PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
J Neurosci. Author manuscript; available in PMC Sep 23, 2011.
Published in final edited form as:
PMCID: PMC3076930
NIHMSID: NIHMS281981
GATA2 IS REQUIRED FOR MIGRATION AND DIFFERENTIATION OF RETINORECIPIENT NEURONS IN THE SUPERIOR COLLICULUS
Ryan T. Willett1,2 and Lloyd A. Greene2,3
1 Department of Pharmacology, Columbia University College of Physicians and Surgeons, New York, NY 10032
2 Department of Pathology and Cell Biology, Columbia University College of Physicians and Surgeons, New York, NY 10032
3 Corresponding Author: Lloyd A. Greene, Phone: 212-305-6369, Fax: 212-305-5498, lag3/at/columbia.edu
The superior colliculus (SC)/optic tectum of the dorsal mesencephalon plays a major role in responses to visual input, yet regulation of neuronal differentiation within this layered structure is only partially understood. Here, we show that the zinc finger transcription factor Gata2 is required for normal SC development. Starting at e15 (corresponding to the times at which neurons of the outer and intermediate layers of the SC are generated), Gata2 is transiently expressed in the rat embryonic dorsal mesencephalon within a restricted region between proliferating cells of the ventricular zone and the deepest neuronal layers of the developing SC. The Gata2 positive cells are post-mitotic and lack markers of differentiated neurons, but express markers for immature neuronal precursors including Ascl1 and Pax3/7. In utero electroporation with Gata2 shRNAs at e16 into cells along the dorsal mesencephalic ventricle interferes with their normal migration into the SC and maintains them in a state characterized by retention of Pax3 expression and the absence of mature neuronal markers. Collectively, these findings indicate that Gata2 plays a required role in the transition of post-mitotic neuronal precursor cells of the retinorecipient layers of the SC into mature neurons and that loss of Gata2 arrests them at an intermediate stage of differentiation.
Keywords: mesencephalon, neurogenesis, midbrain, Gata2, GATA-2, superior colliculus, neuronal differentiation
The superior colliculus (SC/tectum) is a laminar midbrain structure involved in head and eye orientation to sensory stimuli. Retinal ganglion neurons project to the upper layers of the SC and synapse onto retinorecipient neurons to form a topographic map representing the visual field (O’Leary and McLaughlin, 2005). Deeper layer SC neurons receive inputs from cortex and basal ganglia and project radial processes into the retinorecipient laminae. During embryonic development, the laminar SC structure is constructed by sequential cohorts of cells that are generated in the ventricular zone and that migrate dorsally towards the pial surface. In chick embryo, deep layer tectal neurons are generated first, a second wave produces the outermost retinorecipient layers and a third and final wave generates the interstitial lamina (Gray and Sanes, 1991; Sugiyama and Nakamura, 2003). Although there is much progress in understanding the mechanisms underlying retinotectal mapping, only partial information exists about regulation of neuron differentiation in the SC.
The GATA transcription factor family binds the DNA sequence WGATAR and along with other cofactors, drives expression of target genes important in development of a variety of tissues. GATA members present in the nervous systems include Gata2 and Gata3 (Groves et al., 1995; Tsarovina et al., 2004). As in hematopoiesis, Gata3 appears after Gata2 and operates downstream in most cases evaluated (Groves et al., 1995; Kala et al., 2009). Gata2 is expressed in embryonic dorsal diencephalon, ventral hindbrain including serotonergic neurons, V2 spinal cord interneurons, autonomic neurons, and cell types throughout the mesencephalon (Groves et al., 1995; Kornhauser et al., 1994; Bell et al., 1999; Zhou et al., 2000; Craven et al., 2004: Kala et al., 2009). Gata2 null mice exhibit a profound failure of hematopoietic stem cell differentiation (Tsai et al., 1994), as well as neurodevelopmental defects including abnormal axon pathfinding, fasciculation and arborization (Nardelli et al., 1999). While early lethality of Gata2 null mice (e10.5) precludes their use for studying Gata2’s role in differentiation of later born neurons, various studies show that Gata2 is required for V2b spinal interneuron subtype identity (Zhou et al., 2000; Karunaratne et al., 2002), drives precocious neuronal differentiation in chick spinal cord (El Wakil et al., 2006), and is sufficient for ectopic serotonergic neuron specification in lateral hindbrain (Craven et al., 2004). Additionally, region-specific knockout indicates that Gata2 is necessary for GABAergic phenotype of early born interneurons in the inferior colliculus (Kala et al., 2009). Detection of Gata2 in dorsal midbrain was first reported in chick optic tectum, where its laminar expression and spatiotemporal regulation during embryogenesis suggested a function in determining neuronal fates (Kornhauser et al., 1994).
Here, we address Gata2’s role in development of the embryonic rat SC. Gata2 protein expression begins at e15 and is transiently present and restricted to a periventricular zone of immature postmitotic SC neuronal precursors. In utero electroporation of Gata2-targeted shRNAs indicates that Gata2 is required for migration of this population to the outer layers of the SC and for their differentiation into mature neurons. Gata2-knockdown cells retain markers for immature neuronal precursor cells. These results place Gata2 as a critical fate determinant in late phase SC neurogenesis.
Materials
Platinum TaqDNA polymerase, One Shot® TOP10 competent bacteria, and Lipofectamine 2000 were from Invitrogen. Tri Reagent was from Molecular Research Sciences. SuperBlock® Blocking Buffer was from Thermo Scientific. Human recombinant NGF was a kind gift from Genentech.
Antibodies
Antibodies used for immunohistology were: rabbit anti-Gata2 (Santa Cruz Biotech, sc-9008 X, lot# J2108), rabbit anti-Ki67 (Vector Laboratories), mouse anti-GFP (UC Davis/NIH NeuroMab Facility), rabbit anti-GFP (Invitrogen), mouse anti-Ascl1 (BD Pharmingen), rabbit anti-Msi1 mouse anti-NeuN, rabbit anti-Sox2 mouse anti-TH, anti-GAD1 clone 1G10.2, guinea pig anti-DCX (all from Chemicon), mouse anti-NF-l and mouse PH2A.X (gamma H2A.X) (Abcam), mouse anti-phospho-histone H3 (Ser10) and cleaved caspase 3 (Cell Signaling Technology), ERK 1 (Santa Cruz Biotech), and rabbit anti-peripherin (Aletta et al., 1988).
Pax3, Pax7, Nkx2.2, and Nkx6.2 antibodies, developed by C.P. Ordahl, A. Kawakami, T.M. Jessell, and O.D. Madsen, respectively, were obtained from the Developmental Studies Hybridoma Bank developed under the auspices of the NICHD and maintained by The University of Iowa, Department of Biology, Iowa City, IA).
