PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Mitochondrion. Author manuscript; available in PMC 2012 May 1.
Published in final edited form as:
PMCID: PMC3075320
NIHMSID: NIHMS277465
Impairment of mitochonrial tRNAIle processing by a novel mutation associated with chronic progressive external ophthalmoplegia
A Schaller,1 R Desetty,2 D Hahn,3 C B Jackson,1 J-M Nuoffer,3 S Gallati,1 and L Levinger2
1Division of Human Genetics, University Hospital Bern, Switzerland
2Department of Biology, York College/CUNY, Jamaica, NY
3Institute of Clinical Chemistry, University Hospital Bern, Switzerland
Corresponding author: André Schaller, Division of Human Genetics, Department of Paediatrics, Inselspital Bern, 3010 Bern, Phone: ++41 31 632 78 45, Fax: ++41 632 94 84, andre.schaller/at/insel.ch
We report a sporadic case of chronic progressive external ophthalmoplegia associated with ragged red fibers. The patient presented with enlarged mitochondria with deranged internal architecture and crystalline inclusions. Biochemical studies showed reduced activities of complex I, III and IV in skeletal muscle. Molecular genetic analysis of all mitochondrial tRNAs revealed a G to A transition at nt 4308; the G is a highly conserved nucleotide that participates in a GC base-pair in the T-stem of mammalian mitochondrial tRNAIle. The mutation was detected at a high level (approx. 50%) in muscle but not in blood. The mutation co-segregated with the phenotype, as the mutation was absent from blood and muscle in the patient’s healthy mother. Functional characterisation of the mutation revealed a six-fold reduced rate of tRNAIle precursor 3’ end maturation in vitro by tRNAse Z. Furthermore, the mutated tRNAIle displays local structural differences from wild-type. These results suggest that structural perturbations reduce efficiency of tRNAIle precursor 3’ end processing and contribute to the molecular pathomechanism of this mutation.
Mutations in the mitochondrial genome occur 10- to 17-fold more frequently than in the nuclear genome (Pesole et al., 1999). Mitochondrial tRNA genes (MTT) appear to be particularly frequently affected by pathogenesis-related mutations. Although MTT only account for approximately 10% of the mitochondrial genome, more than 150 of the so far over 220 disease correlated mutations are located in MTT (for a compilation, see MITOMAP: A Human Mitochondrial Genome Database. http://www.mitomap.org, 2009). These genes are thus hot-spots for mutation-based mitochondrial pathogenesis. The molecular consequences of these base substitutions with respect to tRNA structure and function are largely unclear, however, and so is the molecular pathology. Furthermore, there is no general rule to distinguish between pathogenic and polymorphic mutations. The mere presence of a mutation in a MTT, even in a conserved position, is not sufficient to predict its pathogenicity as there are known pathogenic mutations located at non-conserved nucleotides, and polymorphic mutations located at conserved nucleotides (Florentz and Sissler, 2001). Thus, molecular investigations are required to confirm the pathogenicity of mutations in the MTT and characterise the underlying molecular mechanism. Presumably, defects in translation of mitochondrial mRNAs would arise from structural changes in the tRNAs. These changes could affect excision of the tRNA by RNase P and tRNase Z, affecting the mRNA function in translation and could also reduce the level of a mature tRNA at the level of removal of the leader and trailer, the addition of CCA that follows endonucleolytic removal of the 3’ end trailer by tRNase Z, subsequent aminoacylation and the interaction of the aminoacyl-tRNA with translation factors and the mitoribosome. In this study, we have analyzed the in vitro processing of pre-tRNAs by tRNase Z, a reaction that is central to the maturation and function of the tRNAs in mitochondrial translation (reviewed in Levinger et al. (Levinger et al., 2004)).
In vivo studies are complicated by a varying degree of heteroplasmy and variable nuclear genetic background, and limited by the availability of biopsy material. However, development of in vitro systems which can directly address potential underlying molecular mechanisms enabled us to analyse the effect of mutations in tRNA genes on a critical step in mitochondrial biogenesis (Rossmanith et al., 1995). Chronic progressive external ophthalmoplegia (CPEO) is a common clinical feature of mitochondrial diseases (DiMauro and Schon, 2008). It presents often as ptosis followed by a gradual involvement of the extraocular muscles in combination with variable degrees of oropharyngeal and limb weakness. The underlying genetic basis of CPEO is, however, heterogenous. CPEO is often caused by large-scale mtDNA rearrangements (deletions and/or duplications). Whereas multiple deletions are often observed in autosomal dominant or recessive forms of CPEO (Hirano and DiMauro, 2001), sporadic single deletions are thought to arise during in oogenesis or early embryonic development. Furthermore, in some cases CPEO is maternally inherited due to point mutations in the mtDNA (McFarland et al., 2010). Specifically, an adult patient presenting with CPEO was found to harbour a substitution (m.4308G>A) in the T-stem of mitochondrial tRNAIle that has not been previously observed. To date 14 substitutions in tRNAIle have been linked to mitochondrial diseases: m.4267A>G (Taylor et al., 2002), m.4269A>G (Degoul et al., 1998; Hayashi et al., 1994; Kaido et al., 1995; Taniike et al., 1992), m.4274T>C (Borthwick et al., 2006; Chinnery et al., 1997), m.4284G>A (Corona et al., 2002), m.4285T>C (Silvestri et al., 1996), m.4290T>C (Limongelli et al., 2004), m.4291T>C (Wilson et al., 2004), m.4295A>G (Merante et al., 1996), m.4298G>A (Taylor et al., 1998), m.4300A>G (Casali et al., 1995; Taylor et al., 2003), m.4302A>G (Berardo et al., 2010), m.4309G>A (Campos et al., 2002; Franceschina et al., 1998), m.4317A>G (Degoul et al., 1998; Obayashi et al., 1992; Ozawa et al., 1991a; Ozawa et al., 1991b; Tanaka et al., 1990) and m.4320C>T (Santorelli et al., 1995). Seven of them are associated with CPEO (in italics) suggesting that tRNAIle could be a hotspot for CPEO. We report herein the effects of the m.4308G>A substitution on the endonucleolytic cleavage of the 3’ end trailer that is central to pre-tRNA maturation and on the tRNAIle structure.
