PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
J Neurosci. Author manuscript; available in PMC 2011 May 10.
Published in final edited form as:
PMCID: PMC3074336
NIHMSID: NIHMS251181

Cleavage at the 586aa caspase-6 site in mutant huntingtin influences caspase-6 activation in vivo

Abstract

Caspase cleavage of huntingtin (htt) and nuclear htt accumulation represent early neuropathological changes in brains of patients with Huntington disease (HD). However the relationship between caspase cleavage of htt and caspase activation patterns in the pathogenesis of HD remains poorly understood. The lack of a phenotype in YAC mice expressing caspase-6-resistant (C6R) mutant htt (mhtt) highlights proteolysis of htt at the 586aa caspase-6 (casp6) site as a key mechanism in the pathology of HD. The goal of this study was to investigate how proteolysis of htt at residue 586 plays a role in the pathogenesis of HD and determine whether inhibiting casp6 cleavage of mhtt alters cell death pathways in vivo. Here we demonstrate that activation of casp6, and not caspase-3, is observed before onset of motor abnormalities in human and murine HD brain. Active casp6 levels correlate directly with CAG size and inversely with age of onset. In contrast, in vivo expression of C6R mhtt attenuates caspase activation. Increased casp6 activity and apoptotic cell death is evident in primary striatal neurons expressing caspase-cleavable, but not C6R, mhtt following NMDA application. Pretreatment with a casp6 inhibitor rescues the apoptotic cell death observed in this paradigm. These data demonstrate that activation of casp6 is an early marker of disease in HD. Furthermore, these data provide a clear link between excitotoxic pathways and proteolysis and suggest that C6R mhtt protects against neurodegeneration by influencing the activation of neuronal cell death and excitotoxic pathways operative in HD.

Keywords: Huntington Disease, mutant huntingtin, caspase-6, apoptosis, human, mouse models

Introduction

Huntington disease (HD) is characterized by progressive cognitive decline and selective neuronal loss first evident in the striatum (Vonsattel et al., 1985). Early neuropathological changes include the appearance of N-terminal nuclear htt fragments, increases in the excitotoxic markers quinolinate and 3-hydroxykynurenine, and increased levels of glutamate (Taylor-Robinson et al.,1996; Wellington et al., 2002; Guidetti et al., 2004).

Proteolytic cleavage of mhtt appears to be a critical event in the pathogenesis of HD. Expression of mhtt fragments are toxic (Mangiarini et al., 1996; Hackam et al., 1998; Ratovitski et al., 2007), and accumulation of N-terminal truncated products of htt are observed early in HD brain (Kim et al., 2001;Wellington et al., 2002). Increasing evidence supports the importance of the specific protein context of mhtt fragments in initiating toxic signaling pathways specific to HD (Yu et al., 2003; Slow et al., 2005; Graham et al., 2006a).

Htt is proteolytically cleaved by caspases (Wellington et al 2000; Kim et al., 2001) releasing an N-terminal fragment containing the glutamine tract. Eliminating cleavage at the 586aa casp6 site of mhtt (C6R mhtt) is sufficient to preserve striatal volume and behavioral disturbances in a YAC model of HD (Graham et al., 2006a; Pouladi et al., 2009). Furthermore, C6R mice are resistant to NMDAR-mediated excitotoxicity (Graham et al., 2006a; Milnerwood et al., 2010). The lack of an HD phenotype in the C6R mice demonstrates that cleavage at the casp6 site plays a key role in the development of HD and implicates casp6 as a critical target in HD.

Apoptosis is a genetically programmed form of cell death that utilizes caspases. Casp6 was originally identified as an executioner caspase due to its role in cytoskeletal alterations and cleavage of nuclear lamins. However, casp6 has since been shown to also function as an initiator caspase through its ability to cleave and activate casp2 and -3 (Xanthoudakis et al., 1999; Allsopp et al., 2000; Henshall et al., 2002) and active casp6 is present in preclinical Alzheimer disease (AD) brains that do not have cellular apoptotic morphology (Albrecht et al., 2007).

Proteolytic cleavage of specific substrates has also been demonstrated to be an important cellular event in the pathogenesis of AD (Gervais et al., 1999; Guo et al., 2004) and spinocerebellar ataxia (Garden et al.,. 2002). Interestingly, in a mouse model of AD, mutation of the casp6 cleavage site at Asp664 in the amyloid precursor protein (APP) suppressed synapse loss, dentate gyral atrophy and memory loss (Galvan et al., 2006;2008; Saganich et al., 2006; Zhang et al., 2010).

Accumulation of nuclear htt fragments is delayed in the C6R mice (Graham et al., 2006a), suggesting that inhibiting casp6 cleavage of mhtt alters proteolytic pathways active in the early stages of HD. In striatal neurons exposed to staurosporine, activation of casp6 is observed and active casp6 translocates to the nucleus and co-localizes with the 586aa htt fragments, suggesting nuclear localization is important for the neurotoxicity of this fragment (Warby et al., 2008).

We have previously determined in vitro that casp6 cleaves htt at the IVLD 586aa site (Wellington et al., 2000; Graham et al., 2006a). Casp6 interacts with htt and dominant-negative inhibition of casp6 activity in primary striatal neurons protects neurons from degeneration (Hermel et al., 2004). If casp6 is an essential rate limiting step in the pathogenesis of HD, it may be expected that casp6 activation occurs early in the disease process. We therefore set out to determine the natural history of casp6 activation patterns in human and murine HD brain. Furthermore, based on prior findings, we aimed to explore the underlying mechanism of the neuroprotection observed in the C6R mice.

Material and Methods

Protein analysis and Western blotting

Human brain tissue was obtained from the Canadian Brain Tissue Bank, New York Brain Bank and Neurological Foundation of the New Zealand Human Brain Bank. Ethical approval was obtained from UBC review committee (CW06-0171/H06-70410). Human or murine tissue protein lysates and western blots were prepared as described previously (Wellington et al., 2002). Membranes were probed with αcasp6 (#0703, MBL) or α casp3 (#557035, BD Pharmigen). Densitometric values from scanned western blots were obtained using Quantity One software (BioRad).

CAG size

DNA was extracted from leukocytes and CAG repeat assessed as previously described (Andrew et al., 1994).

HD transgenic mice

YAC128 and C6R (lines C6R7 and C6R13) mice were identified as described (Graham et al., 2006; Slow et al., 2003) and tissues harvested according to UBC Animal Protocol A07-0106. BACHD mice are as described elsewhere (Gray et al., 2008).

Immunohistochemistry

Mouse brains were fixed, sectioned and immunoassayed as described previously (Slow et al., 2003; Graham et al., 2006a;2006b) with casp6 (9761, Cell Signaling), casp3 (9661, Cell Signaling) or casp6-cleaved-tau (Guo et al., 2004). No staining was observed in a negative control without primary antibody. Photographs were taken on a light microscope (Zeiss).

Fluorogenic caspase activity assay

The protein concentration of tissue lysates (prepared as described above) was measured using the Bradford assay. The lysate was incubated with the reaction mix (as per manufactures instructions) containing fluorogenic casp6 substrate (Ac-VEID-AFC, from BIOMOL) at 50μM in 100μl reaction volume at 37°C for 1 hour. The fluorescent units were read at excitation 405nm and emission 535nm. The μM AFC was calculated against the AFC standard curve and then divided by the protein concentration. The relative casp6 activity is expressed as μM AFC/mg protein. Casp3 activity was assayed as above with Ac-DEVD-AFC (BIOMOL) as substrate.