Plasmids
Plasmid pCR2.1-TOPO was from Invitrogen; pCMS-EGFP and pSIREN-RetroQ-zsGreen were from Clontech; and pcDNA-GATA2 vector was from Addgene (plasmid 1287, from Gokhan S. Hotamisligil (Tong et al., 2000)).
Overexpression and siRNA knockdown constructs were derived from plasmids pCMS-EGFP and pSIREN-RetroQ-ZsGreen (Clontech). Targeting sequences for siRNA cassettes were designed using the design tool available on the BaRC website (Whitehead Institute, MIT). Inactivation of siGATA2-1 to generate siRNA control (siCon) was achieved by substituting positions 2–6 of the sequence with the reverse complement. These sequences were designed into a hairpin expression cassette and cloned into pSIREN-RetroQ-ZsGreen, and this U6-siRNA promoter/knockdown cassette was subcloned into pCMS-EGFP in place of CMV-MCS with the restriction enzymes BglII and EcoRI. The siRNA targeting sequences were: siCon GCACCTGATGTCTTCTTCAACC; siGata2-1 GAGGTGGATGTCTTCTTCAACCA; and siGata2-2 GGACGAGGTGGATGTCTTCTTCAA.
Cell Culture
Culture and transfection of PC12 cells (Greene and Tischler, 1976) are detailed in Xu et al., 2001). Generation of stable, retrovirally tranduced PC12 lines was as reported in Cunningham et al., 2000.
Immunohistology (IHC)
Developmentally timed Sprague Dawley rat embryos were drop fixed in 4% paraformaldehyde in phosphate buffed saline (1x PBS) for 2 days. They were then cryoprotected in 30% sucrose/1x PBS and coronally sectioned at 14 μm for developmental expression studies or 50 μm for electroporated brain samples. Sections were blocked in SuperBlock® with 0.3% Triton X-100 for 1 hour and primary antibodies were bound overnight at 4C. The sections were washed 3×15 minutes with 1x PBS (0.3% Triton X-100) and AlexaFluor conjugated secondary antibodies were bound for 1hr before 3 more washes.
In Utero Electroporation
In utero electroporation was as described in Biswas et al., 2010 except that DNA (2μg/1μl) was injected through the dorsal mesencephalon rather than telencephalon. Due to the thin lateral dimension of the mesencephalic ventricle, the capillary syringe was placed through the dorsal midline angled in the direction of the cephalic flexure. Injection into the ventricle was verified by Fast Green in the DNA solution. Brains were dissected and drop fixed in 4% paraformaldehyde/PBS. For migration and marker studies, embryos were electroporated at e16 and sacrificed at e21 or p5. For cell death marker studies, embryos were electroporated at e16 and sacrificed at e18. For in vivo knockdown verification, embryos were electroporated at e15 and sacrificed at e17.
Western Blot
Performed as previously described (Xu et al., 2001). The antibodies used are referenced above under the antibodies section.
Migration Analysis
Overlapping fluorescent micrographs of specimens were photographed at 20x on a Nikon epifluorescent microscope, and then assembled into contiguous fields. The distance of each labeled cell body from the ventricular surface was measured with ImageJ and normalized to the entire VZ-pial thickness at that position (n = 3 brains/condition; 3–4 sections imaged/brain; n = 100–300 cells counted/section). Values were expressed as percentages of this thickness and assigned into bins for distance traversed (Sector A: 0–30%, Sector B: 31–60%, Sector C: 61–100%). Sections were selected for analysis if electroporated radial glia fibers could be followed for the majority of the SC thickness.
Electroporation marker analysis
Sections were imaged with the Velocity software suite on a hybrid spinning disk confocal microcope (PerkinElmer) using an ORCA-ER camera (Hamamatsu) at 60x with an argon ion laser (CVI Melles Griot). For each marker and each electroporated construct, 3 brains were analyzed with 4 sections from each for a total of 10–15 images/brain. Micrograph fields were assessed for ratio of electroporated/GFP+ cells positive for immunostained markers. About 3–15 electroporated cells typically appeared in each 60x field. Counts from the same brain were pooled and counts of duplicate experiments were used for mean and SEM calculations.
Gata2 is down-regulated by NGF in PC12 cells and influences their neuronal differentiation
Our interest in Gata2 arose from findings that NGF-promoted neuronal differentiation of PC12 pheochromocytoma cells is accompanied by loss of detectable Gata2 transcripts (Greene and Angelastro, 2008). Western immunoblotting confirmed that Gata2 protein levels are undetectable by 4 days of NGF exposure (Fig 1A). To assess Gata2’s role in this system, we over-expressed it either transiently or constitutively and monitored NGF-dependent neuronal differentiation. This reduced the rate of neurite production by 2-fold (Fig 1B–D) and markedly decreased neurite length (Fig 1E). In contrast, constitutive Gata2 expression did not affect induction by NGF of peripherin or neurofilament light protein (Fig 1F). These findings are consistent with the general themes that Gata2 is regulated during neuronal differentiation and may play functionally important roles in this process.
Figure 1
Figure 1
Gata2 is a NGF-responsive gene and suppresses neurite outgrowth in PC12 cells
GATA2 protein is transiently expressed and confined to a periventricular zone during mesencephalic embryonic development
To extend our studies to brain development, we used immunohistofluorescence staining of Gata2 protein. Consistent with prior work (Bell et al., 1999; Zhou et al., 2000; Craven et al., 2004; Herberth et al., 2005; Kala et al., 2009), we observed expression in embryonic rat hindbrain and midbrain. We subsequently focused on the dorsal mesencephalon and developing superior colliculus (SC) where expression was robust as well as transient, and in which the developmental role of Gata2 is unclear.
The earliest detectable mesencephalic Gata2-expressing cells appear at e12 in the ventrolateral part of this structure (Fig 2A–C). At this and all other times between e12 and e18, Gata2 expression is limited to a domain lying between the ventricular zone of neuroprogenitor cells and the β-III-tubulin-expressing neuronal layers neurons (Figure 2). We will refer to this domain as the “intermediate zone” or IZ. By e14, Gata2 expression spreads to the entirety of the IZ in the ventral mesencephalon (Fig 2A,D). Gata2 is not detected in the dorsal mesencephalon at these times, indicating that it does not play a role in development of early born SC neurons that are present at e12–e14. This is consistent with a report that expression of Gata2 transcripts is absent in the mouse dorsal mesencephalon as early as e8.5 (equivalent to about e10.5 in rat) (Nardelli et al., 1999).
