Search tips
Search criteria 


Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
J Neurochem. Author manuscript; available in PMC 2011 December 1.
Published in final edited form as:
PMCID: PMC3057931

Regulation of protein phosphatase 2A methylation by LCMT1 and PME-1 plays a critical role in differentiation of neuroblastoma cells


Neuritic alterations are a major feature of many neurodegenerative disorders. Methylation of protein phosphatase 2A (PP2A) catalytic C subunit by the leucine carboxyl methyltransferase LCMT1, and demethylation by the methylesterase PME-1, is a critical PP2A regulatory mechanism. It modulates the formation of PP2A holoenzymes containing the Bα subunit, which dephosphorylate key neuronal cytoskeletal proteins, including tau. Significantly, we have reported that LCMT1, methylated C and Bα expression levels are down-regulated in Alzheimer disease-affected brain regions. Here, we show that enhanced expression of LCMT1 in cultured N2a neuroblastoma cells, which increases endogenous methylated C and Bα levels, induces changes in F-actin organization. It promotes serum-independent neuritogenesis and development of extended tau-positive processes upon N2a cell differentiation. These stimulatory effects can be abrogated by LCMT1 knockdown and S-adenosylhomocysteine, an inhibitor of methylation reactions. Expression of PME-1 and the methylation-site L309Δ C subunit mutant, which decrease intracellular methylated C and Bα levels, block N2a cell differentiation and LCMT1-mediated neurite formation. Lastly, inducible and non-inducible knockdown of Bα in N2a cells inhibit process outgrowth. Altogether, our results establish a novel mechanistic link between PP2A methylation and development of neurite-like processes.

Keywords: Protein phosphatase 2A, methyltransferase, methylesterase, methylation, differentiation


Ser/Thr protein phosphatase 2A (PP2A or PPP2) is a family of major multimeric enzymes that are abundant in the brain and other tissues. In the typical mammalian holoenzyme, the catalytic C subunit (PPP2CA or PPP2CB) is usually in complex with a scaffolding A subunit (PPP2R1A or PPP2R1B), and a third variable regulatory “B” subunit. Several B subunit gene families (B/B55/PPP2R2, B′/B56/PPP2R5, B″/PPP2R3 and striatins) have been identified, each comprising several isoforms and/or splice variants that are differentially expressed in tissues and cells. PP2A subunit composition plays a key role in ensuring PP2A substrate specificity. In addition, PP2A can be regulated by many cellular factors, subunit phosphorylation, methylation or ubiquitination, and interaction with a wide variety of cellular or foreign proteins and inhibitors (Reviewed in Sontag 2001; Janssens et al. 2008; Virshup and Shenolikar 2009). Notably, methylation of the catalytic C subunit on the Leu-309 residue has emerged in recent years as a highly-conserved mechanism that modulates the assembly of PP2A heterotrimeric complexes (Reviewed in Janssens et al. 2008). It is catalyzed by the leucine carboxyl methyltransferase LCMT1 (or PPMT1) (Lee and Stock 1993; Leulliot et al. 2004). In mammalian cells, methylation promotes the biogenesis and stabilization of major PP2A holoenzymes containing the Bα (or PPP2R2A) subunit (Ogris et al. 1997; Bryant et al. 1999; Tolstykh et al. 2000; Yu et al. 2001; Schild et al. 2006a; Nunbhakdi-Craig et al. 2007; Longin et al. 2007). Significantly, knockdown and/or inactivation of LCMT1 are associated with reduced formation of Bα-containing PP2A heterotrimers and a net loss of intracellular Bα amounts (Sontag et al. 2007; Lee and Pallas 2007; Sontag et al. 2008). On the other hand, the dedicated PP2A methylesterase PME-1 (Ogris et al. 1999) binds to the active site of PP2A, resulting in both PP2A demethylation and inactivation (Xing et al. 2008). The complex between PME-1 and inactive PP2A may prevent the inappropriate activation of PP2A C during PP2A biogenesis (Hombauer et al. 2007). Thus, there is strong evidence that changes in C subunit methylation state can critically influence PP2A biogenesis and intracellular subunit composition, thereby affecting its substrate specificity. In support for the pathophysiological significance of this mechanism, we have previously reported that LCMT1, methylated PP2A and Bα can become down-regulated in vivo in response to alterations in one-carbon metabolism (Sontag et al. 2007; Sontag et al. 2008), and in Alzheimer disease (AD) neurons bearing neurofibrillary tangles (Sontag et al. 2004b). Yet, the precise role and regulation of neuronal PP2A methylation are not well understood.

Notably, neuritic abnormalities and disruption leading to axonal transport defects are associated with pathological lesions in AD and other neurodegenerative disorders (Hashimoto and Masliah 2003; Stokin and Goldstein 2006). A critical role for general PP2A activity in axonogenesis and axonal transport was recently brought to light (Yang et al. 2007; Zhu et al. 2010). Moreover, specific PP2A isoforms participate in the process of neuronal differentiation (Strack 2002; Schild et al. 2006b; Van Kanegan and Strack 2009) and dendritic branching (Brandt et al. 2008). To gain some fundamental new insights into the functional significance of PP2A methylation for normal neuronal homeostasis and AD pathogenesis, we thus chose here to assess how deregulating PP2A methylation affects neuritogenesis in a widely used neuroblastoma cell model.