NMDAR-mediated excitotoxicity

Cultures were maintained in vitro for 9–10 days, after which they were exposed to balanced salt solution (BSS) or 500μm NMDA (Sigma) in BSS for 10 minutes in a procedure described previously (Zeron et al., 2002; Graham et al., 2006a; 2006b). Cells were fixed 4 or 6 hours post NMDA with 4% PFA in PBS. Cells were permeabilized in 0.5% Tx-100 1% PFA in PBS then blocked in 3% NGS in PBS and incubated in active-casp6 antibody (9761, Cell Signaling) at 1:500 in 2% NGS in PBS. Secondary anti-rabbit-Alexa-584 (Molecular Probes) was used at 1:800 in 2% NGS in PBS. Neurons were counter-stained with 10 μM Hoechst then mounted with fluormount (Southern Biotechnology). In each experiment, a negative control without primary antibody was included. To assess percentage of MSNs positive for active casp6, the experimenter was blinded to conditions, and took 6 pairs of photographs per coverslip using a 63X objective (Zeiss axiophot microscope). The intensities of light captured for individual MSNs were then measured using Northern Eclipse software, and all MSNs with intensities of more than two SD greater than the mean intensity of negative control MSNs were considered to be immuno-positive. For casp6 mRNA analysis total RNA was extracted from BSS or NMDA treated MSNs (3.5 hrs post treatment) with RNeasy Micro Kit (Qiagen). First-strand cDNA was prepared using SuperScript III First-Strand Synthesis System (Invitrogen). 1/100 of the first-strand cDNA was used as template in real-time PCR reaction in a final volume of 10 μl. The sequences of the casp6 primers were 5′TGGCTCCTGGTACATTCAGGAT 3′ and 5′ TCCGTGAACTCCAGGGAACT 3′ and the β-actin primers were 5′ ACGGCCAGGTCATCACTATTG 3′ and 5′CAAGAAGGAAGGCTGGAAAAGA 3′. ΔΔCt Comparative Assay was performed using the ABI 7500 Fast Real-Time PCR System and Power SYBR Green PCR Master Mix (Applied Biosystems). All samples were run in triplicate and done for 3 separate cultures. Primary data analysis was performed using system software from Applied Biosystems. Relative quantification (RQ) was used to analyze the results. Casp6 activity assays were performed on BSS or NMDA treated MSN lysate 3.5 hours post treatment as described above. For assessment of apoptotic cell death, cultures were prepared and exposed to BSS, 500μm NMDA (Sigma), 500μm NMDA + casp6 inhibitor z-VEID-fmk (218757, Calbiochem) or 500μm NMDA + casp3 inhibitor z-DEVD-fmk (264155, Calbiochem) for 10 minutes. Neurons with the caspase inhibitor were pretreated for 1 hour with either 5μm z-VEID-fmk or z-DEVD-fmk prior to NMDA application. Twenty-four post NMDA, cultures were fixed and assessed for apoptotic cell death as formerly described (Graham et al., 2006a, 2006b).

Statistical analysis

Statistical analysis was done using Student’s t-test, one-way ANOVA (in cases of significant effect of genotype, post-hoc comparisons between genotypes were performed using Turkey or linear trend post hoc test). P values, SEM, means and standard deviations were calculated using Graphpad Prism version 4.0. Linear regression analysis for r2 and p values was calculated by Pearson correlation coefficient. Differences between means were considered statistically significant if p<0.05.

Results

Activation of caspase-6 is an early feature in patients with HD

In order to investigate whether apoptotic pathways in human HD brain correlate with the findings in the YAC128 model of HD we first determined whether normal aging alone influences activation of casp6. In tissues from individuals younger than 50 years of age, the inactive p34 proform of casp6 is detected in the striatum and frontal cortex of human control tissue (Fig. 1A,B). However, starting in the 5th decade and thereafter, a decrease in the proform of casp6 is observed with a concomitant increase in the active p20 fragment of casp6 (Fig. 1A,B). In general, increases in caspase activation and activity are associated with a decrease in the proform and an increase in the activated form of the specific caspase (Zhang et al., 2003). Comparison of relative active casp6 striatal expression levels in binned age samples reveals a significant difference in active casp6 expression levels with age (ANOVA p=0.0061, post hoc 0–20yrs vs. 60–80rs p<0.05; 20–40yrs vs. 60–80yrs p<0.05). None of the older individuals from whom control tissue was obtained died of a neurodegenerative disease nor were there any other factors that could account for the active casp6 observed with advanced age in control tissues. Demographics on the human control tissues is included in Supplemental Table. 1

Fig. 1
Activation of caspase-6 is an early event in human HD striatum and correlates with CAG size

We next investigated expression levels of casp6 in human HD grade 0–1 and control striatum by western blot. In age-matched human brain tissue, increased levels of the active p20 form of casp6 are observed in early grade HD striatum compared to control brain (Fig. 1C, p<0.01, n=3), demonstrating that casp6 is processed and activated early in the pathogenesis of HD. These patients were aged 35 to 46 years. Importantly we observe active casp6 in brain tissue from a presymptomatic individual ~15 years prior to predicted onset (>90% conditional probability to have onset within 15 years (Langbehn et al., 2004), age at death 37 years, 45 CAG repeat, Grade 0). Of note, a review of transcriptional profiling studies performed on control and HD human brain tissue reveal that casp6 mRNA is increased in early grade (0–2) human HD caudate and motor cortex compared to control tissue (Hodges et al., 2006).

Analysis of grade 3–4 human HD striatum and frontal cortex similarly demonstrates increased active p20 casp6 in brains of HD patients compared to control tissue (age-matched, p<0.001, n=5; p<0.01, n=6, respectively), as previously observed (Hermel et al., 2004), implying cleavage and activation of casp6 is also evident in end stage HD (Fig. 1D,E). In this particular sense, this implies accelerated aging in the brains of human HD individuals.

If caspase activation is key to the pathogenesis of HD and the severity of illness one would predict that CAG size might modulate this effect. In order to examine the influence of CAG size on casp6 activation in human HD brain, we plotted CAG size against normalized levels of active casp6 in the respective grade 3–4 HD brain sample. A positive correlation is observed between striatal levels of active casp6 and CAG size (Fig. 1F, F1,8=8.9, r2=0.524, p=0.017, age at death 41–75yrs, n=10). Furthermore, comparison of age of onset and normalized levels of active casp6 reveals an inverse correlation between these two variables (Fig. 1G, F1,8=7.1, r2=0.471, p=0.02, n=10). However, while there is a linear correlation between CAG size and expression levels of active casp6 in the striatum, there is no correlation with active casp6 and duration of disease (r2=0.1948, p=0.202).

Active p20 casp6 levels also correlate with CAG size in human frontal cortex brain tissue (F1,8=6.2, r2=0.470, p=0.04, CAG range 42–53, age at death 41–75yrs, n=10) and there is a trend towards an inverse correlation with age of onset (F1,8=3.4, r2=0.302, p=0.10, n=10). This correlation with CAG size points to a fundamental mechanism contributing to how longer polyglutamine stretches are associated with a more severe disease phenotype. If casp6 activation were important in the pathogenesis of HD, one might expect predominant casp6 activation in those regions of the brain where selective neuronal loss is most evident and this data suggests this activation is influenced by CAG size.

In order to investigate the relationship of casp6 to the pathogenesis of HD in more detail, we assessed casp6 in the YAC128 model where we are not limited by the availability of presymptomatic tissue.

Caspase-6 activation pathways are observed early and selectively in the YAC128 mouse model of HD

Coronal sections of wildtype (WT), YAC128 (HD53) and C6R mice were stained with an antibody specific for the active form of casp6 at 3, 9, 12 and 18 months of age (n=3). In WT murine brain, active casp6 is detected predominantly in medium sized striatal neurons starting at 9 months with an increase at 18 months of age (Fig. 2A panels a–d), similar to the age related effect observed in the human control tissue. In contrast, active casp6 is detected in medium sized striatal neurons of YAC128 mice by 3 months with levels increasing with age (Fig. 2A (panels e–h), suggesting that at least one component of accelerated aging is occurring in the YAC128 mice similar to that observed in human HD brain.