Figure 2
Figure 2
Dynamics of Gata2 expression during embryonic rat midbrain development
After e14, Gata2 expression spreads dorsally and at e15–17 lies in the IZ in a diffuse pattern around the full mesencephalic circumference (Fig 2A,E,F), except for a medial gap in the ventral midbrain (Fig 3A). The latter contains cells that are positive for tyrosine hydroxylase and negative for Gata2 and that appear to be immature dopaminergic neuronal cells in process of migration (Fig 3B). By e18, Gata2 is absent from the ventral midbrain but persists in a thin layer immediately beneath the differentiating SC in the dorsal mesencephalon (Figure 2A,G). The IZ lying between the ventricle and SC is nearly gone by e21 and there is no detectable Gata2 expression there by this time (Fig 2H). By e17 and beyond, a second wave of strong Gata2 expression appears in subsets of mature neurons within the ventral midbrain including the medial geniculate nucleus and the olivary nuclei (Fig 2A).
Figure 3
Figure 3
Gata2 is expressed in the e15 rat midbrain but excluded from catecholaminergic progenitors as well as SC neuronal and VZ layers
Gata2 positive cells in the embryonic dorsal mesencephalon appear to be migrating immature, post-mitotic neuronal precursors
We further characterized Gata2+ cells in the developing dorsal mesencephalon to better understand their identity. At all times, Gata2 was expressed by only a subpopulation in the IZ. For example, at e15 they comprised 29±4% of the cells there, and this proportion appeared to hold through at least e17. Immunostaining for phospho-histone H3 at e15 revealed a layer of mitotic cells along the ventricle from which Gata2 was completely excluded, indicating that the Gata2+ population is post-mitotic (Fig 4A). Co-staining at this age confirmed that the highest-expressing Gata2+ cells lack β-III-tubulin (TuJ1)+ expression in the IZ (Fig 3C; Fig 4B). However, a small number of neurons that express low levels of Gata2 and TuJ1 were detected near the IZ/SC boundary, suggesting that these may be in transition with Gata2 expression waning while β-III-tubulin expression is induced. These findings and distribution of Gata2+ cells suggest that they are immature, postmitotic neuronal precursors migrating to the differentiating SC.
Figure 4
Figure 4
Gata2-expressing cells in the e15 developing SC are postmitotic and immature
The immature nature of Gata2+ cells was supported by comparison with the expression patterns of Msi1 and Sox2, markers for neuroprogenitor cells and immature neuronal precursors (Kaneko et al., 2000; Bylund et al., 2003; Graham et al., 2003; Sakakibira et al., 2002). Because available antisera precluded co-staining, we examined contiguous serial sections. Both Msi1 and Sox2 were present with Gata2 in the VZ at e15, as well as in the IZ (Fig 4C,D). While both Msi1 and Gata2 extended all the way to the TUJ1-positive SC, Sox2 expression ended several cell diameters short of it. Within the central area of the IZ, essentially all cells were Msi1+ and the vast majority were Sox2+. This indicates that most/all Gata2+ cells there also express Sox2 and Msi1.
Pax homeodomain transcription factors confer region-specific patterning in the central nervous system and are crucial for establishing area boundaries (reviewed by Nakamura, 2001). Pax3 and Pax7 are expressed in dorsal midbrain, specifically in the developing SC, initially together within neural progenitors and early post-mitotic neuronal precursors (Thompson et al., 2008). In late embryogenesis, their patterns diverge and by birth Pax3 persists in a periventricular arrangement while Pax7 is low around the ventricle and highest in mature SC neurons (Thompson et al., 2004; Thompson et al., 2008; Fedtsova et al., 2008). We observed that in e15 dorsal midbrain, Pax3 and Pax7 expression extends from the VZ into the IZ and ends several cell diameters beneath the neuronal layers (Fig 5A,B). Thus, Pax3 and Pax7 are expressed in the IZ along with Gata2+ except in the most superficial part of this zone. Of all Gata2+ cells in the IZ, counts revealed that 50±6% (n=3) express Pax3, and that within the part of the IZ where these markers overlap, 76±6% are also Pax3 positive. Conversely, 13±2% (n=3) of Pax3+ cells in the IZ co-express Gata2. With the patterns of Pax3 and Pax7 expression being so similar at e15, the coincidence of Gata2 and Pax7 appears to be very similar. Another homeodomain transcription factor Brn3a (Pou4f1) is expressed throughout the SC neuronal layers at e15 and e17, but not in the IZ and does not co-express with Gata2 (data not shown).
Figure 5
Figure 5
Gata2-expressing cells are early neuron precursors
The bHLH proneural gene Ascl1 (Mash1) is expressed in developing mesencephalon (Gradwohl et al., 1996; Kala et al., 2009; Osório et al., 2010) and is partially co-expressed with Gata2 in the IC (Kala et al., 2009). We also observed co-expression of Ascl1 and Gata2 in the dorsal mesencephalon. At e15, dorsal mesencephalic Ascl1 is expressed both in the VZ and IZ and overlaps with Gata2 in the upper regions of the IZ (Fig 5C). Counts revealed that where both are present, 46±9% (n=3) of Gata2+ cells co-express Ascl1+ and that 68±1% (n=3) of Mash+ cells are also Gata2+. Taken together, co-expression of Gata2 in the IZ with Sox2, Msi1, Pax3/7 and Ascl1, but not phospho-histone H3 or β-III tubulin supports the idea that Gata2+ cells are post-mitotic neuron precursors that are migrating to the SC. Once in the SC, they lose Gata2 expression and complete their differentiation into mature neurons.
The final marker evaluated was the early neuronal migrating cell marker doublecortin (Dcx). In the e15 dorsal mesencephalon, Dcx expression was essentially indistinguishable from that of β-III-tubulin, and as such, was excluded from the Gata2+ population (Fig 5D).
Gata2 knockdown in dorsal mesencephalon interferes with cell migration
Because our findings indicate that Gata2 is selectively expressed in immature post-mitotic neuronal precursors in the dorsal mesencephalon, we next addressed its functional role there. To achieve this, we designed and characterized independent siRNA constructs targeted against rodent Gata2, but not human Gata2, and expressed them as shRNAs in a vector that also expresses eGFP. Two of these (siGata2-1 and siGata2-2) show effective knockdown of over-expressed rat Gata2 in HEK293 cells, with siGata2-1 being the most robust (Fig 6A). In contrast, they did not knock down human Gata2 (Fig 6A and data not shown).
Figure 6
Figure 6
Transient Gata2 expression is required for normal migration of early neuron precursors in the developing SC
Because Gata2 is induced in neuronal precursors as they exit the cell cycle and migrate towards the SC, we used in utero electroporation to test its role in this critical period of dorsal mesencephalic development. Plasmids were injected into the 3rd ventricle at e16 and electrodes were oriented so that DNA was selectively delivered to the dorsal mesencephalon. In this approach, plasmids are electroporated mainly into the neuroprogenitor cells of the VZ which do not express Gata2. These continue to divide or radially migrate out from the VZ where the expressed Gata2 siRNA should diminish synthesis of endogenous Gata2. For most experiments, animals were sacrificed 5 days after electroporation and their brains processed by immunofluorescence for expression of eGFP and other markers.