N2a cell culture, transfection and generation of stable clones

Control (American Type Culture Collection, Manassas, VA) and transfected Neuro-2a (N2a) cells were maintained in DMEM (Invitrogen, Carlsbad, CA) containing 2.5 mM Hepes, pH 7.4, 10% fetal bovine serum (HyClone, Logan, UT) and 10 μg/ml gentamycin (Invitrogen). Unlessindicated, all chemicals used in this study were from Sigma-Aldrich, St. Louis, MO. Cell transfection was performed using Metafectene Pro reagent following the manufacturer’s instructions (Biontex laboratories, Munich, Germany). N2a cells stably overexpressing either hemagluttinin (HA)-tagged wild-type C (N2a-Wt C), HA-tagged L309Δ C (N2a-L309Δ), HA-tagged LCMT1 (N2a-LCMT1), Myc-tagged PME-1 (N2a-PME1) or HA-tagged Bα (N2a-Bα) have been fully characterized in previous studies (Nunbhakdi-Craig et al. 2007; Sontag et al. 2007; Sontag et al. 2008). Double stable clones expressing both HA-tagged LCMT1 and either HA-tagged Wt C (N2a-LCMT1 + Wt C) or HA-tagged L309Δ (N2a-LCMT1 + L309Δ) were obtained after re-transfection of N2a-LCMT1 clones with either pcDNA 3.1 expressing Wt C (Goedert et al. 2000) or the L309Δ C mutant (Sontag et al. 2007), followed by selection with 200μg/ml hygromycin (Roche, Indianapolis, IN) and 600 μg/ml G418 (Invitrogen). Double stable clones expressing both LCMT1 and PME-1 (N2a-LCMT1 + PME-1) were obtained after re-transfection of N2a-LCMT1 clones with pBABE encoding Myc-tagged mouse PME-1 (Sontag et al. 2007) followed by selection with 200 μg/ml hygromycin and 1 μg/ml puromycin (Sigma). Cells stably re-transfected with the corresponding empty vector alone were used as “controls”. In all our experiments, we found that control cells behaved like untransfected N2a cells. At least 3 distinct stable clones and 2 mixed populations resulting from pooling selected clones together were used throughout our studies with similar results. The expression levels of transfected proteins were constantly monitored by both immunoblotting and/or immunofluorescence. Of note, we verified that ectopically expressed proteins could still be detected after incubation of cells in differentiation medium.

Knockdown experiments

Specific knockdown of LCMT1 or PME-1 was carried out in the indicated N2a cell clone after transfection with selective siRNA exactly as reported previously; control cells were transfected with corresponding mismatched siRNAs (Sontag et al. 2008). Under our experimental conditions, specific protein knockdown was obtained 72 h post-transfection and persisted for another 72 h (Sontag et al. 2008). Thus, differentiation studies were started 72 h post-transfection. Specific PP2A Bα subunit knockdown was performed in N2a cells using transfection with the pSIREN-DNR-DsRed-Express-shBα vector targeting sh-Bα, exactly as described previously (Nunbhakdi-Craig et al. 2007; Sontag et al. 2008). N2a cell-derived clones allowing inducible Bα knockdown were generated as follows. N2a were transfected with the vector pcDNA6/TR (Invitrogen) containing the tetracycline repressor (TR) gene under the control of the human cytomegalovirus (CMV) immediate early promoter and a blasticidin resistance gene. Single clones were isolated and a cell line stably expressing TR, termed N2aTRex14, was established. N2aTRex14 were transfected with pNTOPuro containing a shRNA targeting PP2A Bα subunit (shBα, AAGTGGCAAGCGAAAGAAAGA) or a corresponding shRNA mismatch sequence (shControl, GTGACAAGCTAAAGATAGA) (Van Kanegan et al. 2005). The pNTOPuro vector was obtained by replacing the neomycin with the puromycin resistance gene in the pNTONeo vector (Strack et al. 2004). Stable N2aTRex14-shBα and N2aTRex14-shControl clones were obtained following selection with 5 μg/ml puromycin (Sigma) and single cell expansion. They were grown in DMEM supplemented with 10% fetal calf serum (Sigma), 100 units/ml penicillin, 100 μg/ml streptomycin and 5 μg/ml blasticidin (Invitrogen).

The efficiency of protein knockdown was systematically verified by Western blotting at the beginning and end of each differentiation experiment performed in this study. Since maximal knockdown of LCMT1, PME-1 or Bα can ultimately lead to apoptosis (Lee and Pallas 2007; Sontag et al. 2008), the experimental conditions were optimized to allow for protein knockdown while minimizing potential cell loss.

Determination of protein expression and PP2A methylation levels

Total cell extracts were prepared and analyzed by gel electrophoresis and Western blotting for LCMT1, PME-1 and PP2A subunit expression levels exactly according to our published protocols (Sontag et al. 2007; Sontag et al. 2008). Primary antibodies utilized in this study included anti-HA clone 16B12 (Covance Research Products Inc., Berkeley, CA), anti-Myc clone 4A6 and anti-B55 clone “2G9” (Millipore, Temecula, CA). Anti β-actin antibodies (Sigma) were utilized to normalize for protein loading. Monoclonal methylation- or demethylation-specific (Millipore), and methylation-independent (BD Biosciences, San Jose, CA) anti-C antibodies were utilized to quantify PP2A methylation levels by Western blotting and densitometry exactly as described previously (Sontag et al. 2007; Sontag et al. 2008).

Cell differentiation

To study the ability of cells to grow neurites, all cells were plated in regular cell culture medium at equivalent low density (~5×104 cells/cm2) onto poly-L-Lysine (Sigma)-coated multi-well dishes (for morphological analysis), glass coverslips (for immunocytochemistry) or filter inserts (for neurite outgrowth quantification assays). For N2a knockdown experiments, cells were seeded on poly-L-lysine-coated dishes 72 h post-transfection. Once attached (after 4–6 h), the cells were quickly washed with phosphate-buffered saline (PBS) and incubated for 24–96 h in differentiation medium (DMEM containing 0.1% FBS). Control cells were left in regular cell culture medium. When indicated in some experiments, 10 μM retinoic acid (RA; Sigma) was added to the differentiating medium. For differentiation studies of stable N2aTRex14 clones, cells were first incubated for 72 h in regular cell culture medium with or without 1 μg/ml Doxycyclin (Dox, Sigma) then seeded onto poly-L-Lysine-coated multi-well dishes. On the next day, cells were incubated for 24–48 h in differentiation medium containing 1% serum in the presence or absence of 10 μM RA and 1 μg/ml Dox. Note that Bα knockdown was induced in N2a-TRex-shBα clones by supplementing the cell culture medium for 72 h with 1μg/ml Dox, and could be maintained by continuing to supplement the medium with Dox for the whole duration of the differentiation experiment.