Patient
The 33-year-old woman presented in a peripheral Hospital after her second syncope in a six months interval. History revealed a progressive weight loss in the past two years although the appetite was normal and there were no gastrointestinal symptoms. The BMI at presentation was 16.9 kg/m2, She had a general exercise intolerance with problems in stair climbing and amenorrhea. The examination showed a bilateral ptosis, an impairment of vertical and left gaze whereas right gaze was almost normal. There was no nystagmus and the fundus and visual fields were normal. Further Investigations including audiometry, EEG, brain MRI, echocardiogram, Liquor protein, glucose and lactate were all normal. The electrocardiogram showed ventricular extrasystola without other arrhythmia. The family history was non informative. She had two healthy siblings and was the mother of two healthy children. In the five year follow up the patient developed a clear progression of the muscular symptoms with a complete external ophtalmoplegia and a proximal myopathy with disabling muscular cramps. There further is an increased frequency of neurocardiogenic syncopes as documented with a pathological Tilt test. Brain MRI, EEG and Holter ECG remained normal. The patient was treated symptomatically and with a vitamin cocktail, carnitine and coenzyme Q10.
All participating individuals gave informed consent. The study protocol was approved by the local ethical commission.
Electron microscopy
Skeletal muscle was fixed with 2.5% glutaraldehyde in 0.1M cacodylate buffer (pH 7.4), post-fixed with 1% osmium tetroxide, dehydrated through ascending concentrations of alcohol and embedded in Epon812. Ultrathin sections were obtained routinely at 60 nm thickness on a Reichert-Jung Ultracut ultramicrotome equipped with a diamond knife (Diatome, Switzerland), stained with uranylacetate and leadcitrate using EMstain (Leica, Austria) and observed in a Philips CM12 electron microscope at 80 kv equipped with a Morada digital camera using iTEM software.
OXPHOS assays
Skeletal muscle homogenates (600 g supernatants) were prepared as described previously (Birch-Machin and Turnbull, 2001; Rustin et al., 1994). The activities of the individual respiratory chain complexes and the mitochondrial matrix marker enzyme citrate synthase in skeletal muscle homogenates were measured spectrophotometrically with an UV-1601 spectrophotometer (Shimadzu) using 1 ml sample cuvettes thermostatically maintained at 30° C according to Birch-Machin and Turnbull (2001) (Birch-Machin and Turnbull, 2001). Values were estimated by the difference in activity levels measured in the presence and absence of specific inhibitors and are expressed relative to the mitochondrial marker enzyme citrate synthase (mU/mU citrate synthase), determined as described (Shepherd and Garland, 1969).
Molecular genetic analysis
Total DNA extraction from EDTA-blood and skeletal muscle were performed according to standard isolation protocols (Qiagen). Large-scale rearrangements were excluded by long polymerase chain reaction (PCR) as described previously(Kleinle et al., 1997). mtDNA was screened for mutations by PCR and subsequent single strand conformation polymorphism as previously described (Kleinle et al., 1998; Liechti-Gallati et al., 1999). The tRNAIle gene encompassing the mutation was amplified using the forward (nucleotide position nt 4218-4237) and reverse complementary (nt 4516-4497) primers according to the Cambridge sequence of Anderson et al. (Anderson et al., 1981). Direct sequencing of the PCR products was performed on an ABI 3100 DNA Sequencer (Applied Biosystems) using the ABI PRISM BigDye Terminator Cycle Sequencing Kit.
Heteroplasmy of the G4308A mtDNA point mutation was investigated by PCR amplification of a convenient mtDNA fragment using the following primers: forward, 4212-4233; reverse, 4309-4330 (C/A mismatch at position 4311 introducing a BglII restriction site in mutant mtDNA). Mutant loads were evaluated by fluorescent last cycle PCR (Valentino et al., 2002) using a 5’-FAM labeled forward primer, BglII digestion and subsequent separation of fragments on an agarose gel and for quantification on an ABI 3100 DNA Sequencer.
Preparation of tRNA precursor
A 71 nt long oligonucleotide reverse primer (5’-GCGCGGATCCCGGGTTCGATTCTCATAGTCCTAGAAATAAGGGGGTTTATGCTC TTATTATTTACTCTATC-3’; the mismatched nucleotide for mutagenesis to produce m.4308G>A is double-underlined) was used to reconstruct the BamHI subcloning site, SmaI runoff site, 20 nt natural sequence of 3’ end trailer, the entire T arm and variable including the m.4308G>A (50G>A) substitution. The 33 nt long universal forward primer (5’-GCGCGAATTCTAATACGACTCACTATAGGGAGA-3’) reconstructed the EcoRI subcloning site, T7 promoter and strong start (GGGAGA). The template for amplification was wild type tRNAIle including the hammerhead for cleavage at +1 of the tRNA (original hammerhead construct was a gift of S. Kelley (Kelley et al., 2001)). The amplified DNA segments were digested with EcoRI/BamHI, ligated into the subcloning vector, and confirmed by sequencing (Genewiz). Runoff templates were prepared by SmaI digestion.
Unlabeled transcripts were prepared with T7 RNA polymerase as previously described (Fechter et al., 1998), followed by phenol/chloroform deproteinization and ethanol precipitation before hammerhead self-cleavage of tRNAIle at the 5’ side of +1. tRNA precursors were purified from the hammerhead on denaturing 6% polyacrylamide gels, visualized by UV shadowing, extracted from gel slices by diffusion for 30 min at 37°C and recovered by ethan ol precipitation. Concentration of recovered tRNA was determined by reading A260, using a conversion factor of 875 000 A260 M−1.