As evidence that our shRNAs were effective, counts revealed an approximate 75% decrease in proportion of electroporated cells in the IZ that were positive for endogenous Gata2 after receiving Gata2 shRNA (shControl, 33% Gata2+ vs siGata2-1, 8.3% Gata2+). Even in cells with detectable Gata2 after electroporation with Gata2 shRNA, the signal was markedly reduced (data not shown).
Visualization of eGFP at e21 (5 days post-electroporation) revealed labeled cells at all levels of the dorsal midbrain for both knockdown and control constructs (Fig 6B–F). In the chick tectum, deep layer neurons are generated first, followed by a second wave that produces the outermost retinorecipient layers and a third and final wave that generates the interstitial lamina (LaVail and Cowan, 1971; Gray and Sanes, 1991; Sugiyama and Nakamura, 2003). It is unknown whether such neuron generation patterns are similar in rat SC. However, in brains electroporated with control constructs and stained for the neuronal marker NeuN, essentially all eGFP+/NeuN+ cells were confined to the middle and outermost laminae of the SC. Conversely, 75±3% (n=3 brains, 15–35 cells each) of eGFP+ cells in the brains were NeuN+ in these laminae whereas <5% of eGFP+ cells in the lower layers of the SC were NeuN+. These findings thus indicate that cells electroporated at e16 correspond to waves 2 and 3 of chick tectal neurogenesis.
Initial observations of knockdown cells indicated impaired migration (Fig 6B–F). To facilitate comparison between migration of control and knockdown cells, we partitioned coronal brain sections along the radial axis into three sectors. Sector A included the portion of dorsal mesencephalon 30% of the distance from the aqueduct to the pial surface and contained the VZ, a narrow periventricular zone and the deepest layers of the SC (Fig 6C). Most electroporated cells in the VZ had a morphology and possessed markers (nestin and BLBP) identifying them as radial glia (Figure 6C,D; Fig 6 and data not shown). These are Gata2- and appear unaffected by Gata2 shRNAs and were therefore excluded from our subsequent quantifications. Most cells in sector A outside the VZ had the appearance of migrating neuronal precursors with a bi- or unipolar morphology (data not shown). Gata2 knockdown caused a robust effect on migration so that a large number of electroporated cells appeared to be arrested in the periventricular area of sector A where endogenous Gata2 is expressed during development (Fig 6E,F). Quantification indicated that while about 35–45% of control electroporated cells were in sector A, 60–75% of knockdown cells were located there (Fig 6B). The difference was greater with siGata2-1 than for siGata2-2 shRNA which is consistent with their relative efficacy for knocking down Gata2 (Fig 6A).
Sector B included the portion of the dorsal mesencephalon between 31–60% of the distance to the pial surface and contains the central layers of the SC. Sector C comprised the remaining 61–100% of the distance to the pial surface and contains the retinorecipient layers of the SC. While Gata2 knockdown did not significantly affect the proportion of labeled cells in sector B, it markedly reduced (by about 2/3) the proportion of electroporated cells that reached Sector C (Fig 6B,E,F).
The loss of cells migrating into the outermost layers of the SC promoted by knockdown of Gata2 could be due to several potential causes, including cell death. Gata2 expression is required for normal survival and expansion of hematopoietic cells (Tsai et al., 1994; Rodrigues et al., 2005). Additionally, the GATA factor Gata3 is downstream of Gata2 in sympathetic neuron differentiation and loss of Gata3 in developing (Tsarovina et al., 2004) and in mature sympathetic neurons (Tsarovina et al., 2010) negatively impacts survival. To assess whether the observed effect of Gata2 knockdown in the superior colliculus might be due to excessive cell death, we electroporated at e16 and sacrificed the animals at e18 for a 2 day time-point. Immunostaining of siCon control, siGata2-1, or siGata2-2 electroporated brains were performed using the markers PH2A.X and cleaved caspase 3, which have been shown to correlate well with apoptotic cell death (Holubec et al., 2005). A small number of PH2A.X+ and cleaved caspase 3+ cells were observed in each 50 μm SC section, which indicates that the staining was successful. However less than 1% of the electroporated cells stained for these markers and no difference was observed for such staining of cells electroporated with either the siGata2-1/2 or control constructs (data not shown). In addition, if the absence of GFP+ cells in the outer SC layers in Gata2 knockdown brains were due to cell death, substantially fewer total labeled cells would be observed in these brains compared to siCon controls. However, the distribution patterns of cells in siRNA electroporated brains (Fig 6C–F) are consistent with redistribution of Gata2 knockdown cells, rather than cell loss. Taken together, these findings support the conclusion that cell death does not account for the absence of Gata2 knockdown cells in the SC outer laminae and suggest the alternative that Gata2 is required for proper migration of SC neuronal precursor cells to these layers.
As a control for possible off-target shRNA effects, we performed rescue experiments in which a plasmid expressing human Gata2 was co-electroporated with siGata2-1 or siGata2-2 shRNA. Pairwise comparison of human (hGata2) and rat Gata2 (rGata2) DNA sequences predicts that siGata2-1 and siGata2-2 should knockdown the rat, but not human form, although the two are 98% homologous at the protein level. As discussed below, expression of hGata2 itself did not perturb migration of cells into the SC.
In contrast to the effect of electroporating cells with either siGata2-1 or siGata2-2 alone, there was no evident accumulation of cells in sector A after electroporation with siGata2-1/hGata2 or siGata2-2/hGata2 (Fig 7A and data not shown). Moreover, for brains matched for electroporation efficiency, cells receiving siGata2-1/hGata2 or siGata2-2/hGata2 reached sector B/C in numbers comparable to that for control vector and that were approximately 3-fold higher compared with brains receiving only siGata2-1 or siGata2-2 (Fig 7C, D). Co-immunostaining indicated that 65% of the electroporated cells that reached sectors B/C in the rescue study were NeuN+ (Fig 7E), a level similar to that for brains electroporated with control constructs (75%).
Figure 7
Figure 7
Human Gata2 (hGata2) rescues migration and differentiation of siGata2 knockdown cells
Effects of exogenous Gata2 expression in the dorsal mesencephalon
Because Gata2 knockdown arrests migration of SC precursor cells, we next assessed the potential effects of electroporation with Gata2 expression constructs. Migration of cells electroporated with rat or human Gata2-FLAG pCMS-EGFP at e16 and harvested at e21 showed no significant change in migration relative to control electroporated cells (data not shown). Expression of exogenous Gata2 was verified by immunofluorescence against Gata2 protein and the FLAG epitope, and robust expression was found in many cells at e21 (Fig 7B and data not shown). However, the expression pattern of exogenous Gata2-FLAG protein in the SC was somewhat unexpected in that not all GFP+ cells were positive for Gata2/FLAG (Fig 7B). Expression was detected only in a subset of electroporated cells in the deep layers (Sector A) of the SC and no exogenously expressed protein was found in electroporated cells within Sectors B or C. Comparable results were found with both rat Gata2 and human Gata2. These observations suggest that expression of Gata2 protein may be subject to differential post-translational mechanisms in the SC and that translation or stability of Gata2 protein may be diminished in specific neuronal populations. This mechanism could explain in part why endogenous Gata2 protein levels dramatically fall when neuronal cells enter the SC and the apparent lack of effect of exogenous Gata2 on neuronal migration. The capacity of hGata2 to fully rescue from knockdown of endogenous Gata2 further indicates that sufficient levels of the human protein are expressed in the IZ during the critical period prior to e21 to promote proper migration and differentiation.