Analysis of cell morphology and neurite-like cell processes

Cells were analyzed by phase-contrast microscopy for their morphology and the presence and length of neurite-like processes, which were defined here as thin protrusions that were at least one cell diameter in length (Dehmelt et al. 2003). At least 100 cells/condition and 3 distinct stable cell clones or transfection experiments were analyzed in each condition. Just prior to examination, the cell medium was carefully replaced with phenol red-free DMEM medium (Invitrogen). Cells were examined by phase contrast (15× magnification) on a Nikon Eclipse TE2000-U microscope equipped with a digital camera. Images were directly acquired using the MetaMorph software and transferred to Adobe Photoshop/Illustrator CS4 (Adobe Systems Incorporated, San Jose, CA). The length of neurite-like processes was determined after manual tracing. Statistical analysis was performed using Student’s t-test. Differences with p values < 0.05 were considered statistically significant. In some experiments, quantification was performed using the Neurite Outgrowth Quantification Assay kit (Millipore, Temecula, CA). Briefly, cells were plated in duplicate filter inserts of Transwell plates and processed 72 h after incubation in differentiation medium. Quantification of process outgrowth was performed after staining and extraction of the cell processes following the manufacturer’s instructions. In other experiments, duplicate batches of cells were plated on glass coverslips and analyzed by immunofluorescence microscopy for the presence of neurite-like processes. Cells were washed quickly at 37°C with PEM buffer (0.1 M PIPES, pH 6.9, 2 mM EGTA, 5 mM MgCl2) and fixed for 5 min at −20°C with absolute methanol (Nunbhakdi-Craig et al. 2007). Cells were stained for 1 h with mouse anti-βIII-tubulin antibody (Covance Research Products, Berkeley, CA) followed by incubation for 1 h with Alexa Fluor 488-conjugated goat antibodies (Invitrogen). The samples were mounted with Fluoromount (Fisher Scientific, Pittsburgh, PA) and examined on a Zeiss microscope (Carl Zeiss Inc., Thornwood, NY) using a 63× objective. Captured images were transferred to Adobe Photoshop/Illustrator CS4.

Analysis of tau and F-actin by confocal microscopy

Cells were fixed for 20 min with 4% paraformaldehyde, permeabilized for 5 min in phosphate buffered saline containing 0.1% Triton X-100, then washed and labeled exactly as described previously (Sontag et al. 1995;Nunbhakdi-Craig et al. 2007). Cells were stained for 2 h at room temperature with rabbit anti-tau (1:1,000; rPeptide, Bogart, GA) or monoclonal Tau-1 (1:100; Millipore; North Ryde, Australia) antibodies followed by incubation for 1 h with Alexa Fluor 488-conjugated goat antibodies (Invitrogen) To visualize actin, cells were directly stained for 1 h with Alexa Fluor 488-phalloidin (Invitrogen). The samples were mounted with Fluoromount and examined on an Olympus FluoView FV1000 confocal microscope (Olympus, North Ryde, Australia) using a 60x objective. Captured images were transferred to Adobe Photoshop and Illustrator CS4.


Expression of the methylation-site mutant of PP2A catalytic subunit prevents N2a cell differentiation

We have previously shown that endogenous PP2A methylation levels can be selectively manipulated in N2a cells using ectopic expression or knockdown of PP2A methyltransferase and methylesterase, and expression of the PP2A methylation-site L309Δ C subunit mutant (Nunbhakdi-Craig et al. 2007; Sontag et al. 2007; Sontag et al. 2008). Similar strategies were used here to investigate the role of PP2A methylation in N2a cell differentiation. Like other neuroblastoma cells, N2a cells can be induced to differentiate following serum starvation and addition of retinoic acid (RA) (Wu et al. 2009). Enhanced expression of the neuronal-specific class III β-tubulin accompanies neurite outgrowth during differentiation, so that neurite-like processes can be labeled using antibodies to βIII-tubulin (Aletta 1996), or directly visualized by phase contrast microscopy. As expected, control N2a cells plated on Poly-L-lysine and grown in regular cell culture medium exhibited the typical undifferentiated morphology characterized by round-shaped cell bodies with absent or tiny cell processes (Fig. 1a). When they were switched from high to low serum-containing cell culture medium, they started to become pyramidal and grew several neurite-like processes. About 20–25% of control N2a cells (n = 3) harbored processes after 24 h incubation in differentiation medium. However, ~80–90% (n = 3) of N2a-Wt C cells stably expressing PP2A wild-type C subunit and 0–2% (n = 3) of N2a-L309Δ clones stably expressing the methylation-defective L309Δ C subunit mutant were differentiated under the same experimental conditions. In this context, it is worth mentioning that we have previously reported that total C subunit levels are increased by ~30% in N2a-Wt C and N2a-L309Δ cells relative to controls, and that HA-tagged wild-type or mutated C subunit levels represent ~40% of total C subunit levels in these clones (Sontag et al. 2007). Overexpression of PP2A Wt C subunit, which increases total endogenous PP2A activity by ~30% relative to controls (Sontag et al. 2007), also appeared to stimulate formation of neurite-like processes. After 48 h incubation in low serum medium, N2a-Wt C cells were well-differentiated, but N2a-L309Δ cells failed to develop processes (Fig. 1b). A quantitative assay further confirmed that expression of Wt C subunit stimulated outgrowth of neurite-like processes by ~3-fold in N2a cells incubated for 72 h in low serum-containing medium, while expression of the L309Δ C mutant dramatically prevented it (Fig. 1c). Similar stimulatory effects of expressed Wt C on differentiation were observed in N2a cells incubated with RA, which is known to accelerate neuritogenesis in serum-starved cells. At the same time, incubating N2a-L309Δ cells in RA-containing differentiation medium not only prevented differentiation but ultimately led to compromised cell survival (data not shown).

Fig. 1
Expression of the PP2A methylation-defective L309Δ C subunit mutant inhibits N2a cell differentiation. Control N2a and N2a cells stably expressing the wild-type (N2a-Wt C) or mutated L309Δ (N2a-L309Δ) PP2A C subunit were incubated ...