Fig. 2
Accelerated activation of caspase-6 is observed in the striatum of YAC128 mice compared to wildtype and C6R mice

Increases in casp6 activation in YAC128 striatum vs. WT at 3 months is further confirmed in vivo by measurement of casp6 activity in protein lysates using the fluorogenic substrate VEID-Afc (Fig. 2B, t test, p=0.006, n=8). Increased casp6 activity in YAC128 striatum compared to WT is also observed at 12 and 18 months of age (Fig. 2C,D, t-test, WT vs. YAC128, 12m: p=0.0004, n=15; 18m, p=0.006, n=9).

In the striatum of two lines of mice expressing C6R mhtt (C6R7 and C6R13), low levels of activated casp6 are observed at 3 months with no change as the animals age (Fig. 2A panels i–p). Measurement of casp6 activity in C6R striatum reveals decreased casp6 activity in C6R striatum compared to YAC128 (Fig. 2B, ,3m:3m: ANOVA p=0.004, WT vs. YAC128, p<0.05, C6R vs. YAC128, p<0.01, n=8; Fig. 2C, 12m: ANOVA p<0.003, WT vs. YAC128, p<0.01, C6R vs. YAC128, p<0.05, n=15; Fig. 2D, 18m: ANOVA p=0.018, WT vs. YAC128, p<0.05, WT vs. C6R p>0.05, n=9).

Fig. 3
Caspase-6 activation is observed in YAC128 cortex subsequent to striatal activation

To determine whether the active casp6 detected by immunostaining and the increases observed in casp6 activity in the YAC truly represents active casp6 in vivo, we assessed coronal sections from WT, YAC128 and C6R mice (n=3, 18m) using the neo-epitope antibody to casp6-cleaved-tau which specifically recognizes tau cleaved at the VSGD-314aa casp6 site (Guo et al., 2004). This antibody strongly immunostained medium-sized striatal neurons in YAC128 striata and to a lesser extent in WT and C6R striatum, correlating with the active casp6 immunostaining observed (Fig. 2E).

At 3 months of age, active casp6 is not observed in WT or YAC128 cortex using immunohistochemistry and there is no difference in baseline casp6 activity in protein lysates of WT and YAC128 cortex. In murine WT cortex, expression of active casp6 is observed predominantly in layers 2–5 of the cortex commencing at 12 months of age with a moderate increase observed at 18 months (Fig. 3A panels a–f). By contrast, at 9 months of age YAC128 cortex demonstrates some immunopositive active casp6 stained neurons and this increases with age (Fig. 3A panels g–l). Active casp6 immunostaining is also detected on neurites (Fig. 3A). In mice expressing C6R mhtt, a low level of immunopositive active casp6 stained neurons are observed at 12 and 18 months of age (Fig. 3A, panels m–x). Correlating with the immunohistochemical results, a significant increase in casp6 activity in protein lysates from YAC128 cortex is observed compared to WT and C6R at 12 and 18 months of age (Fig. 3B, 12m: ANOVA p<0.013, WT vs. YAC128 p<0.05, C6R vs. YAC128, p<0.05, n=15; Fig. 3C, 18m: ANOVA p=0.002, WT vs. YAC8 p<0.01, C6R vs. YAC128, p<0.05, n=9).

These results demonstrate that, similar to human HD brain, striatal activation of casp6 is an early event in the YAC128 model and suggest that cortical upregulation of casp6 occurs later than striatal activation in this animal model of HD. Furthermore, inhibiting casp6 cleavage of mhtt alters casp6 activation patterns in vivo, suggesting that C6R mhtt protects against neurodegeneration by interfering with activation of casp6 and supporting the hypothesis that cleavage at aa586 in mhtt is critical for activation of cell death pathways in HD.

Severity of disease correlates with caspase-6 activity levels

We have previously demonstrated that onset and progression of HD is modulated by levels of mhtt in the YAC128 mouse models (Fig. 4A, (Graham et al., 2006b)). In order to determine the influence of disease stage on the activation of casp6 in the YAC128 model, we next assessed casp6 activity in YAC128 line HD54, our lowest mhtt expressing line which demonstrates a later onset and less severe phenotype compared to YAC128-HD53.

Fig. 4
Disease severity correlates with striatum and cortex caspase-6 activity in mouse models of HD

In contrast to the YAC128 line HD53, at 3 months of age there is no difference in casp6 activity in the striatum of WT and HD54 mice (p=0.34, n=8, Fig. 4B). A one way ANOVA linear trend post hoc test reveals a significant trend between WT, HD54 and HD53 for casp6 activity (ANOVA p=0.105, post hoc for linear trend: slope=0.065, r2=0.1493, p=0.03).

If activation of casp6 is a critical event in HD, we would expect other HD mouse models to similarly demonstrate enhanced casp6 activation. Therefore we assessed casp6 activity in the full length BACHD model. At 12 months of age there is a significant increase in casp6 activity in both striatum and cortex of BACHD mice (p=0.003 and p=0.02 respectively, n=4, Fig. 4C) consistent with our findings in the YAC128 animals.

Alterations in caspase-3 are not observed early in the pathogenesis of HD

In order to determine whether the early enhanced activation of casp6 observed in human HD brain is generalizable to other caspases or is specific for casp6 we assessed casp3 activation in human HD brain and in the YAC128 model. In grade 0–1 human HD striatum no difference was observed in the proform levels of casp3 compared to age-matched control tissue (Fig. 5A). In grade 3–4 HD striatum there is a trend towards decreased p34 proform levels of casp3 in HD compared to control tissue (n=6 control, n=9 HD, p=0.06, Fig. 5B). In contrast, in grade 3–4 HD frontal cortex a clear increase in p34 proform casp3 levels is observed compared to control tissue (p=0.02, n=3 control, n=5 HD, Fig. 5C). The active p20 casp3 fragments were not detected in control or HD striatal or frontal cortex tissue.

Fig. 5
Activation of caspase-3 is not observed early in the pathogenesis of HD

In order to determine if alterations in casp3 are observed in the YAC128 model, perfused coronal sections of WT and YAC128 mice were stained with 3 separate antibodies specific for the active form of casp3 at 3 and 12 months of age (n=3). No immunopositive staining was observed at either of these time points in striatum (Fig. 5D) or cortex in WT or YAC128 brain sections. Correlating with the immunohistochemical data, no difference in casp3 activity was observed in WT vs. YAC128 striatum at 3 and 12 months of age (3m: p=0.11, n=10; 12m: p=0.62, n=12, Fig. 5E) or cortex (3m: p=0.87, n=9; 12m: p=0.15, n=12, data not shown). Immunopositive active casp3 was detected in the corpus callosum of both WT and YAC128 brain slices however no difference in the extent of staining was observed between genotypes (Fig. 5D). The casp3 positive immunostaining did not co-localize with cresyl violet stained cells and may represent lysosome or autophagosome-like structures as has been previously described (Stadelmann et al., 1999).

Casp2 activity was also assessed in WT and YAC128 striatum and cortex. At 3 months of age no difference in casp2 activity is observed between genotypes in either the striatum (p=0.54) or cortex (p=0.43).

Excitotoxic stress influences caspase-6 activation

Caspase activation occurs early in HD brain but how this correlates with other early changes leading to excitotoxicity is not known. We have previously demonstrated enhanced susceptibility to excitotoxic stress in neonatal MSNs from multiple YAC lines (Zeron et al., 2002; Graham et al., 2006a; 2006b;2009; Milnerwood et al., 2010), underscoring the early nature of excitotoxic stress in the pathogenesis of HD.