Gata2 knockdown in the dorsal mesencephalon interferes with differentiation of neuronal precursors
The above findings indicate that Gata2 plays an important role in permitting migration of immature neuronal precursors from the IZ into the SC. To discern whether loss of Gata2 limits migration alone or whether this is in addition to or secondary to impingement on postmitotic precursor differentiation, we performed additional marker analyses of the electroporated cells. One possibility was that Gata2 loss causes precocious differentiation of precursors into mature neurons which in turn impairs migration. However, both knockdown and control electroporated cells in Sector A lacked expression of neuronal markers β-III-tubulin or NeuN (Fig 8A,B).
Figure 8
Figure 8
Gata2 is required for differentiation of SC neural precursors
The appearance of endogenous Gata2 protein in postmitotic neuronal precursors raises the possibility that it is necessary for cell cycle exit, as reported in the chick spinal cord (El-Wakil et al., 2006), and that its knockdown may induce cells outside the VZ to remain in or re-enter the cell cycle. However, Ki67 staining indicated that Gata2 loss did not block proliferation within the VZ or stimulate mitosis outside the VZ (data not shown and Fig 8C). Moreover, cells in Sector A outside the VZ that were electroporated with Gata2 shRNAs were negative for the radial glial marker BLBP (Fig 8D).
Because Gata2 is highly expressed in immature neuronal precursors, we reasoned that it might play a role in their differentiation into mature neurons and that Gata2 loss would result in retention of co-expressed markers such as Ascl1 and Pax3/7 that are present before its induction and that are extinguished in SC neurons. At e21, endogenous Ascl1 is sparsely expressed within, and is limited to, a 4–5 cell deep zone in Sector A at the junction between the VZ and the deepest neuronal layers of the SC. This largely corresponds with the area of greatest migration arrest caused by Gata2 knockdown. For cells electroporated with control or Gata2 shRNAs, all Ascl1 expression was within this zone. Strikingly, Gata2 knockdown increased the proportion of electroporated cells in this region that were Ascl1+ by 2–3-fold (Fig 8E,G).
The endogenous expression pattern of Pax3 at e21 is quite different from Ascl1 and includes nearly all cells within the VZ and within Sector A below the neuronal layers of the SC. In addition, all neuronal layers in the SC (i.e., within Sectors A–C) contain a sparse population of Pax3 cells. Examination of electroporated cells for Pax3 revealed no expression within Sectors B and C, irrespective of whether they received control or siGata2 plasmids (data not shown). However, Pax3 was present in a subpopulation of electroporated cells within the neuronal layers of Sector A and the proportion of such cells was 2.5-fold higher for those receiving siGata2 compared with those receiving control plasmid (Fig 8F,H). We also examined Pax7 which showed strong expression in a subpopulation of neurons within Sectors B and C, but was absent from Sector A. In contrast to Pax3, Pax7 was absent from cells in Sector A electroporated with either control or Gata2 shRNA plasmids.
We additionally assessed Sox2 and Msi1 which are co-expressed at e15 with Gata2. At e21 Sox2 is present in all VZ cells and in isolated cells distributed throughout the SC. The majority of both knockdown and control cells present in Sector A were Sox2+. In contrast, by e21 Msi1 expression was restricted to the VZ and absent from Gata2 knockdown or control cells (data not shown).
To determine whether Gata2 knockdown cells persist in an immature state, animals electroporated at e16 with siGata2-1 were allowed to develop until p5 when SC neurogenesis is nearly complete. Similarly to e21, the Gata2 knockdown cells in the deep layers of the SC at p5 were still positive for Pax3 and Sox2 (Fig 9), and exhibited an immature radially-oriented unipolar and bipolar morphology. In contrast, Ascl1 and Msi1 were undetectable. Taken together, these findings support the idea that Gata2 plays a critical role in differentiation of post-mitotic neuronal precursor cells in the dorsal mesencephalon and that its loss arrests them at an early stage of maturation characterized by retention of Pax3 and Sox2.
Figure 9
Figure 9
Pax3 and Sox2 expression are retained in Gata2 knockdown cells postnatally
Gata2 is expressed in post-mitotic dorsal midbrain neuronal precursors
Although Gata2 plays a central position in hematopoiesis and stem cell maintenance (Shimizu et al., 2005), its function within neural tissues has only recently come into focus. Evidence suggests that Gata2 operates in discrete neuronal subtype lineages and first appears during intermediate stages of differentiation after commitment to a neuronal fate. In some cases, expression is transitory and downregulated before terminal differentiation (mesencephalic precursors) and in others is retained in differentiated cells (serotonergic and V2 spinal interneurons). In another instance, r4 vestibuloacoustic neurons, Gata2 directs axon pathfinding (Bell et al., 1995; Nardelli et al., 1999). It thus appears that Gata2’s roles in neuronal cells are both varied and subtype-dependent.
Gata2 was detected in a restricted pattern in developing chick optic tectum (Kornhauser et al., 1993) and mouse SC (Zhou et al., 2000) that decreased with differentiation (Herberth et al., 2005). Kala et al. (2009) also reported transient Gata2 expression in developing mouse midbrain. A detailed description of Gata2 protein expression in developing mammalian dorsal midbrain has not been previously presented. Our findings confirm widespread transient midbrain expression in embryonic rat.
One excluded population was ventral tyrosine hydroxylase positive neurons, Gata2 has been detected in human substantia nigra and in cultured midbrain dopaminergic neurons, and dopaminergic cell lines (Scherzer et al., 2008; Polanski et al., 2010). This suggests that expression in such neurons appears at a relatively late developmental stage. In consonance, we noted emergent Gata2 expression in ventral midbrain structures during late embryogenesis. Thus, in midbrain, both Gata2 regulation and function appear to differ among neuronal subtypes.
In rat dorsal mesencephalon, the earliest Gata2 expression appeared at e15. The deep-layer periventricular SC neuronal population has formed by this stage, so Gata2 doesn’t appear necessary for their differentiation. From e15–e18, positioning of Gata2+ cells in dorsal midbrain beneath the neuronal layer but above the proliferating VZ, along with co-expression with immature markers, indicates that Gata2 is expressed in post-mitotic neuronal precursors migrating to the superficial laminae of the SC.