Expression of PME-1 in N2a cells inhibits cell differentiation while expression of LCMT1 promotes the formation of elongated neurite-like processes

We next assessed the effects of modulating PP2A methylesterase and methyltransferase expression levels in N2a cells. As illustrated in Fig. 2a, stable overexpression of PME-1 in N2a cells, which was accompanied by a ~3-fold increase in total intracellular PME-1 amounts relative to control cells (Sontag et al. 2007), prevented cell differentiation. While extended neurite-like processes were prominent in control cells, only marginal sprouting was observed in N2a-PME1 clones even after 72 h incubation in low serum medium. Conversely, selective PME-1 knockdown in N2a cells, which decreases endogenous PME-1 expression levels by ~68–88% (Sontag et al. 2008), promoted the formation of very elongated and thin neurite-like projections (Fig. 2b). In contrast to PME-1, stable overexpression of LCMT1, which is associated with a ~2-fold increase in total intracellular LCMT1 levels relative to controls (Sontag et al. 2007), was sufficient to induce neuritogenesis in the presence of serum. This was evidenced by the presence of long and thick projections extending from the cell bodies (Fig. 3a), and clearly distinguished N2a-LCMT1 cells from the typical undifferentiated phenotype of control N2a cells grown in regular serum-rich culture medium (Fig. 2a). The outgrowth of neurite-like processes was further accelerated after incubating N2a-LCMT1 cells in low serum-containing differentiating medium. Similar effects were observed in N2a-LCMT1 clones incubated in RA-containing differentiation medium (data not shown). Interestingly, while multiple neurite-like processes per cell body and secondary branching were commonly observed in differentiated control cells, N2a clones expressing high levels of LCMT1 primarily harbored either a single neurite-like protrusion or straight bipolar projections without interstitial branching. Compared to controls, the mean process length of N2a-LCMT1 cells was significantly increased in both high and low serum-containing culture media (Fig. 3b). Notably, these effects were abrogated following LCMT1 knockdown (Fig. 3c), which reduces endogenous LCMT1 levels by ~77–95% (Sontag et al. 2008), or supplementation of the cell medium with S-adenosylhomocysteine (SAH) (Fig. 3d), an inhibitor of LCMT1 methyltransferase activity (Leulliot et al. 2004; Sontag et al. 2007).

Fig. 2
PME-1 expression affects N2a cell differentiation. (a) Control N2a and N2a cells stably expressing PME-1 (N2a-PME1) were incubated for the indicated time in medium containing either 10% (High serum) or 0.1% (Low serum) serum and analyzed by phase contrast ...
Fig. 3
Enhanced expression of LCMT1 promotes the formation of extended neurite-like processes. (a) Control N2a and N2a cells stably expressing LCMT1 (N2a-LCMT1) were incubated for the indicated time in medium containing either 10% (High serum) or 0.1% (Low serum) ...

Further immunofluorescent analysis of N2a-LCMT1 extended cell processes revealed that they were immuno-positive for βIII-tubulin (Fig. 4a) and the axon-specific marker tau (Fig. 4b), indicating that these elongated protrusions resemble neurites and share axonal-like properties of primary neurons (Dehmelt and Halpain 2004). Significantly, the actin filament (F-actin) network also appeared to be reorganized in differentiated N2a-LCMT1 cells, relative to controls (Fig. 4c). F-actin-rich filopodia were abundant in differentiated N2a cells with multiple neurite-like projections or secondary branching. In contrast, the overall actin staining pattern was punctuated and disorganized in differentiated N2a-LCMT1 cells, with only very few short and thin actin filaments visible along the elongated neurite-like processes. These results suggest that enhanced expression of LCMT1 in N2a cells affects F-actin dynamics, which is known to play a critical role in neurite initiation, elongation and branching (Reviewed in Da Silva and Dotti 2002; Luo 2002).

Fig. 4
Characterization of N2a-LCMT1 cells reveals changes in F-actin organization. N2a and N2a-LCMT1 cells were differentiated for 48 h in DMEM containing 0.1 % serum then processed for analysis by confocal microscopy. Representative pictures from three separate ...

Enhanced intracellular amounts of methylated PP2A correlate with the initiation and elongation of neurite-like processes

Interestingly, concomitant ectopic expression of either PME-1 or the Leu309Δ C subunit mutant in N2a-LCMT1 clones blocked LCMT1-induced neuritogenesis (Fig. 5). On the other hand, expression of Wt C in N2a-LCMT1 clones had a synergistic effect on process outgrowth. As observed in N2a-LCMT1 clones, N2a-LCMT1 + Wt C cells were able to develop long processes in both high and low serum media. Compared to the parental N2a-LCMT1 cells (Fig. 3a), there was a ~1.3- to 1.6-fold (n = 3) increase in mean process length in these double clones upon differentiation. However, unlike N2a-LCMT1 cells, differentiated N2a-LCMT1 + Wt C cells frequently exhibited secondary branching, so that their morphological appearance was more closely related to that of well-differentiated N2a-Wt C clones (Fig. 1c).

Fig. 5
Expression of either L309Δ C subunit mutant or PME-1 blocks LCMT1-dependent process formation. (a) N2a-LCMT1 cells were stably transfected with plasmids expressing either HA-tagged Wt C (N2a-LCMT1 + Wt C), HA-tagged Leu309Δ C (N2a-LCMT1 ...