To determine the relationship between casp6 activation and excitotoxic death of striatal MSNs, we used a neo-epitope antibody specific for the active form of casp6. We labelled DIV9 primary cultured MSNs (WT, YAC128) by immunocytochemistry at 4 and 6 hours post NMDA challenge. In MSNs expressing mhtt a significant increase in the percentage of neurons immunopositive for active casp6 is observed at 6hrs (p=0.04) following NMDA treatment and a trend observed at 4hrs (p=0.07) (n=4 WT and n=6 YAC128 separate cultures, Fig. 6A, B).

Fig. 6
NMDA-mediated excitotoxic stress triggers caspase-6 activation

In order to verify the casp6 immunofluoresence data we next assessed casp6 mRNA levels and casp6 activity in MSNs from WT and YAC128 post NMDA treatment. A significant increase in levels of casp6 mRNA and casp6 activity is observed in neurons expressing mhtt compared to WT 3.5hrs post NMDA application (casp6 mRNA levels, WT vs. YAC128, p=0.015, n=3; casp6 activity WT vs. YAC128, p=0.011, n=10, Fig. 6C). Saturating concentrations of NMDA do trigger specific activation of some caspases, which include casp9 and casp3 (Zeron et al., 2002; 2004), in MSNs expressing mhtt compared to WT MSNs. Caspase-8 (IETDase) activity is not increased in this paradigm (Zeron et al., 2004).

We have previously demonstrated that, in contrast to YAC128 MSNs, C6R MSNs are resistant to NMDAR-induced neurotoxicity (Graham et al., 2006a; Milnerwood et al., 2010). In order to investigate the mechanisms underlying this differential susceptibility to excitotoxic cell death we compared casp6 activity in MSNs containing C6R mhtt post NMDA treatment to YAC128. In contrast to YAC128 MSNs, no increase in casp6 activity is observed in C6R MSNs 3.5 hrs post NMDA treatment (ANOVA p=0.04, WT vs. C6R, p>0.05, WT vs YAC128, p<0.05, n=7, Fig. 6C).

If activation of casp6 is necessary for NMDAR-mediated cell death in MSNs expressing mhtt, we hypothesized that a casp6 inhibitor would rescue primary MSNs in this paradigm. Therefore we pretreated MSNs from WT and YAC128 striata with the casp6 peptide inhibitor, z-VEID-fmk, prior to NMDA treatment. A significant decrease in NMDAR-mediated apoptotic cell death was observed in MSNs pretreated with z-VEID-fmk from WT (ANOVA p=0.014, percent apoptotic neurons in NMDA vs. NMDA+casp6inh p<0.05, n=3) and YAC128 striata (ANOVA p=0.0001, percent apoptotic neurons in BSS vs. NMDA p<0.001, NMDA vs. NMDA+casp6inh p<0.001, n=3, Fig. 6D). We also pretreated MSNs from WT and YAC128 striata with the caspase-3 peptide inhibitor, z-DEVD-fmk, prior to NMDA treatment. A significant decrease in NMDAR-mediated apoptotic cell death was observed in MSNs pretreated with z-DEVD-fmk from WT (ANOVA p=0.002, percent apoptotic neurons in NMDA vs. NMDA+casp3inh p<0.01) and YAC128 striata (ANOVA p=0.0001, percent apoptotic neurons in BSS vs. NMDA p<0.001, NMDA vs. NMDA+casp3inh p<0.001, n=3, Fig. 6E).

Discussion

In this study our goal was to investigate the patterns of activation of casp6 in an effort to investigate its potential role in the pathogenesis of HD. Our results demonstrate that active casp6 is present in early-grade and presymptomatic HD brain. Significantly, the active casp6 observed in early stage HD tissue is observed at a time when no active casp3 is detected. Intriguingly, we found that active casp6 levels correlate with CAG size in human HD brain and inversely correlate with age of onset. This data suggests that the expanded polyglutamine tract in mhtt influences casp6 activation levels and supports a role for casp6 in the early selectivity of vulnerable striatal neurons in HD.

Enhanced levels of active casp6 and increased casp6 activity are also observed in brain tissue from two separate, symptomatic HD mouse models. C6R mice do not demonstrate increased casp6 activation suggesting that the 586aa htt fragment may be part of a forward amplification cycle of casp6 activation. In the absence of this fragment, as in the C6R mice, we now show that activation of casp6 is muted.

A major question is what stimulates casp6 activation in HD? Here we show that NMDAR-mediated excitotoxicity triggers activation of casp6 in mhtt-expressing MSNs isolated from YAC128 striata at birth. This may provide an explanation for the early activation of casp6 in vivo and highlights links between casp6 activation and excitotoxicity in the pathogenesis of HD. The underlying reason(s) for excitotoxicity in HD may be several fold and include increases in extracellular glutamate due to altered expression and/or function of glutamate transporters (Faideau et al, 2010; Huang et al., 2010), and mislocalization and altered signaling of extrasynaptic NMDARs (Milnerwood et al., 2010). Recent evidence points to these events as being dependent on mhtt cleavage at aa586 (Graham et al., 2006a; Milnerwood et al., 2010).

Casp6 activation occurs normally as part of the aging process with small increases at 9 months of age in the striatum and by one year of age in the cortex of WT mice, consistent with previous studies (Jiang et al., 2001; Albrecht et al., 2007). However, in HD this process is significantly amplified and accelerated in both striatum and cortex. The pattern of activation parallels the early selective neuronal loss with predominant effects in the striatum. Active casp6 is detected in the neurons and neurites of the cortex of YAC128 mice by 9 months of age but this occurs subsequent to striatal activation.

CAG length significantly influences onset and clinical features of HD in mouse models and affected humans (Hodgson et al., 1999; Zeron et al., 2002; Langbehn et al., 2004). Intriguingly, similar to the correlation between CAG repeat length and mitochondrial ADP-uptake (Seong et al., 2005) and body weight (Aziz et al., 2008), we now demonstrate that active casp6 levels also correlate with CAG size and inversely with age of onset in HD brain. This correlation with CAG size highlights another example of longer polyglutamine stretches associating with a more severe phenotype.

A major unanswered question is whether casp6 is the protease responsible for cleavage of htt at aa586. We have previously demonstrated in vitro that casp6 cleaves htt at the IVLD 586aa site (Wellington et al., 2000; Graham et al., 2006a; Warby et al., 2008). Caspases cleave with remarkable specificity at a small subset of aspartic acid residues within only a discrete and highly limited subset of cellular polypeptides (Thornberry et al., 1997; 2000). Studies with peptide-based and macromolecular inhibitors support the IVLD site as an optimal tetrapeptide recognition motif for casp6 (Thornberry et al., 1997). The activation of casp6 in HD brain supports the hypothesis that casp6 cleaves htt at the IVLD site in vivo. However, this is not definitive and studies using mice deficient in casp6 are required to address this question.

The finding that casp6 activation occurs in the YAC128 model and not in the C6R mice suggests that the 586aa mhtt fragment may play a crucial role in the amplification of casp6 in HD. Cleavage products of caspases have previously been shown to be part of an amplification cycle. Stress-induced generation of caspase-cleaved proteolytic fragments triggers toxicity and amplifies the cell death response. For example, caspase-dependent cleavage of CDC25A generates an active fragment that activates cyclin-dependent kinase 2 during apoptosis (Mazars et al., 2009) and casp6-cleavage of NF-κs generates a dominant-negative inhibitor of NF-κs thereby promoting apotosis (Levkau et al., 1999).