One emerging theme is that Gata2 is induced in postmitotic neuronal precursors expressing bHLH proneural and homeodomain transcription factors. In developing sympathetic ganglia, Gata2 is induced after sequential expression of Ascl1, Phox2b, Phox2a, and Hand2, but before catecholaminergic markers (Groves et al., 1995). Gata2 loss-of-function in chick reduces sympathetic ganglion size and tyrosine hydroxylase and NF-160 expression (Tsarovina et al., 2004). Gata2 is also co-expressed with Ascl1 and the bHLH transcription factor Helt in early ventral midbrain (Kala et al., 2009). In hindbrain and early IC, Gata2 is induced in Nkx2.2 and Nkx6.1-expressing progenitors and acts to specify serotonergic and GABAergic fate, respectively (Craven et al., 2004; Kala et al., 2009).
Gata2 can be dynamically regulated throughout cell cycle (Koga et al., 2007), and its electroporation into chick spinal cord induces precocious differentiation and cell cycle exit (El Wakil et al., 2006). However, as in ventral midbrain (Kala et al., 2009) in dorsal midbrain, we observed that Gata2 first appears after cell cycle exit and that Gata2 knockdown has no effect on proliferation within or outside of the VZ.
Gata2 is essential for migration and differentiation of neuronal precursor cells that populate the SC retinotectal laminae
We employed in utero shRNA electroporation to interfere with Gata2 induction in neuronal precursors following their exit from the VZ. This approach permits labeling and tracking of individual cells in which Gata2 protein levels have been manipulated. Dorsal midbrain progenitors electroporated with pCMS-EGFP at e16 generate cells that, based on their positions at e20, colonize the middle and outermost laminae of the SC. These appear to correspond to the second and third waves of developmental migration described in chick optic tectum (LaVail and Cowan, 1971; Sugiyama and Nakamura, 2003). Gata2 knockdown at e16 greatly diminished the proportion of cells migrating to the retinorecipient laminae of the SC. Thus, Gata2 plays an essential role in development of this important neuronal population. On the other hand, those electroporated cells reaching these laminae appeared morphologically typical and were NeuN+, indicating normal migration and differentiation. This could reflect either the timing or extent of Gata2 knockdown or that Gata2 is required for migration and differentiation of only a subpopulation of neurons in these laminae.
We observed little or no effect of Gata2 knockdown on the proportion of cells reaching the middle strata of the SC (sector B). It is possible that such neurons do not require Gata2 for migration and differentiation or that they were destined for the outer laminae but failed to properly migrate/differentiate. Characterization of Gata2 knockdown cells in the middle laminae yielded ambiguous results; those receiving siGata2-1 were NeuN- while those electroporated with siGata2-2 were NeuN+. While this may reflect the difference in efficacy between the two constructs, we cannot presently draw a clear interpretation.
While Gata2 knockdown significantly reduced migration of cells to the outer SC, it conversely increased the proportion that inappropriately migrated and that accumulated in the periventricular zone and lower laminae of the SC. Marker studies indicated that these were non-mitotic and neither radial glia nor neurons. Rather, a substantial proportion retained Ascl1, Sox2 and Pax3 at e21 and Pax3 and Sox2 at p5. This phenotype strongly suggests that Gata2 loss traps cells in a neuronal precursor state that fails to further mature or to properly migrate. Gata2 therefore appears necessary for transition of neuronal precursors into those neurons that populate the retinorecipient laminae of the SC. This function is distinct from that in early ventral midbrain where Gata2 is required for selection between GABAergic and glutamatergic fates (Kala et al., 2009). Of potential relevance, Gata2 expression is subject to differential use of regulatory elements in dorsal and ventral midbrain (Nozawa et al., 2009).
Co-expression of Gata2 with Ascl1, Sox2 and Pax3 and their retention in Gata2 knockdown cells raises the possibility of reciprocal regulation. In ventral midbrain, Helt (but not Ascl1) is required for early Gata2 induction (Kala et al., 2009). The mechanisms of Gata2 induction in dorsal midbrain remain to be seen. Ascl1, Sox2 and Pax3 are expressed in the VZ where Gata2 is absent, indicating that they are not sufficient to induce Gata2. On the other hand, expression of these factors is extinguished just below the deepest layers of the SC in cells still expressing Gata2. This raises the possibility that Gata2 suppresses Ascl1, Pax3 and/or Sox2 expression in late neuron precursors before they fully differentiate. Consistent with this, a substantial proportion of Gata2 knockdown cells retained these factors.
It is presently unclear whether Pax3 and Sox2 retention by Gata2 knockdown cells merely reflects their immature nature, or whether such markers help maintain this state. Of potential relevance, Pax3 over-expression in neural tube interferes with differentiation of floor plate and mesencephalon and reduces production of thoracic motoneurons (Tremblay et al., 1996). Moreover, knockdown studies indicate that in ND7 cells, Pax3 prevents neuronal differentiation, (Reeves et al., 1999). Also, activated Sox2 over-expression in cortex inhibits neurogenesis (Bani-Yaghoub et al., 2006).
We found that electroporation with Gata2 failed to affect normal neuronal migration or differentiation. Interestingly, immunofluorescence detected exogenous Gata2 only in a subset of transfected cells within Sector A. This was not due to faulty vector expression since hGATA2 robustly rescued cells from defects caused by mGata2 shRNAs. Rather, the absence of detectable exogenous Gata2 in electroporated cells within Sectors B and C suggests a stringent control over Gata2 protein expression in SC neurons. One possibility is degradation, supported by findings that Gata2 undergoes rapid proteasomal turnover in various cellular contexts (Minegishi et al., 2005; Koga et al., 2007; Lurie et al., 2008). This may be relevant to the extinction of Gata2 expression as neuron precursors enter the SC and mature. However, transcriptional down-regulation of endogenous Gata2 also seems likely, as occurs in NGF-treated PC12 cells.
Gata2 function is associated with the bHLH cofactor SCL/Tal1 which is crucial in blood progenitors to confer binding specificity to target genes. During hematopoiesis, Gata2 induces SCL (Chan et al., 2007; Lugus et al., 2007), acts combinatorially with SCL (Wadman et al., 1997) and colocalizes on chromatin with SCL (Wozniak et al., 2008). SCL is expressed in midbrain neuronal precursors and SC cells (van Eekelen et al., 2003; Bradley et al., 2006) and loss of SCL expression in neuronal precursors impairs SC development and causes visual impairment (Bradley et al., 2006). These findings suggest that Gata2 and SCL function together to regulate differentiation of neuronal precursors destined for the SC.