To further support the hypothesis that PP2A methylation plays a major role in neurite-like process initiation and outgrowth, we compared PP2A methylation state in the single and double clones that were analyzed here for their ability to differentiate (Fig. 6). Stable expression of the L309Δ C mutant or PME-1 in N2a cells, which inhibit differentiation (Figs. 1 and and2),2), reduced endogenous levels of methylated PP2A by ~45% and ~60%, respectively, according to our previous studies (Nunbhakdi-Craig et al. 2007; Sontag et al. 2007). Conversely, total methylated PP2A levels were increased by ~35% (Sontag et al. 2007) and neuritogenesis was readily stimulated (Fig. 3) following stable overexpression of LCMT1 in N2a cells. Expression of Wt C, which enhances total C subunit amounts and PP2A activity by ~30% in N2a cells (Nunbhakdi-Craig et al. 2007; Sontag et al. 2007), also increased the total pool of intracellular PP2A C available for LCMT1-dependent methylation. Not surprisingly, the highest levels of methylated PP2A were present in clones overexpressing both LCMT1 and PP2A Wt C subunit. Relative to controls, the ~2-fold increase in endogenous methylated PP2A content in these double clones was associated with marked process outgrowth either in the absence or presence of serum (Fig. 5b). On the other hand, LCMT1-mediated neuritogenesis was abolished following expression of either the L309Δ mutant or PME-1 (Fig. 5), which both induced a large drop in intracellular methylated PP2A amounts relative to the parental N2a-LCMT1 clones. Of note, N2a-LCMT1 + PME-1 double clones expressed higher levels of the methylesterase than N2a-PME1 single clones, which likely explains why total levels of methylated C were lower in these cells. Altogether, our results suggest that enhancing PP2A methylation stimulates the formation and elongation of neurite-like processes. They also support the hypothesis that functional levels of LCMT1 and PME-1, and a fine balance between intracellular methylated and demethylated PP2A pools, are critically required for proper N2a cell differentiation.

Fig. 6
PP2A methylation status in single and double N2a clones. Total homogenates were prepared from four separate N2a single or double clones and analyzed by Western blotting for PP2A methylation state using a combination of methylation-specific, demethylation-specific ...

Bα is critically required for formation of neurite-like processes

We have previously shown in N2a cells that LCMT1-dependent PP2A methylation promotes the formation and stabilization of Bα-containing PP2A holoenzymes; conversely, down-regulation of LCMT1 and methylated C is associated with a loss of endogenous Bα subunits (Sontag et al. 2008). The results of our PP2A methylation studies thus raised the possibility that Bα-containingPP2A holoenzymes, which expression is highly sensitive to changes in C subunit methylation state, participate in N2a cell differentiation. To address this hypothesis, we examined the behavior of N2a cells in response to changes in Bα expression levels. As illustrated in Fig. 7a-b, overexpression of Bα in N2a cells, which results in a mean ~180% increase in endogenous Bα levels relative to controls (Sontag et al. 2008), stimulated neurite-like process extension. Conversely, selective knockdown of Bα in N2a cells, which reduces endogenous protein levels by ~half (Nunbhakdi-Craig et al. 2007; Sontag et al. 2008), inhibited cell differentiation. To further support the role of Bα in process formation, we also generated stable N2a-derived, N2a-TRex14 cell lines in which Bα knockdown could be induced by incubation of cells with doxycycline (Dox) (Fig. 7c). As observed in N2a cells transiently transfected with vectors encoding Bα silencing (shBα) target sequences (Fig. 7a), the induction of Bα knockdown in N2a-TRex14 clones resulted in marked down-regulation of Bα expression levels. The decrease in Bα levels was sufficient to block the neuritogenesis normally triggered by incubating cells in medium containing low serum with or without RA (Fig. 7d). At the same time, N2a-TRex14-shBα clones maintained in the absence of Dox, or N2a-Trex-shControl clones stably transfected with vectors encoding shControl mismatch Bα target sequences, were able to extend processes when switched to differentiation media. Together, these results support the hypothesis that Bα-containing PP2A isoforms play an essential role in N2a cell differentiation.

Fig. 7
Changes in Bα expression levels affect neurite-like process formation. (a) N2a cells were mock-transfected (N2a-Mock) or transfected with either sh-Bα (N2a-shBα) or HA-tagged Bα (N2a-Bα). Representative phase contrast ...


In agreement with a recent report showing that up-regulation of PP2A catalytic subunit promotes axonal formation and elongation while PP2A inhibition prevents differentiation (Zhu et al. 2010), we found that neurite-like process outgrowth is facilitated in N2a-WT C cells. However, instead of looking at the effect of modulating PP2A activity, we chose here to focus our attention on assessing the potential role of PP2A methylation in N2a cell differentiation, which have been widely used to study formation of neurite-like processes. In the context of these studies, it is important to note that C subunit methylation likely modulates PP2A substrate specificity (Reviewed in Janssens et al. 2008) through its role in PP2A biogenesis (Hombauer et al. 2007). We and others have shown that the methylation-site L309Δ mutant cannot bind to regulatory B subunits, but can still associate with other regulatory subunits from the B′ and B″ families(Nunbhakdi-Craig et al. 2007; Longin et al. 2007). In addition, down-regulation of LCMT1 and methylated PP2A expression levels lead to a loss of Bα and compensatory changes inintracellular PP2A subunit composition that can affect its substrate specificity and targeting (Schild et al. 2006a; Gentry et al. 2005; Lee and Pallas 2007; Longin et al. 2007; Sontag et al. 2008). Our data provide the first evidence that modulating PP2A methylation can dramatically affect the differentiation process in N2a cells. We have also obtained similar results in preliminary studies performed in human SH-SY5Y neuroblastoma and rat PC12 cells (E. Sontag, unpublished results). Notably, enhancing LCMT1 expression was able to trigger serum-independent differentiation. Data from the double N2a-LCMT1 + L309Δ clones indicated that the bability of LCMT1 to drive the initiation and extension of neurite-like processes was primarily mediated by PP2A. Most importantly, the extent of both process formation and elongation appeared to be highly correlated with the total levels of methylated PP2A enzymes present in our single and double clones. Interestingly, protein methylation is involved in neurite outgrowth in PC12 cells (Cimato et al. 1997) and general inhibition of methyltransferase activity interferes with neuronal differentiation of P19 embryonal cells (Hong et al. 2008). Accordingly, the abilityof LCMT1 to promote neuritogenesis was impeded by incubating N2a cells with 100μM SAH, a universal inhibitor of cellular methylation reactions. In agreement with the role of this metabolite in inhibiting LCMT1 methyltransferase activity (Leulliot et al. 2004), we have previously reported that supplementing N2a cell culture medium with 100 μM SAH induces a 40–50% decrease in endogenous methylated C levels (Sontag et al. 2007). Thus, together with our findings that the L309Δ mutant blocks neuritogenesis in N2a and N2a-LCMT1 cells, these observations strongly support the hypothesis that PP2A is one of the methylated proteins critically required for commencement of the neuronal differentiation process.