Indirect evidence in favour of the 586aa htt fragment being involved in an amplification loop for casp6 activation in HD includes the observation that active casp6 and the 586aa htt fragments co-localize in the nucleus (Warby et al., 2008). Several studies have shown that nuclear accumulation of htt fragments is associated with increased toxicity (Hackam et al., 1998; Slow et al., 2003; Van Raamsdonk et al., 2005; Graham et al., 2006b) and in YAC128 mice nuclear localization of htt occurs earliest and to the greatest extent in the striatum, correlating with the neuropathology observed (Van Raamsdonk et al., 2005). In contrast, nuclear accumulation of htt is delayed in the C6R mice (Graham et al., 2006a) showing that blocking formation of the casp6 mhtt fragment ameliorates the neuropathological and behavioral phenotype in the C6R mice.

Early activation of casp6 in HD, and the absence of active casp6 in the C6R mice, raises the question as to whether cleavage of other casp6 substrates could contribute to the pathogenesis of HD. In other words, could the absence of cleavage of particular casp6 substrates in the C6R mice contribute to the neuroprotective phenotype observed in these mice? Interestingly, a number of other casp6 substrates have been implicated in HD, including CBP and NFκβ (Qin et al., 1999; Steffan et al., 2000; Khoshnan et al., 2004; Jiang et al., 2006). Casp6 selectively cleaves CBP (Rouaux et al., 2004), suggesting that casp6 activation may contribute to the altered gene transcription observed in HD. Transcriptional repression of specific genes is observed in HD (Steffan et al., 2000; Hodges et al., 2006; Jiang et al., 2006). Potential mechanisms include altered binding of mhtt and CBP, inactivation of CBP through casp6 cleavage and/or sequestration of CBP in inclusions (Steffan et al., 2000; Jiang et al., 2006). Interestingly, casp6-mediated cleavage of NF-κs generates a transcriptionally inactive p65 molecule that acts as a dominant-negative inhibitor of NF-κs and promotes apoptosis. In contrast, casp6-resistant p65 protects cells from apoptosis (Levkau et al., 1999). Therefore other substrates that are cleaved by casp6 could play a role in HD and it is important to define all potential casp6 substrates in human brain to explore their role in HD.

A very important question then is what initiates casp6 activation in HD? Our prior observations in C6R mice that amelioration of the behavioural and neuronal deficits is associated with protection against excitotoxic stress (Graham et al., 2006a; Milnerwood et al., 2010), support the hypothesis of mhtt-mediated alterations of excitotoxicity as an important contributor to caspase activation. Here we demonstrate that NMDAR-mediated excitotoxicity activates casp6 in neurons expressing caspase-cleavable mhtt but not C6R mhtt. These findings are mirrored by decreased activation of casp6 in the brains of C6R mice. These data strongly support enhanced excitotoxicity in HD (Beal et al., 1991; Li et al., 2004; Graham et al., 2006a;2009; Guidetti et al., 2006) as an early event contributing to casp6 activation. Recent studies provide additional evidence and demonstrate that increased extrasynaptic NMDAR-induced currents and signaling is a critical underlying mechanism in the pathogenesis of HD (Okamoto et al., 2009; Milnerwood et al., 2010). Of note is the finding that increased extrasynaptic NMDAR activity requires casp6 cleavage of htt. Electrophysiological investigation of the C6R mice demonstrates that C6R MSNs are remarkably similar to MSNs overexpressing wild type htt (YAC18) and WT MSNs and significantly different from YAC128 MSNs (Milnerwood et al., 2010). The data suggest that increased extrasynaptic NMDAR activation is intimately linked to generation of the 586aa fragment of htt and that caspase-6 cleavage of mhtt is necessary for increased Ex-INMDA, leading to behavioral deficits, excitotoxicity and neurodegeneration.

Consistent with a role for casp6 in excitotoxicity, we find that inhibiting casp6 protects MSNs from NMDAR-mediated cell death. In addition, we also demonstrate that inhibition of casp3 similarly protects MSNs against excitotoxic cell death. It may be expected that inhibition of a downstream executioner caspase such as casp3 would provide protection against cell death. It is important to note however that casp6 can activate casp3 both in vitro and ex vivo (Liu et al., 1996; Xanthoudakis et al., 1999; Allsopp et al., 2000) and activation of casp6 is observed prior to casp3 in in vivo excitotoxic models (Ferrer et al., 2000; Henshall et al., 2002). This evidence, and the data demonstrating activation of casp6 in pre-symptomatic HD and AD brains, suggests that casp6 can function upstream of casp3 and may influence its activation.

The increase in casp6 mRNA post NMDA treatment may be the result of NMDAR-mediated increases in p53. Glutamate-induced neurotoxicity leads to accumulation of p53 (Xiang et al., 1998; Culmsee et al., 2001; Linag et al., 2005) and down-regulation of p53 protects neurons against excitotoxicity (Morrison et al., 1996; Culmsee et al., 2001; Morrison et al., 2003). Induction of p53 has been shown to directly induce casp6 expression through a response element within the third intron of the gene (MacLachlan et al, 2002).

Interestingly, casp3 and casp6 have remarkably different caspase activation patterns in HD brain. We did not detect active casp3 or alterations in the proform of casp3 in early HD but we did observe a decrease in the proform of casp3 in late stage HD striatum. Indeed, active casp3 has been observed in degenerating astrocytes in the caudate of patients with advanced HD (Hermel et al., 2004). These data show that casp3 is not involved early in the pathogenesis of HD.

Casp6 cleavage of substrates and casp6 activation is also present in AD. Activation of casp6 is an early event in human AD brain (Pompl et al., 2003; Albrecht et al., 2007) and, similar to htt, APP is cleaved by caspases resulting in elevated levels of amyloid-β peptide (Gervais et al., 1999; Tesco et al., 2007). Cleavage of APP occurs at the asp664aa casp6 site in vivo (Banwait et al., 2008) and inhibiting cleavage at this site provides some rescue from the AD phenotype in a mouse model (Galvan et al., 2006; 2008; Saganich et al., 2006; Harris et al., 2010; Zhang et al., 2010). Cleavage of APP generates an N-terminal APP fragment that is a death ligand for DR6 and activation of DR6 triggers casp6 activation and axonal degeneration (Nikolaev et al., 2009). The evidence implicating casp6 in AD and HD suggests that casp6 may be a crucial enzyme underlying neurodegeneration in both diseases.

The results of these studies support a critical role for casp6 early in HD and demonstrate that inhibiting cleavage of a caspase substrate can influence caspase activation patterns in vivo. These data suggest that specific mhtt fragments are required to initiate a toxic amplification cycle that contributes to neuronal dysfunction and the neuropathological abnormalities in HD. Furthermore, we demonstrate a strong relationship between casp6 and excitotoxicity which support therapeutic approaches to identify inhibitors of casp6 and/or excitotoxic stress as ways to influence the pathogenesis of HD.

Supplementary Material

Supp1

Acknowledgments

We thank members of our lab, in particular Simon Warby, Zoe Murphy, Mark Wang, Lily Y.J. Zhang and Esther G.X. Yu for their support. Additional human tissue samples were kindly provided by Jean-Paul Vonsattel at the New York Brain Bank. We thank Andréa C. LeBlanc for the gift of the casp6-cleaved tau antibody. This work was supported by grants from the Cure Huntington disease Initiative [TREAT-HD], Huntington disease Society of America [20R69538], Canadian Institute of Health Research[CGD-85375], Michael Smith Foundation for Health Research [RKG: 00495(06-1)BM] and the Health Research Council of New Zealand [08/051] and Neurological Foundation of New Zealand [0910-PG]. X.W.Y is supported by an NINDS/National Institutes of Health (R01 NS049501) and a research contract from Hereditary Disease Foundation.

M.R.H, is a Killam University Professor and holds a Canada Research Chair in Human Genetics.