In summary, during dorsal midbrain neurogenesis, cells pass through stages of lineage commitment. Post-mitotic neuronal precursor cells within the dorsal midbrain express Gata2 and lose such expression when they further differentiate into neurons that populate the retinorecipient layers of the SC. (Fig 10). Such expression is necessary for normal migration and differentiation. When Gata2 induction is prevented, precursor cell differentiation is arrested and they fail to undergo transition to retinorecipient SC neurons. It remains to be seen whether these effects on differentiation and migration are independent of one another or whether they reflect the same defects.
Figure 10
Figure 10
Model of Gata2 expression and function in the developing SC
Acknowledgments
This work was supported in part by grants from the NIH/NINDS (NIH T32 GM007182, NS33689 and P50_NS038370). We thank Drs. Jin-Wu Tsai and Richard Vallee for aid with in utero electroporation.
  • Aletta JM, Angeletti R, Liem RK, Purcell C, Shelanski ML, Greene LA. Relationship between the nerve growth factor-regulated clone 73 gene product and the 58-kilodalton neuronal intermediate filament protein (peripherin) J Neurochem. 1988;51:1317–1320. [PubMed]
  • Altman J, Bayer SA. Atlas of prenatal rat brain development. Boca Raton, Fla: CRC Press; 1995.
  • Bani-Yaghoub M, Tremblay RG, Lei JX, Zhang D, Zurakowski B, Sandhu JK, Smith B, Ribecco-Lutkiewicz M, Kennedy J, Walker PR, Sikorska M. Role of Sox2 in the development of the mouse neocortex. Dev Biol. 2006;295:52–66. [PubMed]
  • Bell E, Lumsden A, Graham A. Expression of GATA-2 in the developing avian rhombencephalon. Mech Dev. 1999;84:173–176. [PubMed]
  • Biswas SC, Zhang Y, Iyirhiaro G, Willett RT, Rodriguez Gonzalez Y, Cregan SP, Slack RS, Park DS, Greene LA. Sertad1 plays an essential role in developmental and pathological neuron death. J Neurosci. 2010;30:3973–3982. [PMC free article] [PubMed]
  • Bradley CK, Takano EA, Hall MA, Gothert JR, Harvey AR, Begley CG, van Eekelen JA. The essential haematopoietic transcription factor Scl is also critical for neuronal development. Eur J Neurosci. 2006;23:1677–1689. [PubMed]
  • Bylund M, Andersson E, Novitch BG, Muhr J. Vertebrate neurogenesis is counteracted by Sox1-3 activity. Nat Neurosci. 2003;6:1162–1168. [PubMed]
  • Chan WY, Follows GA, Lacaud G, Pimanda JE, Landry JR, Kinston S, Knezevic K, Piltz S, Donaldson IJ, Gambardella L, Sablitzky F, Green AR, Kouskoff V, Gottgens B. The paralogous hematopoietic regulators Lyl1 and Scl are coregulated by Ets and GATA factors, but Lyl1 cannot rescue the early Scl−/− phenotype. Blood. 2007;109:1908–1916. [PubMed]
  • Craven SE, Lim KC, Ye W, Engel JD, de Sauvage F, Rosenthal A. Gata2 specifies serotonergic neurons downstream of sonic hedgehog. Development. 2004;131:1165–1173. [PubMed]
  • Cunningham ME, Kitajewski JK, Greene LA. Efficient generation of stable pheochromocytoma (PC12) cell lines using a recombinant retrovirus (LNC) Methods Mol Biol. 2001;169:135–147. [PubMed]
  • El Wakil A, Francius C, Wolff A, Pleau-Varet J, Nardelli J. The GATA2 transcription factor negatively regulates the proliferation of neuronal progenitors. Development. 2006;133:2155–2165. [PubMed]
  • Fedtsova N, Quina LA, Wang S, Turner EE. Regulation of the development of tectal neurons and their projections by transcription factors Brn3a and Pax7. Dev Biol. 2008;316:6–20. [PMC free article] [PubMed]
  • Gradwohl G, Fode C, Guillemot F. Restricted expression of a novel murine atonal-related bHLH protein in undifferentiated neural precursors. Dev Biol. 1996;180:227–241. [PubMed]
  • Graham V, Khudyakov J, Ellis P, Pevny L. SOX2 functions to maintain neural progenitor identity. Neuron. 2003;39:749–765. [PubMed]
  • Gray GE, Sanes JR. Migratory paths and phenotypic choices of clonally related cells in the avian optic tectum. Neuron. 1991;6:211–225. [PubMed]
  • Greene LA, Tischler AS. Establishment of a noradrenergic clonal line of rat adrenal pheochromocytoma cells which respond to nerve growth factor. Proc Natl Acad Sci U S A. 1976;73:2424–2428. [PubMed]
  • Groves AK, George KM, Tissier-Seta JP, Engel JD, Brunet JF, Anderson DJ. Differential regulation of transcription factor gene expression and phenotypic markers in developing sympathetic neurons. Development. 1995;121:887–901. [PubMed]
  • Herberth B, Minko K, Csillag A, Jaffredo T, Madarasz E. SCL, GATA-2 and Lmo2 expression in neurogenesis. Int J Dev Neurosci. 2005;23:449–463. [PubMed]
  • Holubec H, Payne CM, Bernstein H, Dvorakova K, Bernstein C, Waltmire CN, Warneke JA, Garewal H. Assessment of apoptosis by immunohistochemical markers compared to cellular morphology in ex vivo-stressed colonic mucosa. J Histochem Cytochem. 2005;53:229–235. [PubMed]
  • Kala K, Haugas M, Lillevali K, Guimera J, Wurst W, Salminen M, Partanen J. Gata2 is a tissue-specific post-mitotic selector gene for midbrain GABAergic neurons. Development. 2009;136:253–262. [PubMed]
  • Kaneko Y, Sakakibara S, Imai T, Suzuki A, Nakamura Y, Sawamoto K, Ogawa Y, Toyama Y, Miyata T, Okano H. Musashi1: an evolutionally conserved marker for CNS progenitor cells including neural stem cells. Dev Neurosci. 2000;22:139–153. [PubMed]
  • Karunaratne A, Hargrave M, Poh A, Yamada T. GATA proteins identify a novel ventral interneuron subclass in the developing chick spinal cord. Dev Biol. 2002;249:30–43. [PubMed]
  • Koga S, Yamaguchi N, Abe T, Minegishi M, Tsuchiya S, Yamamoto M, Minegishi N. Cell-cycle-dependent oscillation of GATA2 expression in hematopoietic cells. Blood. 2007;109:4200–4208. [PubMed]
  • Kornhauser JM, Leonard MW, Yamamoto M, LaVail JH, Mayo KE, Engel JD. Temporal and spatial changes in GATA transcription factor expression are coincident with development of the chicken optic tectum. Brain Res Mol Brain Res. 1994;23:100–110. [PubMed]
