] on an orbital shaker. Primary antibodies, all purchased from Santa Cruz, except for anti-p75NTR (Promega, Madison, WI, #G323A), were added at dilutions ranging from 1:200-1:1000 and the membranes were allowed to incubate at 4°C overnight on an orbital shaker. Membranes were washed twice with shaking for 10 min each with washing buffer [0.1% v/v Tween-20 (Fisher Scientific, Hampton, NH, #BP337-500) diluted in 1x PBS]. The secondary antibody was added in a ratio of 1:5000 in blocking buffer and the membrane and overlying solution were incubated at room temperature for 1 h on an orbital shaker. The membranes were washed with washing buffer 4 times for 10 min each at room temperature on an orbital shaker. The membranes were then placed on Saran Wrap™ and a chemiluminescent solution (Santa Cruz Biotechnology, Santa Cruz, CA, #sc-2048) was added. The excess solution was wiped away and the membranes were exposed onto Kodak Biomax film (Kodak, Rochester, NY, #165-1454). The films were then digitally scanned as TIFs.

The Neuro-2A, SH-EP1, SH-SY5Y and SK-N-AS cell lines were shown by RT-PCR to express necdin (Fig. 2, +RT). Primary cortical neurons were known to express necdin (11) and were used as a positive control. ATCC PC12 cells were known to lack necdin expression (9,12) and were used as a negative control. The -RT lanes did not have reverse transcriptase during the production of cDNA and were used as controls to ensure that the samples did not contain genomic DNA.