RNA labeling
tRNA precursors were labeled at their 5’ ends with T4 polynucleotide kinase and [γ-32P]ATP for 30 min at 37°C using RNasin as a ribonucl ease inhibitor, gel purified, visualised by autoradiography, and recovered from the gel as described above.
tRNA refolding
Both labeled and unlabeled tRNAs were re-folded by heating in water for 2 min at 90°C, mixing briefly with an equal volume of heated buffer to a final concentration of 25 mM Tris-HCL pH 7.5, 250 mM KCL, 5 mM MgCl2 and 5% glycerol, and cooling to room temperature for 5 min.
3’ End processing
Human tRNase ZL was baculovirus expressed from a glycine at position 50 and affinity purified as previously described (Yan et al., 2006). Within the first 50 residues, tRNase ZL has a presumed mitochondrial targeting sequence with a predicted cleavage site at residue 30. There is also a methionine at r16 that could be the translation start for a nuclear-targeted tRNase Z. tRNase Z has been expressed from +1, 16, 31, 45, 50, 55 and 60, and the processing activity on a nuclear-encoded substrate was found to be the same, except that the +1 form expressed appeared to be lower in yield and more subject to degradation (Hopkinson and Levinger, unpublished).
tRNase ZL processing reactions (25 µl) were performed with labeled WT and m.4308G>A pre-tRNAIle substrates using 25 mM K-MOPS pH 6.75, 2 mM MgCl2, 1 mM dithiothreitol, 5% glycerol, 4 units/ml RNasin+ and 100 µg/ml bovine serum albumin at 37°C. Reactions were sampled and analyze d after 5, 10 and 15 minutes by transferring 5 µl to 2.5 µl of formamide-marker dye mix and electrophoresing on 6% denaturing polyacrylamide gels. Gels were dried and exposed overnight using a storage phospor screen which was scanned with the Typhoon and analyzed using ImageQuant. Efficiency experiments without added unlabeled substrates (data not shown) approximate zero order kinetics in which % product/minute of reaction (V/[S]) is proportional to V. Reaction velocities for variant and wild type pre-tRNA substrates were matched by adjusting enzyme concentrations.
Michaelis-Menten experiments were performed using unlabeled pre-tRNA substrate at 2, 5, 10, 20 and 50 nM with a constant (trace) concentration of labeled substrate. To obtain linear processing reactions over a range of substrate concentrations, tRNase Z was used at 2.5 pM for wild type pre-tRNAIle and at 12.5 pM for m.4308G>A pre-tRNAIle. As % product/minute (V/[S]) decreases with increasing [S], V (obtained by multiplying V/[S] by [S]) increases (Figure 5B, C). Each variant tRNA was analyzed in two or more kinetic experiments. Comparisons to determine relative kcat/KM (Figure 3, ,4;4; Table 2) were made between results of variant and wild type experiments performed on the same day.
Figure 5
Figure 5
The m.4308G>A substitution in tRNAIle causes structural rearrangements
Figure 3
Figure 3
tRNase ZL processing kinetics with the Wild Type and G4308A mutant of human mitochondrially encoded pre-tRNAIle
Figure 4
Figure 4
Structure probing of tRNAIle wild type and m.4308G>A
Table 2
Table 2
tRNase ZL Processing Kinetics with Wild Type tRNAIle and Pathogenesis-Associated T Stem Mutant Substrates
Structure probing
Structure probing of mitochondrial tRNAIle was performed substantially as previously reported (Levinger et al., 2003). For alkaline ladders, the end-labeled tRNA was incubated at 90°C for 10 min in 50 mM NaHCO 3, pH 9. For semi-denaturing (SD) ribonuclease (RNase) T1 reactions, the labeled tRNA was incubated at 50°C for 5 min in 12.5 mM Na citrate, pH 4.5, 3.5 M urea, 0.5 mM EDTA. Unlabeled Escherichia coli tRNA was used as a carrier at a final concentration of 1 µg/10 µl reaction. To achieve native conditions, tRNAs were refolded as described above for processing, and incubated in the processing buffer (but without RNasin) for 5 min at 37°C with the structure probing nucleases. Final concentrations were 1.0 and 2.5 X 10−2 U/µl (RNase T1; US Biochemical), 0.4 and 1 X 10−2 U/µl (RNase V1; Pierce), 0.4 and 1 X 10−2 U/µl (RNase If; New England Biolabs) or 0.8 and 2 X 10−7 U/ml (RNase A; Sigma). Native reactions were performed using processing buffer (with Tris-HCl pH 7 substituted for K-MOPS pH 6.75) at 37°C for 5 min. Reactions were terminated by placing samples at −20°C. For electrophoresis on 30 X 40 cm, 6, 8 or 10% denaturing polyacrylamide gels, 5 µl of formamide-marker dye mix was added and 7.5 µl samples were loaded directly, without heating, and electrophoresed until the bromophenol blue migrated to 10 cm above the bottom. Imaging and analysis were performed as for processing gels.
Ultrastructural examinations and biochemical assays
Electron microscopy examination showed myofibers containing increased amounts of lipid droplets and glycogen. In these fibers mitochondria were strikingly abnormal in appearance, abundance, and distribution (Fig. 1). While enlarged mitochondria were not present in all fibers; when present, however, the vast majority of mitochondria showed an aberrant morphology. They had disturbed internal organisation. Many exhibit concentrically arranged cristae and contained the classic “parking lot” inclusions. Further, subsarcolemmal aggregates of enlarged mitochondria are seen, producing the appearance of ragged red fibers. Subsequent measurement of the respiratory chain activities on muscle homogenate demonstrated a partial deficiency of the respiratory complexes I, III and IV containing mtDNA-encoded subunits, with normal SDH activity, whereas complex V remained in the lower reference range (Table 1).