  • LaVail JH, Cowan WM. The development of the chick optic tectum. II. Autoradiographic studies. Brain Res. 1971;28:421–441. [PubMed]
  • Lugus JJ, Chung YS, Mills JC, Kim SI, Grass J, Kyba M, Doherty JM, Bresnick EH, Choi K. GATA2 functions at multiple steps in hemangioblast development and differentiation. Development. 2007;134:393–405. [PubMed]
  • Lurie LJ, Boyer ME, Grass JA, Bresnick EH. Differential GATA factor stabilities: implications for chromatin occupancy by structurally similar transcription factors. Biochemistry. 2008;47:859–869. [PubMed]
  • Minegishi N, Suzuki N, Kawatani Y, Shimizu R, Yamamoto M. Rapid turnover of GATA-2 via ubiquitin-proteasome protein degradation pathway. Genes Cells. 2005;10:693–704. [PubMed]
  • Murakami R, Okumura T, Uchiyama H. GATA factors as key regulatory molecules in the development of Drosophila endoderm. Dev Growth Differ. 2005;47:581–589. [PubMed]
  • Nakamura H. Regionalisation and acquisition of polarity in the optic tectum. Prog Neurobiol. 2001;65:473–488. [PubMed]
  • Nardelli J, Thiesson D, Fujiwara Y, Tsai FY, Orkin SH. Expression and genetic interaction of transcription factors GATA-2 and GATA-3 during development of the mouse central nervous system. Dev Biol. 1999;210:305–321. [PubMed]
  • Nozawa D, Suzuki N, Kobayashi-Osaki M, Pan X, Engel JD, Yamamoto M. GATA2-dependent and region-specific regulation of Gata2 transcription in the mouse midbrain. Genes Cells. 2009;14:569–582. [PubMed]
  • O’Leary DD, McLaughlin T. Mechanisms of retinotopic map development: Ephs, ephrins, and spontaneous correlated retinal activity. Prog Brain Res. 2005;147:43–65. [PubMed]
  • Osorio J, Mueller T, Retaux S, Vernier P, Wullimann MF. Phylotypic expression of the bHLH genes Neurogenin2, Neurod, and Ascl1 in the mouse embryonic forebrain. J Comp Neurol. 2010;518:851–871. [PubMed]
  • Patient RK, McGhee JD. The GATA family (vertebrates and invertebrates) Curr Opin Genet Dev. 2002;12:416–422. [PubMed]
  • Polanski W, Enzensperger C, Reichmann H, Gille G. The exceptional properties of 9-methyl-beta-carboline: stimulation, protection and regeneration of dopaminergic neurons coupled with anti-inflammatory effects. J Neurochem 2010 [PubMed]
  • Reeves FC, Burdge GC, Fredericks WJ, Rauscher FJ, Lillycrop KA. Induction of antisense Pax-3 expression leads to the rapid morphological differentiation of neuronal cells and an altered response to the mitogenic growth factor bFGF. J Cell Sci. 1999;112 (Pt 2):253–261. [PubMed]
  • Sakakibara S, Nakamura Y, Yoshida T, Shibata S, Koike M, Takano H, Ueda S, Uchiyama Y, Noda T, Okano H. RNA-binding protein Musashi family: roles for CNS stem cells and a subpopulation of ependymal cells revealed by targeted disruption and antisense ablation. Proc Natl Acad Sci U S A. 2002;99:15194–15199. [PubMed]
  • Scherzer CR, Grass JA, Liao Z, Pepivani I, Zheng B, Eklund AC, Ney PA, Ng J, McGoldrick M, Mollenhauer B, Bresnick EH, Schlossmacher MG. GATA transcription factors directly regulate the Parkinson’s disease-linked gene alpha-synuclein. Proc Natl Acad Sci U S A. 2008;105:10907–10912. [PubMed]
  • Shimizu R, Yamamoto M. Gene expression regulation and domain function of hematopoietic GATA factors. Semin Cell Dev Biol. 2005;16:129–136. [PubMed]
  • Sugiyama S, Nakamura H. The role of Grg4 in tectal laminar formation. Development. 2003;130:451–462. [PubMed]
  • Thompson J, Lovicu F, Ziman M. The role of Pax7 in determining the cytoarchitecture of the superior colliculus. Dev Growth Differ. 2004;46:213–218. [PubMed]
  • Thompson JA, Zembrzycki A, Mansouri A, Ziman M. Pax7 is requisite for maintenance of a subpopulation of superior collicular neurons and shows a diverging expression pattern to Pax3 during superior collicular development. BMC Dev Biol. 2008;8:62. [PMC free article] [PubMed]
  • Tong Q, Dalgin G, Xu H, Ting CN, Leiden JM, Hotamisligil GS. Function of GATA transcription factors in preadipocyte-adipocyte transition. Science. 2000;290:134–138. [PubMed]
  • Tremblay P, Pituello F, Gruss P. Inhibition of floor plate differentiation by Pax3: evidence from ectopic expression in transgenic mice. Development. 1996;122:2555–2567. [PubMed]
  • Tsai FY, Keller G, Kuo FC, Weiss M, Chen J, Rosenblatt M, Alt FW, Orkin SH. An early haematopoietic defect in mice lacking the transcription factor GATA-2. Nature. 1994;371:221–226. [PubMed]
  • Tsarovina K, Pattyn A, Stubbusch J, Muller F, van der Wees J, Schneider C, Brunet JF, Rohrer H. Essential role of Gata transcription factors in sympathetic neuron development. Development. 2004;131:4775–4786. [PubMed]
  • van Eekelen JA, Bradley CK, Gothert JR, Robb L, Elefanty AG, Begley CG, Harvey AR. Expression pattern of the stem cell leukaemia gene in the CNS of the embryonic and adult mouse. Neuroscience. 2003;122:421–436. [PubMed]
  • Wadman IA, Osada H, Grutz GG, Agulnick AD, Westphal H, Forster A, Rabbitts TH. The LIM-only protein Lmo2 is a bridging molecule assembling an erythroid, DNA-binding complex which includes the TAL1, E47, GATA-1 and Ldb1/NLI proteins. EMBO J. 1997;16:3145–3157. [PubMed]
  • Wozniak RJ, Keles S, Lugus JJ, Young KH, Boyer ME, Tran TM, Choi K, Bresnick EH. Molecular hallmarks of endogenous chromatin complexes containing master regulators of hematopoiesis. Mol Cell Biol. 2008;28:6681–6694. [PMC free article] [PubMed]
  • Xu Z, Maroney AC, Dobrzanski P, Kukekov NV, Greene LA. The MLK family mediates c-Jun N-terminal kinase activation in neuronal apoptosis. Mol Cell Biol. 2001;21:4713–4724. [PMC free article] [PubMed]
  • Zhou Y, Yamamoto M, Engel JD. GATA2 is required for the generation of V2 interneurons. Development. 2000;127:3829–3838. [PubMed]