References

  • Albrecht S, Bourdeau M, Bennett D, Mufson EJ, Bhattacharjee M, LeBlanc AC. Activation of caspase-6 in aging and mild cognitive impairment. Am J Pathol. 2007;170:1200–1209. [PubMed]
  • Allsopp TE, McLuckie J, Kerr LE, Macleod M, Sharkey J, Kelly JS. Caspase 6 activity initiates caspase 3 activation in cerebellar granule cell apoptosis. Cell Death Differ. 2000;7:984–993. [PubMed]
  • Andrew SE, Goldberg YP, Theilmann J, Zeisler J, Hayden MR. A CCG repeat polymorphism adjacent to the CAG repeat in the Huntington disease gene: implications for diagnostic accuracy and predictive testing. Hum Mol Genet. 1994;3:65–67. [PubMed]
  • Aziz NA, van der Burg JM, Landwehrmeyer GB, Brundin P, Stijnen T, Roos RA. EHDI Study Group. Weight loss in Huntington disease increases with higher CAG repeat number. Neurology. 2008;71:1506–1513. [PubMed]
  • Banwait S, Galvan V, Zhang J, Gorostiza OF, Ataie M, Huang W, Crippen D, Koo EH, Bredesen DE. C-terminal cleavage of the amyloid-beta protein precursor at Asp664: a switch associated with Alzheimer’s disease. J Alzheimers Dis. 2008;13:1–16. [PMC free article] [PubMed]
  • Beal MF, Ferrante RJ, Swartz KJ, Kowall NW. Chronic quinolinic acid lesions in rats closely resemble Huntington’s disease. J Neurosci. 1991;11:1649–59. [PubMed]
  • Culmsee C, Zhu X, Yu QS, Chan SL, Camandola S, Guo Z, Greig NH, Mattson MP. A synthetic inhibitor of p53 protects neurons against death induced by ischemic and excitotoxic insults, and amyloid beta-peptide. J Neurochem. 2001;77(1):220–8. [PubMed]
  • Faideau M, Kim J, Cormier K, Gilmore R, Welch M, Auregan G, Dufour N, Guillermier M, Brouillet E, Hantraye P, Déglon N, Ferrante RJ, Bonvento G. In vivo expression of polyglutamine-expanded huntingtin by mouse striatal astrocytes impairs glutamate transport: a correlation with Huntington’s disease subjects. HMG. 2010 Jun 1; Epub ahead of print. [PMC free article] [PubMed]
  • Ferrer I, López E, Blanco R, Rivera R, Krupinski J, Martí E. Differential c-Fos and caspase expression following kainic acid excitotoxicity. Acta Neuropathol. 2000;99(3):245–56. [PubMed]
  • Galvan V, Gorostiza OF, Banwait S, Ataie M, Logvinova AV, Sitaraman S, Carlson E, Sagi SA, Chevallier N, Jin K, Greenberg DA, Bredesen DE. Reversal of Alzheimer’s-like pathology and behavior in human APP transgenic mice by mutation of Asp664. PNAS. 2006;103:7130–7135. [PubMed]
  • Galvan V, Zhang J, Gorostiza OF, Banwait S, Huang W, Ataie M, Tang H, Bredesen DE. Long-term prevention of Alzheimer’s disease-like behavioral deficits in PDAPP mice carrying a mutation in Asp664. Behav Brain Res. 2008;191(2):246–55. [PMC free article] [PubMed]
  • Garcia-Calvo M, Peterson EP, Rasper DM, Vaillancourt JP, Zamboni R, Nicholson DW, Thornberry NA. Purification and catalytic properties of human caspase family members. Cell Death Differ. 1999;6:362–369. [PubMed]
  • Garden GA, Libby RT, Fu YH, Kinoshita Y, Huang J, Possin DE, Smith AC, Martinez RA, Fine GC, Grote SK, et al. Polyglutamine-expanded ataxin-7 promotes non-cell-autonomous purkinje cell degeneration and displays proteolytic cleavage in ataxic transgenic mice. J Neurosci. 2002;22:4897–4905. [PubMed]
  • Gervais FG, Xu D, Robertson GS, Vaillancourt JP, Zhu Y, Huang J, LeBlanc A, Smith D, Rigby M, Shearman MS, et al. Involvement of caspases in proteolytic cleavage of Alzheimer’s amyloid-beta precursor protein and amyloidogenic A beta peptide formation. Cell. 1999;97:395–406. [PubMed]
  • Graham RK, Deng Y, Slow EJ, Haigh B, Bissada N, Lu G, Pearson J, Shehadeh J, Bertram L, Murphy Z, et al. Cleavage at the caspase-6 site is required for neuronal dysfunction and degeneration due to mutant huntingtin. Cell. 2006a;125:1179–1191. [PubMed]
  • Graham RK, Slow EJ, Deng Y, Bissada N, Lu G, Pearson J, Shehadeh J, Leavitt BR, Raymond LA, Hayden MR. Levels of mutant huntingtin influence the phenotypic severity of Huntington disease in YAC128 mouse models. Neurobiol Dis. 2006b;21:444–455. [PubMed]
  • Graham RK, Pouladi MA, Joshi P, Lu G, Deng Y, Wu NP, Figueroa BE, Metzler M, André VM, Slow EJ, Raymond L, Friedlander R, Levine MS, Leavitt BR, Hayden MR. Differential susceptibility to excitotoxic stress in YAC128 mouse models of Huntington disease between initiation and progression of disease. J Neurosci. 2009;29(7):2193–204. [PMC free article] [PubMed]
  • Gray M, Shirasaki DI, Cepeda C, Andre VM, Wilburn B, Lu XH, Tao J, Yamazaki, Li SH, Sun YE, et al. Full-length human mutant huntingtin with a stable polyglutamine repeat can elicit progressive and selective neuropathogenesis in BACHD mice. J Neurosci. 2008;28:6182–6195. [PMC free article] [PubMed]
  • Guidetti P, Luthi-Carter RE, Augood SJ, Schwarcz R. Neostriatal and cortical quinolinate levels are increased in early grade Huntington’s disease. Neurobiol Dis. 2004;17:455–461. [PubMed]
  • Guidetti P, Bates GP, Graham RK, Hayden MR, Leavitt BR, Macdonald ME, Slow EJ, Wheeler VC, Woodman B, Schwarcz R. Elevated brain 3-hydroxykynurenine and quinolinate levels in Huntington disease mice. Neurobiol Dis. 2006;23:190–197. [PubMed]
  • Guo H, Albrecht S, Bourdeau M, Petzke T, Bergeron C, LeBlanc AC. Active caspase-6 and caspase-6-cleaved tau in neuropil threads, neuritic plaques, and neurofibrillary tangles of Alzheimer’s disease. Am J Pathol. 2004;165:523–531. [PubMed]
  • Hackam AS, Singaraja R, Wellington CL, Metzler M, McCutcheon K, Zhang T, Kalchman M, Hayden MR. The influence of huntingtin protein size on nuclear localization and cellular toxicity. J Cell Biol. 1998;141:1097–1105. [PMC free article] [PubMed]
  • Harris JA, Devidze N, Halabisky B, Lo I, Thwin MT, Yu GQ, Bredesen DE, Masliah E, Mucke L. Many neuronal and behavioral impairments in transgenic mouse models of Alzheimer’s disease are independent of caspase cleavage of the amyloid precursor protein. J Neurosci. 2010;30(1):372–81. [PMC free article] [PubMed]
  • Henshall DC, Skradski SL, Meller R, Araki T, Minami M, Schindler CK, Lan JQ, Bonislawski DP, Simon RP. Expression and differential processing of caspases 6 and 7 in relation to specific epileptiform EEG patterns following limbic seizures. Neurobiol Dis. 2002;10:71–87. [PubMed]