Figure 1
Figure 1
Electron microscopy of cross section from limp muscle biopsy
Table 1
Table 1
Respiratory chain enzyme activities from patient muscle homogenate.
Genetic analysis
The clinical features and the histological and biochemical results from the patient’s muscle biopsy supported the diagnosis of a mitochondrial disorder, prompting us to analyse the mitochondrial genome. Large-scale rearrangements of mtDNA, which are the most frequent cause of CPEO, were excluded using long PCR (Kleinle et al., 1997). All 22 tRNAs were subjected to modified SSCP analysis followed by direct sequencing of polymorphic SSCP-fragments. We detected a novel G to A point mutation at nt 4308 in the mitochondrial tRNAIle-gene (Fig. 2A) which changes a nucleotide in the T-stem, disrupting a GC base pair close to the V-loop – T-stem boundary, which is strictly conserved in mammals. The mutation was present in heteroplasmic state in the patient’s skeletal muscle but not in blood (Fig. 2B). Quantification of the mutation using a last fluorescence cycle revealed 47% heteroplasmy. Mutated mtDNA was found neither in the mother’s blood nor in her skeletal muscle (Fig. 2B), suggesting a de novo mutation.
Figure 2
Figure 2
Analysis of the m.4308G>A mutation in the tRNAIle gene
Mitochondrial tRNAIle precursor 3’ end processing
Endonucleotlytic removal of the 3’ end trailer by tRNase Z is central to the maturation of human mitochondrial tRNA precursors. Precursor 3’ end processing kinetics were investigated using wild-type and G4308A mutant tRNAIle precursor containing a mature 5’ end and a 20 nt 3’ end trailer (Fig. 3A; arrow indicates the expected tRNAse Z cleavage site). Figure 3B and C illustrate the effect of the G4308A substitution on tRNase Z processing. Based on efficiency experiments (not shown), the tRNase Z reaction with m.4308G>A was performed at a 5X higher tRNase Z concentration than for WT to approximately match Vmax for WT tRNAIle and G4308A subtrates. This leads to a ~6X lower Kcat for m.4308G>A (Table 2). The G4308A mutant tRNAIle causes relatively little effect on KM (Table 2). The combined result is a ~ 5-fold overall reduction in processing efficiency (Kcat/Km) relative to wild-type (Table 2). Comparison with the previously identified mutation m.4309G>A (Franceschina et al., 1998) (also associated with CPEO) revealed a 2-fold more pronounced 3’ end processing deficiency than for the m.4308G>A mutant (Table 2 and Fig 4). Kcat relative to wild-type was 2 fold lower for m.4308G>A (0.15) than for m.4309G>A (0.32) (Table 2), whereas KM of m.4308G>A was slightly lower than wild-type compared with a slight increase in KM for m.4309G>A (Table 2). Along with the 5-fold lower 3’ end processing efficiency for the m.4308G>A mutant, we confirmed a 3-fold decrease in processing efficiency of the m.4309G>A mutant (Table 2).
Effect of the m.4308G>A substitution on tRNAIle precursor structure
Secondary structure probing nucleases were used to investigate precursor tRNAIle folding and to search for structural differences between the m.4308G>A mutant and wild-type tRNAIle. Ribonuclease T1 is specific for G residues, ribonuclease A for single stranded pyrimidines, Ribonuclease If for single stranded RNA and ribonuclease V1 for paired stems and otherwise structured s (note, however, that V1 cleavage as a literal indicator of helicity can be misleading, missing some helices and cutting to the sides of others (Maizels et al., 1999); reliable comparisons between mutant and wild-type V1 data can nonetheless be made). The alternating If and V1 patterns are consistent with the stem-loop structure characteristic of the canonical tRNA cloverleaf and the 3’ end trailer is also apparently structured, as previously reported (Levinger et al., 2003).
Ribonuclease T1 used under semi-denaturing (Fig. 4A lane 2 and and4B4B lane 2) as well as native conditions (Fig. 4A lanes 3–4 and and4B4B lanes 3–4) can reveal differences in exposure of Gs which arise from changes in tRNA folding. No differences in T1 susceptibility were observed between wild-type and m.4308G>A mutant precursor, but absence of G50 from the m.4308G>A pattern confirms the m.4308G>A substitution. Ribonuclease A and If patterns are consistent with the cloverleaf structure of tRNAIle (Fig. 4A). The bottom of the T stem (nucleotides 49–53, Fig. 4B) displays low V1 sensitivity; only nucleotide 50 is a strong V1 site in the wild-type tRNAIle precursor (Fig. 4C). Most structural changes in the m.4308G>A precursor relative to wild-type are observed at a hinge position between the T arm and acceptor stem (Fig. 4B and C, indicated by a dot). Decreased V1 susceptibility of the m.4308G>A mutant is observed at the site of the substitution (A50) and increased V1 susceptibility is observed at U56 in the T loop and U65 at a hinge position between the T arm and acceptor stem. These changes in nuclease V1 cleavage are superimposed on the tRNAIle secondary structure in Figure 5A.
The tRNAIle T stem contains the 52·62 A·C apposition which weakens the T stem (as suggested by Kelley et al., 2001 (Kelley et al., 2001)) and would be expected to increase the disturbance of T-stem structure arising from the m.4308G>A mutation. Manual folding allows us to suggest a somewhat extreme refolding involving the V-loop, T arm and acceptor stem produced by sliding one nucleotide from the top of the T stem into the T loop (producing an 8 nt T loop; Figure 5B) which generates a 10 bp T-stem including one A·C apposition. With no acceptor stem, this structure would not be a substrate for tRNA end-processing enzymes including tRNase Z. Structural modeling using Mfold (Zuker, 2003) predicts that destabilization of the T stem by the G4308A mutant would lead to a large open loop consisting of the V-loop and the entire T-arm, while the acceptor stem remains intact (Figure 5C). This structure, lacking a T-stem to coaxially stack on the acceptor stem, would also fail as a tRNase Z substrate.