Results from PME-1 overexpression studies in N2a and N2a-LCMT1 cells also indicate that increased PP2A demethylation has an adverse effect on the initiation of neurite-like process formation. This may be in part because PME-1 overexpression induces a loss of methylated PP2A and subsequent loss of Bα in N2a cells (Sontag et al. 2008), and the resulting down-regulation of Bα prevents differentiation (Fig. 7). Bα-containing PP2A holoenzymes are very abundant in neurons where they regulate microtubule stability (Nunbhakdi-Craig et al. 2007) and the phosphorylation state of tau (Sontag et al. 2008; Xu et al. 2008), amyloid precursor protein (APP) (Sontag et al. 2007) and neurofilament proteins (Strack et al. 1997). It is well recognized that the microtubule cytoskeleton (Fukushima et al. 2009), tau (Stoothoff and Johnson 2005), APP (Stokin and Goldstein 2006) and neurofilament proteins (Szaro and Strong 2010) all play a critical role in axonal growth. In addition, many signaling pathways, including the MAP kinase (ERK) pathway (Van Kanegan et al. 2005), are regulated by Bα-containing PP2A holoenzymes. Based on these observations, it is difficult to pinpoint the precise mechanisms that directly or indirectly contribute to Bα-dependent effects on N2a cell differentiation in our study.

It has been reported that differentiation of SH-SY5Y cells or PC12 cells does not affect Bα mRNA or protein expression levels. In contrast, the mRNA and/or protein levels of Bβ, Bγ, and Bδ, which also belong to the PP2A regulatory B subunit family, but are much less abundant than Bα, become either up- or down-regulated during the differentiation process in those cells. As a result, it had been proposed that those are more likely to be specifically required for early neurite formation (Strack 2002; Schild et al. 2006b). Indeed, Bγ plays a key role in MAP kinase-dependent PC6-3 cell differentiation (Strack 2002). Recently, PP2A holoenzymes containing the B′β and B′δ subunits have also been implicated in nerve growth factor-mediated PC12 cell differentiation (Van Kanegan and Strack 2009), and dendritic branching (Brandt et al. 2008). While Bα protein expression levels do not fluctuate during the differentiation process, our results indicate that, nevertheless, these basal amounts are critically required for proper neuritogenesis. Indeed, Bα knockdown, which also leads to a subsequent loss of LCMT1 expression levels in N2a cells (Sontag et al. 2008), inhibited N2a cell differentiation (Fig. 7), thereby mimicking the effects of LCMT1 knockdown (Fig. 3). On the other hand, overexpression of Bα, which is associated with down-regulation of demethylated C levels (Sontag et al. 2008), promoted process elongation in serum-starved N2a cells (Fig. 7). Thus, there is a very close interrelationship between LCMT1-dependent PP2A methylation, Bα expression levels and process formation. Yet, we cannot exclude the possibility that variations in intracellular Bα amounts also indirectly influence neuritogenesis by inducing a compensatory increase or decrease in the levels of other regulatory “B” subunit-containing PP2A holoenzymes that play a role in the differentiation process. While many PP2A isoforms have the potential to regulate neuronal differentiation, it is likely that they are recruited in response to distinct extracellular or intracellular stimuli, are functioning in well-defined signaling pathways, and have a differential cellular and subcellular distribution. Further studies will be needed to elucidate their respective contribution to each step of the differentiation process by identifying their specific substrates. However, the lack of suitable B-specific antibodies, and the complex regulation and widespread cellular effects exerted by various PP2A isoforms make this a quite difficult prospect.

Interestingly, tau- and microtubule-containing straight projections reminiscent of neuronal axons were the hallmark of differentiated N2a-LCMT1 cells (Fig. 4). Secondary neuritic branching was observed in differentiated N2a, N2a-Wt C and N2a-LCMT1 + Wt C, but not in N2a-LCMT1 cells. These discrepancies reinforce the central dogma that PP2A activity and methylation differentially modulate PP2A function, and have divergent effects on the growth of primary and secondary cellular processes. Significantly, we observed that the organization of F-actin was altered in N2a-LCMT1 cells relative to controls. Together with microtubules, the actin cytoskeleton plays a critical role in neuritic development (Dehmelt and Halpain 2004). Axon formation, elongation and branching are highly sensitive to local perturbation of microtubule and actin dynamics (Luo 2002). It is thus tempting to speculate that local changes in actin stability could underlie the observed differentiated phenotype of N2a-LCMT1 cells. However, in-depth studies are required to fully understand the mechanisms by which PP2A methylation affects neuronal morphogenesis.

As observed with LCMT1 overexpression, PME-1 knockdown led to the formation of elongated processes. However, they appear somehow anomalous, being quite thin compared to the standard neurites of differentiated N2a cells. We have previously reported that PME-1 silencing in N2a cells does not significantly affect Bα and LCMT1 expression levels (Sontag et al. 2008). While enhanced PME-1 expression inhibits N2a cell differentiation, the aberrant process formation induced by artificially decreasing intracellular PME-1 levels suggests that threshold levels of this PP2A methylesterase need to be maintained for ensuring normal neurite-like process development. Indeed, while LCMT1 and PME-1 selectively regulate PP2A methylation state, combined data from our differentiation experiments and earlier studies (Sontag et al. 2008) indicate that they do not simply exert opposite actions on PP2A regulation. When examined altogether, our results suggest that a subtle equilibrium between LCMT1 and PME-1 expression levels and activity, and their subsequent modulation of the methylation/demethylation state of specific PP2A isoforms, is required for proper coordinated development of the neuritic network.


This work was supported by NIH grant AG18883 (ES), a grant from the University of Newcastle (ES and JMS), and a grant from the Herzfelder Familienstiftung (EO). We thank Stefan Strack (University of Iowa, USA) for providing pNTONeo vectors used for cloning.