  • Hermel E, Gafni J, Propp SS, Leavitt BR, Wellington CL, Young JE, Hackam AS, Logvinova AV, Peel AL, Chen SF, Hook V, Singaraja R, Krajewski S, Goldsmith PC, Ellerby HM, Hayden MR, Bredesen DE, Ellerby LM. Specific caspase interactions and amplification are involved in selective neuronal vulnerability in Huntington’s disease. Cell Death Differ. 2004;11:424–438. [PubMed]
  • Hodges A, Strand AD, Aragaki AK, Kuhn A, Sengstag T, Hughes G, Elliston LA, Hartog C, Goldstein DR, Thu D, et al. Regional and cellular gene expression changes in human Huntington’s disease brain. Hum Mol Genet. 2006;15:965–977. [PubMed]
  • Hodgson JG, Agopyan N, Gutekunst CA, Leavitt BR, LePiane F, Singaraja R, Smith DJ, Bissada N, McCutcheon K, Nasir J, Jamot L, et al. A YAC mouse model for Huntington’s disease with full- length mutant huntingtin, cytoplasmic toxicity, and selective striatal neurodegeneration. Neuron. 1999;23(1):181–92. [PubMed]
  • Huang K, Kang MH, Askew C, Kang R, Sanders SS, Wan J, Davis NG, Hayden MR. Palmitoylation and function of Glial Glutamate Transporter-1 is reduced in the YAC128 mouse model of Huntington disease. Neurobiol Dis. 2010 In press. [PubMed]
  • Jiang CH, Tsien JZ, Schultz PG, Hu Y. The effects of aging on gene expression in the hypothalamus and cortex of mice. Proc Natl Acad Sci U S A. 2001;98(4):1930–4. [PubMed]
  • Jiang H, Poirier MA, Liang Y, Pei Z, Weiskittel CE, Smith WW, DeFranco DB, Ross CA. Depletion of CBP is directly linked with cellular toxicity caused by mutant huntingtin. Neurobiol Dis. 2006;23(3):543–51. [PubMed]
  • Kim YJ, Yi Y, Sapp E, Wang Y, Cuiffo B, Kegel KB, Qin ZH, Aronin N, DiFiglia M. Caspase 3- cleaved N-terminal fragments of wild-type and mutant huntingtin are present in normal and Huntington’s disease brains, associate with membranes, and undergo calpain-dependent proteolysis. PNAS. 2001;98(22):12784–9. [PubMed]
  • Khoshnan A, Ko J, Watkin EE, Paige LA, Reinhart PH, Patterson PH. Activation of the IkappaB kinase complex and nuclear factor-kappaB contributes to mutant huntingtin neurotoxicity. J Neurosci. 2004;24:7999–8008. [PubMed]
  • Langbehn DR, Brinkman RR, Falush D, Paulsen JS, Hayden MR. A new model for prediction of the age of onset and penetrance for Huntington’s disease based on CAG length. Clin Genet. 2004;65:267–277. [PubMed]
  • LeBlanc A, Liu H, Goodyer C, Bergeron C, Hammond J. Caspase-6 role in apoptosis of human neurons, amyloidogenesis, and Alzheimer’s disease. J Biol Chem. 1999;274:23426–23436. [PubMed]
  • Levkau B, Scatena M, Giachelli CM, Ross R, Raines EW. Apoptosis overrides survival signals through a caspase-mediated dominant-negative NF-kappa B loop. Nat Cell Biol. 1999;1:227–233. [PubMed]
  • Li L, Murphy TH, Hayden MR, Raymond LA. Enhanced striatal NR2B-containing N-methyl-D-aspartate receptor-mediated synaptic currents in a mouse model of Huntington disease. J Neurophysiol. 2004;92:2738–2746. [PubMed]
  • Liu X, Kim CN, Pohl J, Wang X. Purification and characterization of an interleukin-1β-converting enzyme family protease that activates cysteine protease P32 (CPP32) JBC. 1996;271(23):13371–13376. [PubMed]
  • Liang ZQ, Wang XX, Wang Y, Chuang DM, DiFiglia M, Chase TN, Qin ZH. Susceptibility of striatal neurons to excitotoxic injury correlates with basal levels of Bcl-2 and the induction of P53 and c-Myc immunoreactivity. Neurobiol Dis. 2005;20(2):562–73. [PubMed]
  • MacLachlan TK, el Deiry WS. Apoptotic threshold is lowered by p53 transactivation of caspase-6. PNAS. 2002;99:9492–9497. [PubMed]
  • Mangiarini L, Sathasivam K, Seller M, Cozens B, Harper A, Hetherington C, Lawton M, Trottier Y, Lehrach H, Davies SW, Bates GP. Exon 1 of the HD gene with an expanded CAG repeat is sufficient to cause a progressive neurological phenotype in transgenic mice. Cell. 1996;87:493–506. [PubMed]
  • Mazars A, Fernandez-Vidal A, Mondesert O, Lorenzo C, Prevost G, Ducommun B, Payrastre B, Racaud-Sultan C, Manenti S. A caspase-dependent cleavage of CDC25A generates an active fragment activating cyclin-dependent kinase 2 during apoptosis. Cell Death Differ. 2009;16:208–218. [PubMed]
  • Milnerwood AJ, Gladding CM, Pouladi MA, Kaufman AM, Hines RM, Boyd JD, Ko RW, Vasuta OC, Graham RK, Hayden MR, Murphy TH, Raymond LA. Early Increase in Extrasynaptic NMDA Receptor Signaling and Expression Contributes to Phenotype Onset in Huntington’s Disease Mice. Neuron. 2010;65(2):178–190. [PubMed]
  • Morrison RS, Wenzel HJ, Kinoshita Y, Robbins CA, Donehower LA, Schwartzkroin PA. Loss of the p53 tumor suppressor gene protects neurons from kainate-induced cell death. J Neurosci. 1996;16(4):1337–45. [PubMed]
  • Morrison RS, Kinoshita Y, Johnson MD, Guo W, Garden GA. p53-dependent cell death signaling in neurons. Neurochem Res. 2003;28(1):15–27. Review. [PubMed]
  • Nikolaev A, McLaughlin T, O’Leary DD, Tessier-Lavigne M. APP binds DR6 to trigger axon pruning and neuron death via distinct caspases. Nature. 2009;457:981–989. [PMC free article] [PubMed]
  • Okamoto S, Pouladi MA, Talantova M, Yao D, Xia P, Ehrnhoefer DE, Zaidi R, Clemente A, Kaul M, Graham RK, Zhang D, Vincent Chen HS, Tong G, Hayden MR, Lipton SA. Balance between synaptic versus extrasynaptic NMDA receptor activity influences inclusions and neurotoxicity of mutant huntingtin. Nat Med. 2009;15(12):1407–13. [PMC free article] [PubMed]
  • Pellegrini L, Passer BJ, Tabaton M, Ganjei JK, D’Adamio L. Alternative, non-secretase processing of Alzheimer’s beta-amyloid precursor protein during apoptosis by caspase-6 and -8. J Biol Chem. 1999;274:21011–21016. [PubMed]
  • Pompl PN, Yemul S, Xiang Z, Ho L, Haroutunian V, Purohit D, Mohs R, Pasinetti GM. Caspase gene expression in the brain as a function of the clinical progression of Alzheimer disease. Arch Neurol. 2003;60:369–376. [PubMed]
  • Pouladi MA, Graham RK, Karasinska JM, Xie Y, Santos RD, Petersen A, Hayden MR. Prevention of depressive behaviour in the YAC128 mouse model of Huntington disease by mutation at residue 586 of huntingtin. Brain. 2009;134:919–932. [PubMed]