Various causes have been found for sporadic CPEO, including both large rearrangements and point mutations in mtDNA. In a patient presenting with CPEO, we identified a novel point mutation in mitochondrial tRNAIle which could interfere with formation of the T stem and stabilize an alternate secondary structure. The following features substantiate the pathogenic nature of the m.4308G>A mutation. The lack of large rearrangements in the mtDNA suggests that primary mutations in a nuclear gene (e.g. POLG, POLG2, Twinkle and ANT1) is unlikely (Spinazzola and Zeviani, 2009; Tuppen et al., 2010). The mutation was associated with clinical symptoms and was present in a heteroplasmic form in the muscle tissue, consistent with a general criterion for mtDNA. Electron microscopy showed the typical features of a mitochondrial cytopathy (Mierau et al., 2004). Morphologically, there were ultrastructural mitochondrial abnormalities, including deranged internal architecture and crystalline inclusions which have not only been observed in PEO patients (Mitsumoto et al., 1983) but also in other diseases linked to defective mitochondrial function such as MERRF (Suomalainen, 1997), Kearns-Sayre Syndrome (McKechnie et al., 1985), myopathy (Frey and Mannella, 2000; Zanssen et al., 1997), and encephalopathy (Kaido et al., 1995). Biochemically, we found a multiple partial respiratory chain enzyme deficiency, affecting the activities of complexes I, III and IV. The m.4308G>A variant was not found in analysis of more than 2700 individuals (Ingman and Gyllensten, 2006), strongly suggesting that it is not a neutral polymorphism. A general approach to demonstrate the pathogenicity of a newly identified point mutation in the mtDNA includes single fibre PCR to show a co-segregation of the mutation with COX-negative fibres. However, in this particular case, the amount of native muscle biopsy remaining after electron microscopy, biochemical analysis and genetic testing, was insufficient to obtain good quality sections for accurate qualitative assessment of COX-negative fibers, prompting us to investigate the pathogenicity of the newly identified variant at a functional level. Mitochondrial tRNAs are embedded in long primary transcripts, punctuating the two ribosomal RNAs and 11 mRNAs (Anderson et al., 1981). Production of mature, functional mitochondrial RNAs requires endonucleolytic cleavage of the precursors at the 5’ and/or 3’ ends of the tRNAs (Montoya et al., 1981; Ojala et al., 1981). tRNAIle 5’ end and ND1 3’ end have an overlap of 1 nt, which therefore requires the addition of an A after processing to complete the ND1 translation termination codon. At its 3’ end, tRNAIle has a 70 nt spacer followed by tRNAMet, making the reductions in tRNase Z processing efficiency due to pathogenesis-related mutations still more remarkable. This is also observed for tRNASer(UCN) which is followed by an even longer 2.5 kb spacer at its 3’ end (Levinger et al., 2001). In these instances, the molecular defect is probably the reduced quantity and impaired function of the affected aminoacyl tRNA that causes a deficiency in translation of mitochondrial messages, leading to the pathology.
For functional studies of the m.4308G>A substitution, we initially investigated the effect of the m.4308G>A substitution on tRNase Z processing and observed a five fold reduction in processing efficiency. On the basis of this reduced processing efficiency, we performed Michaelis-Menten kinetics on wild-type and two mutants (m.4308G>A and m.4309G>A). The latter has previously been described to be associated with CPEO (Franceschina et al., 1998) and resulted in a pathology-related reduction in 3’ end processing (Levinger et al., 2003). Both mutants display substantially reduced 3’ end processing efficiency, due principally to a lower kcat. Whereas the m.4309G>A mutant decreases 3’end processing about 3 fold, the G4308A mutant has 5 fold reduced 3’ end processing efficiency.
Wild-type and m.4308G>A mutant structures were compared to search for structural reasons for reduced processing efficiency. The mutation disrupts a strictly conserved GC base pair in the T stem of tRNAIle close to the V-Loop – T-stem boundary. The effect of the G4308A substitution on tRNAIle structure (Figures 5, 6) and tRNase Z processing combine to suggest an overall reduction in availability of Ile-tRNAIle for translation. Computer analysis and visual inspection of mutant tRNAIle suggest that the m.4308G>A mutation destabilises the already weak T stem. While no single secondary structure completely explains the changes in V1 nuclease susceptibility, the three-headed arrow between Figure 6A, B and C indicates a shift in the equilibrium away from the coaxially stacked acceptor stem and T stem that is required of a tRNase Z substrate in favour of altered structures. The m.4308G>A mutation thus severely affects secondary and tertiary structure of tRNAIle, thereby reducing its function.
End processing reactions by RNase P, tRNase Z and CCA-adding enzyme require an intact, coaxially stacked acceptor stem and T domain (Levinger et al., 2003). Thus, the location of the m.4308G>A mutation and its implication in structural, functional and physiological effects are consistent with interference of the mutated tRNAIle with cleavage by tRNase Z, contributing to pathology.
Interestingly, while our manuscript was in the process of revision, we became aware of a publication (Sihem et al., 2010) in which the authors found the m.4308G>A in a patient with sporadic CPEO, suggesting an association of the m.4308G>A mutation with this clinical phenotype.