Abbreviations used

Alzheimer disease
amyloid precursor protein
actin filaments
leucine carboxyl methyltransferase 1
protein phosphatase methylesterase 1
protein phosphatase 2A
retinoic acid
Wt C
wild-type C subunit


  • Aletta JM. Phosphorylation of type III beta-tubulin PC12 cell neurites during NGF-induced process outgrowth. J Neurobiol. 1996;31:461–475. [PubMed]
  • Brandt N, Franke K, Johannes S, Buck F, Harder S, Hassel B, Nitsch R, Schumacher S. B56beta, a regulatory subunit of protein phosphatase 2A, interacts with CALEB/NGC and inhibits CALEB/NGC-mediated dendritic branching. FASEB J. 2008;22:2521–2533. [PubMed]
  • Bryant JC, Westphal RS, Wadzinski BE. Methylated C-terminal leucine residue of PP2A catalytic subunit is important for binding of regulatory Balpha subunit. Biochem J. 1999;339:241–246. [PubMed]
  • Cimato TR, Ettinger MJ, Zhou X, Aletta JM. Nerve growth factor-specific regulation of protein methylation during neuronal differentiation of PC12 cells. J Cell Biol. 1997;138:1089–1103. [PMC free article] [PubMed]
  • Da Silva JS, Dotti CG. Breaking the neuronal sphere: regulation of the actin cytoskeleton in neuritogenesis. Nat Rev Neurosci. 2002;3:694–704. [PubMed]
  • Dehmelt L, Halpain S. Actin and microtubules in neurite initiation: are MAPs the missing link? J Neurobiol. 2004;58:18–33. [PubMed]
  • Dehmelt L, Smart FM, Ozer RS, Halpain S. The role of microtubule-associated protein 2c in the reorganization of microtubules and lamellipodia during neurite initiation. J Neurosci. 2003;23:9479–9490. [PubMed]
  • Fukushima N, Furuta D, Hidaka Y, Moriyama R, Tsujiuchi T. Post-translational modifications of tubulin in the nervous system. J Neurochem. 2009;109:683–693. [PubMed]
  • Gentry MS, Li Y, Wei H, Syed FF, Patel SH, Hallberg RL, Pallas DC. A Novel Assay for Protein Phosphatase 2A (PP2A) Complexes In Vivo Reveals Differential Effects of Covalent Modifications on Different Saccharomyces cerevisiae PP2A Heterotrimers. Eukaryot Cell. 2005;4:1029–1040. [PMC free article] [PubMed]
  • Goedert M, Satumtira S, Jakes R, Smith MJ, Kamibayashi C, White CL, Sontag E. Reduced binding of protein phosphatase 2A to tau protein with frontotemporal dementia and parkinsonism linked to chromosome 17 mutations. J Neurochem. 2000;75:2155–2162. [PubMed]
  • Hashimoto M, Masliah E. Cycles of aberrant synaptic sprouting and neurodegeneration in Alzheimer’s and dementia with Lewy bodies. Neurochem Res. 2003;28:1743–1756. [PubMed]
  • Hombauer H, Weismann D, Mudrak I, Stanzel C, Fellner T, Lackner DH, Ogris E. Generation of active protein phosphatase 2A is coupled to holoenzyme assembly. PLoS Biol. 2007;5:e155. [PubMed]
  • Hong S, Heo J, Lee S, Heo S, Kim SS, Lee YD, Kwon M, Hong S. Methyltransferase-inhibition interferes with neuronal differentiation of P19 embryonal carcinoma cells. Biochem Biophys Res Commun. 2008;377:935–940. [PubMed]
  • Janssens V, Longin S, Goris J. PP2A holoenzyme assembly: in cauda venenum (the sting is in the tail) Trends Biochem Sci. 2008;33:113–121. [PubMed]
  • Lee J, Stock J. Protein phosphatase 2A catalytic subunit is methyl-esterified at its carboxyl terminus by a novel methyltransferase. J Biol Chem. 1993;268:19192–19195. [PubMed]
  • Lee JA, Pallas DC. Leucine carboxyl methyltransferase-1 is necessary for normal progression through mitosis in mammalian cells. J Biol Chem. 2007;282:30974–30984. [PMC free article] [PubMed]
  • Leulliot N, Quevillon-Cheruel S, Sorel I, de La Sierra-Gallay IL, Collinet B, Graille M, Blondeau K, Bettache N, Poupon A, Janin J, Van Tilbeurgh H. Structure of protein phosphatase methyltransferase 1 (PPM1), a leucine carboxyl methyltransferase involved in the regulation of protein phosphatase 2A activity. J Biol Chem. 2004;279:8351–8358. [PubMed]
  • Longin S, Zwaenepoel K, Louis JV, Dilworth S, Goris J, Janssens V. Selection of Protein Phosphatase 2A Regulatory Subunits Is Mediated by the C Terminus of the Catalytic Subunit. J Biol Chem. 2007;282:26971–26980. [PubMed]
  • Luo L. Actin cytoskeleton regulation in neuronal morphogenesis and structural plasticity. Annu Rev Cell Dev Biol. 2002;18:601–635. [PubMed]
  • Nunbhakdi-Craig V, Schuechner S, Sontag JM, Montgomery L, Pallas DC, Juno C, Mudrak I, Ogris E, Sontag E. Expression of protein phosphatase 2A mutants and silencing of the regulatory Balpha subunit induce a selective loss of acetylated and detyrosinated microtubules. J Neurochem. 2007;101:959–971. [PubMed]
  • Ogris E, Du X, Nelson KC, Mak EK, Yu XX, Lane WS, Pallas DC. A Protein Phosphatase Methylesterase (PME-1) Is One of Several Novel Proteins Stably Associating with Two Inactive Mutants of Protein Phosphatase 2A. J Biol Chem. 1999;274:14382–14391. [PMC free article] [PubMed]
  • Ogris E, Gibson DM, Pallas DC. Protein phosphatase 2A subunit assembly: the catalytic subunit carboxy terminus is important for binding cellular B subunit but not polyomavirus middle tumor antigen. Oncogene. 1997;15:911–917. [PubMed]