  • Qin ZH, Chen RW, Wang Y, Nakai M, Chuang DM, Chase TN. Nuclear factor kappaB nuclear translocation upregulates c-Myc and p53 expression during NMDA receptor-mediated apoptosis in rat striatum. J Neurosci. 1999;19:4023–4033. [PubMed]
  • Ratovitski T, Nakamura M, D’Ambola J, Chighladze E, Liang Y, Wang W, Graham RK, Hayden MR, Borchelt DR, Hirschhorn RR, Ross CA. N-terminal proteolysis of full-length mutant huntingtin in an inducible PC12 cell model of Huntington’s disease. Cell Cycle. 2007;6(23):2970–81. [PubMed]
  • Rouaux C, Loeffler JP, Boutillier AL. Targeting CREB-binding protein (CBP) loss of function as a therapeutic strategy in neurological disorders. Biochem Pharmacol. 2004;68:1157–1164. [PubMed]
  • Saganich MJ, Schroeder BE, Galvan V, Bredesen DE, Koo EH, Heinemann SF. Deficits in synaptic transmission and learning in amyloid precursor protein (APP) transgenic mice require C-terminal cleavage of APP. J Neurosci. 2006;26:13428–13436. [PubMed]
  • Seong IS, Ivanova E, Lee JM, Choo YS, Fossale E, Anderson M, Gusella JF, Laramie JM, Myers RH, Lesort M, Macdonald ME. HD CAG repeat implicates a dominant property of huntingtin in mitochondrial energy metabolism. Hum Mol Genet. 2005;14:2871–2880. [PubMed]
  • Slow EJ, van RJ, Rogers D, Coleman SH, Graham RK, Deng Y, Oh R, Bissada N, Hossain SM, Yang Z, Li XJ, Simpson EM, Gutekunst CA, Leavitt BR, Hayden MR. Selective striatal neuronal loss in a YAC128 mouse model of Huntington disease. Hum Mol Genet. 2003;12:1555–1567. [PubMed]
  • Slow EJ, Graham RK, Osmand AP, Devon RS, Lu G, Deng Y, Pearson J, Vaid K, Bissada N, Wetzel R, Leavitt BR, Hayden MR. Absence of behavioral abnormalities and neurodegeneration in vivo despite widespread neuronal huntingtin inclusions. PNAS. 2005;102:11402–11407. [PubMed]
  • Stadelmann C, Deckwerth TL, Srinivasan A, Bancher C, Bruck W, Jellinger K, Lassmann H. Activation of caspase-3 in single neurons and autophagic granules of granulovacuolar degeneration in Alzheimer’s disease. Evidence for apoptotic cell death. Am J Pathol. 1999;155:1459–1466. [PubMed]
  • Steffan JS, Kazantsev A, Spasic-Boskovic O, Greenwald M, Zhu YZ, Gohler H, Wanker EE, Bates GP, Housman DE, Thompson LM. The Huntington’s disease protein interacts with p53 and CREB-binding protein and represses transcription. PNAS. 2000;97(12):6763–8. [PubMed]
  • Taylor-Robinson SD, Weeks RA, Bryant DJ, Sargentoni J, Marcus CD, Harding AE, Brooks DJ. Proton magnetic resonance spectroscopy in Huntington’s disease: evidence in favour of the glutamate excitotoxic theory. Mov Disord. 1996;11:167–173. [PubMed]
  • Tesco G, Koh YH, Kang EL, Cameron AN, Das S, Sena-Esteves M, Hiltunen M, Yang SH, Zhong Z, Shen Y, Simpkins JW, Tanzi RE. Depletion of GGA3 stabilizes BACE and enhances beta-secretase activity. Neuron. 2007;54:721–737. [PMC free article] [PubMed]
  • Thornberry NA, Rano TA, Peterson EP, Rasper DM, Timkey T, Garcia-Calvo M, Houtzager VM, Nordstrom PA, Roy S, Vaillancourt JP, Chapman KT, Nicholson DW. A combinatorial approach defines specificities of members of the caspase family and granzyme B. Functional relationships established for key mediators of apoptosis. J Biol Chem. 1997;272:17907–17911. [PubMed]
  • Thornberry NA, Chapman KT, Nicholson DW. Determination of caspase specificities using a peptide combinatorial library. Methods Enzymol. 2000;322:100–110. [PubMed]
  • Van Raamsdonk JM, Murphy Z, Slow EJ, Leavitt BR, Hayden MR. Selective Degeneration and Nuclear Localization of Mutant Huntingtin in the YAC128 Mouse Model of Huntington Disease. Hum Mol Genet. 2005;14:3823–3835. [PubMed]
  • Vonsattel JP, Myers RH, Stevens TJ, Ferrante RJ, Bird ED, Richardson EP., Jr Neuropathological classification of Huntington’s disease. J Neuropathol Exp Neurol. 1985;44:559–577. [PubMed]
  • Warby SC, Doty CN, Graham RK, Carroll JB, Yang YZ, Singaraja RR, Overall CM, Hayden MR. Activated caspase-6 and caspase-6-cleaved fragments of huntingtin specifically colocalize in the nucleus. Hum Mol Genet. 2008;17:2390–2404. [PubMed]
  • Wellington CL, Singaraja R, Ellerby L, Savill J, Roy S, Leavitt B, Cattaneo E, Hackam A, Sharp A, Thornberry N, et al. Inhibiting caspase cleavage of huntingtin reduces toxicity and aggregate formation in neuronal and nonneuronal cells. J Biol Chem. 2000;275:19831–19838. [PubMed]
  • Wellington CL, Ellerby LM, Gutekunst CA, Rogers D, Warby S, Graham RK, Loubser O, Van Raamsdonk J, Singaraja R, Yang YZ, et al. Caspase cleavage of mutant huntingtin precedes neurodegeneration in Huntington’s disease. J Neurosci. 2002;22:7862–7872. [PubMed]
  • Xanthoudakis S, Roy S, Rasper D, Hennessey T, Aubin Y, Cassady R, Tawa P, Ruel R, Rosen A, Nicholson DW. Hsp60 accelerates the maturation of pro-caspase-3 by upstream activator proteases during apoptosis. EMBO J. 1999;18:2049–2056. [PubMed]
  • Xiang H, Kinoshita Y, Knudson CM, Korsmeyer SJ, Schwartzkroin PA, Morrison RS. Bax involvement in p53-mediated neuronal cell death. J Neurosci. 1998;18(4):1363–73. [PubMed]
  • Yu ZX, Li SH, Evans J, Pillarisetti A, Li H, Li XJ. Mutant huntingtin causes context-dependent neurodegeneration in mice with Huntington’s disease. J Neurosci. 2003;23:2193–2202. [PubMed]
  • Zeron MM, Hansson O, Chen N, Wellington CL, Leavitt BR, Brundin P, Hayden MR, Raymond LA. Increased sensitivity to N-methyl-D-aspartate receptor-mediated excitotoxicity in a mouse model of Huntington’s disease. Neuron. 2002;33(6):849–60. [PubMed]
  • Zeron MM, Fernandes HB, Krebs C, Shehadeh J, Wellington CL, Leavitt BR, Baimbridge KG, Hayden MR, Raymond LA. Potentiation of NMDA receptor-mediated excitotoxicity linked with intrinsic apoptotic pathway in YAC transgenic mouse model of Huntington’s disease. Mol Cell Neurosci. 2004;25(3):469–79. [PubMed]
  • Zhang J, Gorostiza OF, Tang H, Bredesen DE, Galvan V. Reversal of learning deficits in hAPP transgenic mice carrying a mutation at Asp664: a role for early experience. Behav Brain Res. 2010;206(2):202–7. [PMC free article] [PubMed]
  • Zhang WH, Wang X, Narayanan M, Zhang Y, Huo C, Reed JC, Friedlander RM. Fundamental role of the Rip2/caspase-1 pathway in hypoxia and ischemia-induced neuronal cell death. PNAS. 2003;100:16012–16017. [PubMed]