Genetic counseling for a mtDNA mutation is generally a difficult task as factors determining the transmission of mtDNA mutations are largely unknown. Thus, the likelihood that the m.4308G>A mutation would be transmitted to the patient’s two children is difficult to predict (Elson et al., 2009). The mutation found in the patient is confined to muscle and the absence of the mutation in blood suggests that it is not a germline mutation. However, there is no guarantee that the patient’s oocytes are mutation-free. To fully exclude transmission of the mutation, a muscle biopsy should be performed on the presently unaffected children. However, a muscle biopsy in unaffected individuals is not standard practice and therefore, the status of her children remains unknown.
In summary, this study adds m.4308G>A to the growing list of point mutations associated with CPEO and further emphasizes the importance of analyzing all the 22 tRNAs in sporadic CPEO patients after exclusion of large deletions. It also demonstrates the need of a muscle biopsy when no mutations can be detected in DNA extracted from blood. Our data provide a further example in support of the thesis that inefficient 3’ end processing of mutant tRNAs can contribute to pathology (Levinger et al., 2004). CPEO may be associated with mtDNA deletions or related to point mutations within one or another of the tRNA genes. A link between these two mitochondrial genome-based causes could be presumed to arise from a decrease in mitochondrial protein synthesis which would cause the multiple partial defects in respiratory chain activity.
Acknowledgement
The authors are indebted to the patient and family members involved for their cooperation. We are grateful to K.-M. Rösler (Inselspital, Bern), Christopher Wilson (York College/CUNY) and C. Florentz (IBMC, Strasbourg) for helpful discussions, and to T. Lauterburg for excellent technical assistance. This work was supported by a grant from Novartis (AS).
Footnotes
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
  • Anderson S, Bankier AT, Barrell BG, de Bruijn MH, Coulson AR, Drouin J, Eperon IC, Nierlich DP, Roe BA, Sanger F, Schreier PH, Smith AJ, Staden R, Young IG. Sequence and organization of the human mitochondrial genome. Nature. 1981;290:457–465. [PubMed]
  • Berardo A, Coku J, Kurt B, DiMauro S, Hirano M. A novel mutation in the tRNAIle gene (MTTI) affecting the variable loop in a patient with chronic progressive external ophthalmoplegia (CPEO) Neuromuscul Disord. 2010;20:204–206. [PMC free article] [PubMed]
  • Birch-Machin MA, Turnbull DM. Assaying mitochondrial respiratory complex activity in mitochondria isolated from human cells and tissues. Methods Cell Biol. 2001;65:97–117. [PubMed]
  • Borthwick GM, Taylor RW, Walls TJ, Tonska K, Taylor GA, Shaw PJ, Ince PG, Turnbull DM. Motor neuron disease in a patient with a mitochondrial tRNAIle mutation. Ann Neurol. 2006;59:570–574. [PubMed]
  • Campos Y, Garcia A, Lopez A, Jimenez S, Rubio JC, Del Hoyo P, Bustos F, Martin MA, Cabello A, Ricoy JR, Arenas J. Cosegregation of the mitochondrial DNA A1555G and G4309A mutations results in deafness and mitochondrial myopathy. Muscle Nerve. 2002;25:185–188. [PubMed]
  • Casali C, Santorelli FM, D'Amati G, Bernucci P, DeBiase L, DiMauro S. A novel mtDNA point mutation in maternally inherited cardiomyopathy. Biochem Biophys Res Commun. 1995;213:588–593. [PubMed]
  • Chinnery PF, Johnson MA, Taylor RW, Durward WF, Turnbull DM. A novel mitochondrial tRNA isoleucine gene mutation causing chronic progressive external ophthalmoplegia. Neurology. 1997;49:1166–1168. [PubMed]
  • Corona P, Lamantea E, Greco M, Carrara F, Agostino A, Guidetti D, Dotti MT, Mariotti C, Zeviani M. Novel heteroplasmic mtDNA mutation in a family with heterogeneous clinical presentations. Ann Neurol. 2002;51:118–122. [PubMed]
  • Degoul F, Brule H, Cepanec C, Helm M, Marsac C, Leroux J, Giege R, Florentz C. Isoleucylation properties of native human mitochondrial tRNAIle and tRNAIle transcripts. Implications for cardiomyopathy-related point mutations (4269, 4317) in the tRNAIle gene. Hum Mol Genet. 1998;7:347–354. [PubMed]
  • DiMauro S, Schon EA. Mitochondrial disorders in the nervous system. Annu Rev Neurosci. 2008;31:91–123. [PubMed]
  • Elson JL, Swalwell H, Blakely EL, McFarland R, Taylor RW, Turnbull DM. Pathogenic mitochondrial tRNA mutations--which mutations are inherited and why? Hum Mutat. 2009;30:E984–E992. [PubMed]
  • Fechter P, Rudinger J, Giege R, Theobald-Dietrich A. Ribozyme processed tRNA transcripts with unfriendly internal promoter for T7 RNA polymerase: production and activity. FEBS Lett. 1998;436:99–103. [PubMed]
  • Florentz C, Sissler M. Disease-related versus polymorphic mutations in human mitochondrial tRNAs. Where is the difference? EMBO Rep. 2001;2:481–486. [PubMed]