  • Schild A, Isenmann S, Tanimoto N, Tonagel F, Seeliger MW, Ittner LM, Kretz A, Ogris E, Gotz J. Impaired development of the Harderian gland in mutant protein phosphatase 2A transgenic mice. Mech Dev. 2006a;123:362–371. [PubMed]
  • Schild A, Schmidt K, Lim YA, Ke Y, Ittner LM, Hemmings BA, Gotz J. Altered levels of PP2A regulatory B/PR55 isoforms indicate role in neuronal differentiation. Int J Dev Neurosci. 2006b;24:437–443. [PubMed]
  • Sontag E. Protein phosphatase 2A: the Trojan Horse of cellular signaling. Cell Signal. 2001;13:7–16. [PubMed]
  • Sontag E, Hladik C, Montgomery L, Luangpirom A, Mudrak I, Ogris E, White CL., III Downregulation of protein phosphatase 2A carboxyl methylation and methyltransferase may contribute to Alzheimer disease pathogenesis. J Neuropathol Exp Neurol. 2004a;63:1080–1091. [PubMed]
  • Sontag E, Luangpirom A, Hladik C, Mudrak I, Ogris E, Speciale S, White CL., III Altered expression levels of the protein phosphatase 2A ABalphaC enzyme are associated with Alzheimer disease pathology. J Neuropathol Exp Neurol. 2004b;63:287–301. [PubMed]
  • Sontag E, Nunbhakdi-Craig V, Bloom GS, Mumby MC. A novel pool of protein phosphatase 2A is associated with microtubules and is regulated during the cell cycle. J Cell Biol. 1995;128:1131–1144. [PMC free article] [PubMed]
  • Sontag E, Nunbhakdi-Craig V, Sontag JM, Diaz-Arrastia R, Ogris E, Dayal S, Lentz SR, Arning E, Bottiglieri T. Protein phosphatase 2A methyltransferase links homocysteine metabolism with tau and amyloid precursor protein regulation. J Neurosci. 2007;27:2751–2759. [PubMed]
  • Sontag JM, Nunbhakdi-Craig V, Montgomery L, Arning E, Bottiglieri T, Sontag E. Folate deficiency induces in vitro and mouse brain region-specific downregulation of leucine carboxyl methyltransferase-1 and protein phosphatase 2A B(alpha) subunit expression that correlate with enhanced tau phosphorylation. J Neurosci. 2008;28:11477–11487. [PMC free article] [PubMed]
  • Stokin GB, Goldstein LS. Axonal transport and Alzheimer’s disease. Annu Rev Biochem. 2006;75:607–627. [PubMed]
  • Stoothoff WH, Johnson GV. Tau phosphorylation: physiological and pathological consequences. Biochim Biophys Acta. 2005;1739:280–297. [PubMed]
  • Strack S. Overexpression of the protein phosphatase 2A regulatory subunit Bgamma promotes neuronal differentiation by activating the MAP kinase (MAPK) cascade. J Biol Chem. 2002;277:41525–41532. [PubMed]
  • Strack S, Cribbs JT, Gomez L. Critical role for protein phosphatase 2A heterotrimers in mammalian cell survival. J Biol Chem. 2004;279:47732–47739. [PubMed]
  • Strack S, Westphal RS, Colbran RJ, Ebner FF, Wadzinski BE. Protein serine/threonine phosphatase 1 and 2A associate with and dephosphorylate neurofilaments. Brain Res Mol Brain Res. 1997;49:15–28. [PubMed]
  • Szaro BG, Strong MJ. Post-transcriptional control of neurofilaments: New roles in development, regeneration and neurodegenerative disease. Trends Neurosci. 2010;33:27–37. [PubMed]
  • Tolstykh T, Lee J, Vafai S, Stock JB. Carboxyl methylation regulates phosphoprotein phosphatase 2A by controlling the association of regulatory B subunits. EMBO J. 2000;19:5682–5691. [PubMed]
  • Van Kanegan MJ, Adams DG, Wadzinski BE, Strack S. Distinct Protein Phosphatase 2A Heterotrimers Modulate Growth Factor Signaling to Extracellular Signal-regulated Kinases and Akt. J Biol Chem. 2005;280:36029–36036. [PubMed]
  • Van Kanegan MJ, Strack S. The protein phosphatase 2A regulatory subunits B’beta and B’delta mediate sustained TrkA neurotrophin receptor autophosphorylation and neuronal differentiation. Mol Cell Biol. 2009;29:662–674. [PMC free article] [PubMed]
  • Virshup DM, Shenolikar S. From promiscuity to precision: protein phosphatases get a makeover. Mol Cell. 2009;33:537–545. [PubMed]
  • Wu PY, Lin YC, Chang CL, Lu HT, Chin CH, Hsu TT, Chu D, Sun SH. Functional decreases in P2X7 receptors are associated with retinoic acid-induced neuronal differentiation of Neuro-2a neuroblastoma cells. Cell Signal. 2009;21:881–891. [PubMed]
  • Xing Y, Li Z, Chen Y, Stock JB, Jeffrey PD, Shi Y. Structural mechanism of demethylation and inactivation of protein phosphatase 2A. Cell. 2008;133:154–163. [PubMed]
  • Xu Y, Chen Y, Zhang P, Jeffrey PD, Shi Y. Structure of a protein phosphatase 2A holoenzyme: insights into B55-mediated Tau dephosphorylation. Mol Cell. 2008;31:873–885. [PMC free article] [PubMed]
  • Yang Y, Yang XF, Wang YP, Tian Q, Wang XC, Li HL, Wang Q, Wang JZ. Inhibition of protein phosphatases induces transport deficits and axonopathy. J Neurochem. 2007;102:878–886. [PubMed]
  • Yu XX, Du X, Moreno CS, Green RE, Ogris E, Feng Q, Chou L, McQuoid MJ, Pallas DC. Methylation of the Protein Phosphatase 2A Catalytic Subunit Is Essential for Association of Balpha Regulatory Subunit But Not SG2NA, Striatin, or Polyomavirus Middle Tumor Antigen. Mol Biol Cell. 2001;12:185–199. [PMC free article] [PubMed]
  • Zhu LQ, Zheng HY, Peng CX, Liu D, Li HL, Wang Q, Wang JZ. Protein phosphatase 2A facilitates axonogenesis by dephosphorylating CRMP2. J Neurosci. 2010;30:3839–3848. [PubMed]