  • Franceschina L, Salani S, Bordoni A, Sciacco M, Napoli L, Comi GP, Prelle A, Fortunato F, Hadjigeorgiou GM, Farina E, Bresolin N, D'Angelo MG, Scarlato G. A novel mitochondrial tRNA(Ile) point mutation in chronic progressive external ophthalmoplegia. J Neurol. 1998;245:755–758. [PubMed]
  • Frey TG, Mannella CA. The internal structure of mitochondria. Trends Biochem Sci. 2000;25:319–324. [PubMed]
  • Hayashi J, Ohta S, Kagawa Y, Takai D, Miyabayashi S, Tada K, Fukushima H, Inui K, Okada S, Goto Y, et al. Functional and morphological abnormalities of mitochondria in human cells containing mitochondrial DNA with pathogenic point mutations in tRNA genes. J Biol Chem. 1994;269:19060–19066. [PubMed]
  • Hirano M, DiMauro S. ANT1, Twinkle, POLG, and TP: new genes open our eyes to ophthalmoplegia. Neurology. 2001;57:2163–2165. [PubMed]
  • Ingman M, Gyllensten U. mtDB: Human Mitochondrial Genome Database, a resource for population genetics and medical sciences. Nucleic Acids Res. 2006;34:D749–D751. [PMC free article] [PubMed]
  • Kaido M, Fujimura H, Taniike M, Yoshikawa H, Toyooka K, Yorifuji S, Inui K, Okada S, Sparaco M, Yanagihara T. Focal cytochrome c oxidase deficiency in the brain and dorsal root ganglia in a case with mitochondrial encephalomyopathy (tRNA(Ile) 4269 mutation): histochemical, immunohistochemical, and ultrastructural study. J Neurol Sci. 1995;131:170–176. [PubMed]
  • Kelley SO, Steinberg SV, Schimmel P. Fragile T-stem in disease-associated human mitochondrial tRNA sensitizes structure to local and distant mutations. J Biol Chem. 2001;276:10607–10611. [PubMed]
  • Kleinle S, Schneider V, Moosmann P, Brandner S, Krahenbuhl S, Liechti-Gallati S. A novel mitochondrial tRNA(Phe) mutation inhibiting anticodon stem formation associated with a muscle disease. Biochem Biophys Res Commun. 1998;247:112–115. [PubMed]
  • Kleinle S, Wiesmann U, Superti-Furga A, Krahenbuhl S, Boltshauser E, Reichen J, Liechti-Gallati S. Detection and characterization of mitochondrial DNA rearrangements in Pearson and Kearns-Sayre syndromes by long PCR. Hum Genet. 1997;100:643–650. [PubMed]
  • Levinger L, Giege R, Florentz C. Pathology-related substitutions in human mitochondrial tRNA(Ile) reduce precursor 3' end processing efficiency in vitro. Nucleic Acids Res. 2003;31:1904–1912. [PMC free article] [PubMed]
  • Levinger L, Jacobs O, James M. In vitro 3'-end endonucleolytic processing defect in a human mitochondrial tRNA(Ser(UCN)) precursor with the U7445C substitution, which causes non-syndromic deafness. Nucleic Acids Res. 2001;29:4334–4340. [PMC free article] [PubMed]
  • Levinger L, Morl M, Florentz C. Mitochondrial tRNA 3' end metabolism and human disease. Nucleic Acids Res. 2004;32:5430–5441. [PMC free article] [PubMed]
  • Liechti-Gallati S, Schneider V, Neeser D, Kraemer R. Two buffer PAGE system-based SSCP/HD analysis: a general protocol for rapid and sensitive mutation screening in cystic fibrosis and any other human genetic disease. Eur J Hum Genet. 1999;7:590–598. [PubMed]
  • Limongelli A, Schaefer J, Jackson S, Invernizzi F, Kirino Y, Suzuki T, Reichmann H, Zeviani M. Variable penetrance of a familial progressive necrotising encephalopathy due to a novel tRNA(Ile) homoplasmic mutation in the mitochondrial genome. J Med Genet. 2004;41:342–349. [PMC free article] [PubMed]
  • Maizels N, Weiner AM, Yue D, Shi PY. New evidence for the genomic tag hypothesis: archaeal CCA-adding enzymes and tDNA substrates. Biol Bull. 1999;196:331–333. discussion 333–334. [PubMed]
  • McFarland R, Taylor RW, Turnbull DM. A neurological perspective on mitochondrial disease. Lancet Neurol. 2010;9:829–840. [PubMed]
  • McKechnie NM, King M, Lee WR. Retinal pathology in the Kearns-Sayre syndrome. Br J Ophthalmol. 1985;69:63–75. [PMC free article] [PubMed]
  • Merante F, Myint T, Tein I, Benson L, Robinson BH. An additional mitochondrial tRNA(Ile) point mutation (A-to-G at nucleotide 4295) causing hypertrophic cardiomyopathy. Hum Mutat. 1996;8:216–222. [PubMed]
  • Mierau GW, Tyson RW, Freehauf CL. Role of electron microscopy in the diagnosis of mitochondrial cytopathies. Pediatr Dev Pathol. 2004;7:637–640. [PubMed]
  • Mitsumoto H, Aprille JR, Wray SH, Nemni R, Bradley WG. Chronic progressive external ophthalmoplegia (CPEO): clinical, morphologic, and biochemical studies. Neurology. 1983;33:452–461. [PubMed]
  • Montoya J, Ojala D, Attardi G. Distinctive features of the 5'-terminal sequences of the human mitochondrial mRNAs. Nature. 1981;290:465–470. [PubMed]
  • Obayashi T, Hattori K, Sugiyama S, Tanaka M, Tanaka T, Itoyama S, Deguchi H, Kawamura K, Koga Y, Toshima H, et al. Point mutations in mitochondrial DNA in patients with hypertrophic cardiomyopathy. Am Heart J. 1992;124:1263–1269. [PubMed]
  • Ojala D, Merkel C, Gelfand R, Attardi G. The tRNA genes punctuate the reading of genetic information in human mitochondrial DNA. Cell. 1980;22:393–403. [PubMed]
  • Ojala D, Montoya J, Attardi G. tRNA punctuation model of RNA processing in human mitochondria. Nature. 1981;290:470–474. [PubMed]
  • Ozawa T, Tanaka M, Ino H, Ohno K, Sano T, Wada Y, Yoneda M, Tanno Y, Miyatake T, Tanaka T, et al. Distinct clustering of point mutations in mitochondrial DNA among patients with mitochondrial encephalomyopathies and with Parkinson's disease. Biochem Biophys Res Commun. 1991a;176:938–946. [PubMed]
  • Ozawa T, Tanaka M, Sugiyama S, Ino H, Ohno K, Hattori K, Ohbayashi T, Ito T, Deguchi H, Kawamura K, et al. Patients with idiopathic cardiomyopathy belong to the same mitochondrial DNA gene family of Parkinson's disease and mitochondrial encephalomyopathy. Biochem Biophys Res Commun. 1991b;177:518–525. [PubMed]
  • Pesole G, Gissi C, De Chirico A, Saccone C. Nucleotide substitution rate of mammalian mitochondrial genomes. J Mol Evol. 1999;48:427–434. [PubMed]
  • Rossmanith W, Tullo A, Potuschak T, Karwan R, Sbisa E. Human mitochondrial tRNA processing. J Biol Chem. 1995;270:12885–12891. [PubMed]
  • Rustin P, Chretien D, Bourgeron T, Gerard B, Rotig A, Saudubray JM, Munnich A. Biochemical and molecular investigations in respiratory chain deficiencies. Clin Chim Acta. 1994;228:35–51. [PubMed]
  • Santorelli FM, Mak SC, Vazquez-Acevedo M, Gonzalez-Astiazaran A, Ridaura-Sanz C, Gonzalez-Halphen D, DiMauro S. A novel mitochondrial DNA point mutation associated with mitochondrial encephalocardiomyopathy. Biochem Biophys Res Commun. 1995;216:835–840. [PubMed]
  • Shepherd D, Garland PB. The kinetic properties of citrate synthase from rat liver mitochondria. Biochem J. 1969;114:597–610. [PubMed]
  • Sihem S, Chebel S, Mancuso M, Petrozzi L, Siciliano G, Frihayed M, Hentati F, Amouri R. A novel mitochondrial tRNA(Ile) point mutation associated with chronic progressive external ophthalmoplegia and hyperCKemia. J Neurol Sci. 2010 [PubMed]
  • Silvestri G, Servidei S, Rana M, Ricci E, Spinazzola A, Paris E, Tonali P. A novel mitochondrial DNA point mutation in the tRNA(Ile) gene is associated with progressive external ophtalmoplegia. Biochem Biophys Res Commun. 1996;220:623–627. [PubMed]
  • Spinazzola A, Zeviani M. Disorders from perturbations of nuclear-mitochondrial intergenomic cross-talk. J Intern Med. 2009;265:174–192. [PubMed]
  • Suomalainen A. Mitochondrial DNA and disease. Ann Med. 1997;29:235–246. [PubMed]
  • Tanaka M, Ino H, Ohno K, Hattori K, Sato W, Ozawa T, Tanaka T, Itoyama S. Mitochondrial mutation in fatal infantile cardiomyopathy. Lancet. 1990;336:1452. [PubMed]
  • Taniike M, Fukushima H, Yanagihara I, Tsukamoto H, Tanaka J, Fujimura H, Nagai T, Sano T, Yamaoka K, Inui K, et al. Mitochondrial tRNA(Ile) mutation in fatal cardiomyopathy. Biochem Biophys Res Commun. 1992;186:47–53. [PubMed]
  • Taylor RW, Chinnery PF, Bates MJ, Jackson MJ, Johnson MA, Andrews RM, Turnbull DM. A novel mitochondrial DNA point mutation in the tRNA(Ile) gene: studies in a patient presenting with chronic progressive external ophthalmoplegia and multiple sclerosis. Biochem Biophys Res Commun. 1998;243:47–51. [PubMed]
  • Taylor RW, Giordano C, Davidson MM, d'Amati G, Bain H, Hayes CM, Leonard H, Barron MJ, Casali C, Santorelli FM, Hirano M, Lightowlers RN, DiMauro S, Turnbull DM. A homoplasmic mitochondrial transfer ribonucleic acid mutation as a cause of maternally inherited hypertrophic cardiomyopathy. J Am Coll Cardiol. 2003;41:1786–1796. [PubMed]
  • Taylor RW, Schaefer AM, McFarland R, Maddison P, Turnbull DM. A novel mitochondrial DNA tRNA(Ile) (A4267G) mutation in a sporadic patient with mitochondrial myopathy. Neuromuscul Disord. 2002;12:659–664. [PubMed]
  • Tuppen HA, Blakely EL, Turnbull DM, Taylor RW. Mitochondrial DNA mutations and human disease. Biochim Biophys Acta. 2010;1797:113–128. [PubMed]
  • Valentino ML, Avoni P, Barboni P, Pallotti F, Rengo C, Torroni A, Bellan M, Baruzzi A, Carelli V. Mitochondrial DNA nucleotide changes C14482G and C14482A in the ND6 gene are pathogenic for Leber's hereditary optic neuropathy. Ann Neurol. 2002;51:774–778. [PubMed]
  • Wilson FH, Hariri A, Farhi A, Zhao H, Petersen KF, Toka HR, Nelson-Williams C, Raja KM, Kashgarian M, Shulman GI, Scheinman SJ, Lifton RP. A cluster of metabolic defects caused by mutation in a mitochondrial tRNA. Science. 2004;306:1190–1194. [PMC free article] [PubMed]
  • Yan H, Zareen N, Levinger L. Naturally occurring mutations in human mitochondrial pre-tRNASer(UCN) can affect the transfer ribonuclease Z cleavage site, processing kinetics, and substrate secondary structure. J Biol Chem. 2006;281:3926–3935. [PubMed]
  • Zanssen S, Molnar M, Schroder JM, Buse G. Multiple mitochondrial tRNA(Leu[UUR]) mutations associated with infantile myopathy. Mol Cell Biochem. 1997;174:231–236. [PubMed]
  • Zuker M. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 2003;31:3406–3415. [PMC free article] [PubMed]