PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
J Neurosci. Author manuscript; available in PMC 2011 August 16.
Published in final edited form as:
PMCID: PMC3050597
NIHMSID: NIHMS273625

Presenilin-1 regulates neural progenitor cell differentiation in the adult brain

Abstract

Presenilin-1 (PS1) is the catalytic core of the aspartyl protease γ-secretase. Previous genetic studies using germ-line deletion of PS1 and conditional knockout mice demonstrated that PS1 plays an essential role in neuronal differentiation during neural development, but it remained unclear whether PS1 plays a similar role in neurogenesis in the adult brain. Here we show that neural progenitor cells infected with lentiviral vectors expressing short interfering RNA (siRNA) for the exclusive knockdown of PS1 in the neurogenic microenvironments, exhibit a dramatic enhancement of cell differentiation. Infected cells differentiated into neurons, astrocytes and oligodendrocytes, suggesting that multipotentiality of neural progenitor cells is not affected by reduced levels of PS1. Neurosphere cultures treated with γ-secretase inhibitors exhibit a similar phenotype of enhanced cell differentiation, suggesting that PS1 function in neural progenitor cells is γ-secretase-dependent. Neurospheres infected with lentiviral vectors expressing siRNA for the targeting of PS1 differentiated even in the presence of the proliferation factors epidermal growth factor (EGF) and basic fibroblast growth factor (bFGF), suggesting that PS1 dominates EFG and bFGF signaling pathways. Reduction of PS1 expression in neural progenitor cells was accompanied by a decrease in epidermal growth factor receptor (EGFR) and β-catenin expression level, suggesting that they are downstream essential transducers of PS1 signaling in adult neural progenitor cells. These findings suggest a physiological role for PS1 in adult neurogenesis, and a potential target for the manipulation of neural progenitor cell differentiation.

Keywords: presenilin-1, neurogenesis, neural progenitor cells, cell differentiation, epidermal growth factor receptor, beta-catenin

Introduction

Neural progenitor cells (NPCs) in the adult brain reside in discrete microenvironments, the subventricular zone (SVZ) and the subgranular layer (SGL) of the dentate gyrus (Kriegstein and Alvarez-Buylla, 2009; Aimone et al., 2010). These niches support NPC self-renewal, proliferation and differentiation into neurons and glia throughout life (Suh et al., 2009). However, the molecular basis for the transition of NPCs from proliferation to differentiation has remained largely elusive. Presenilin-1 (PS1) is the catalytic core of the aspartyl protease γ-secretase (De Strooper et al., 1998; De Strooper et al., 1999; Wolfe et al., 1999; Herreman et al., 2000; Li et al., 2000; Zhang et al., 2000) that catalyzes numerous molecules implicated in neurogenesis [for review (Wines-Samuelson and Shen, 2005; Lazarov and Marr, 2010)]. In humans, mutations in PS1 cause familial Alzheimer’s disease (FAD) (Selkoe, 2001). Mice with targeted disruption in the PS1 locus showed impairments in neurogenesis. Beginning at embryonic day 14.5 the ventricular zone is substantially thinner, indicating a drastic reduction in the number of NPCs (Shen et al., 1997). In PS conditional double knockout (PS cDKO) mice there is a severe depletion of NPCs characterized by their disrupted interkinetic nuclear migration (Kim and Shen, 2008). Reduced numbers of NPCs are thought to be due to premature differentiation, rather than a decrease in proliferation or cell death (Handler et al., 2000; Yang et al., 2000; Kim and Shen, 2008).

PS1 knock out mice die in late embryogenesis, hampering the examination of the role of PS1 in regulation of adult neurogenesis. Information from transgenic mice harboring FAD-linked PS1 variants is controversial and inconclusive (Feng et al., 2001; Wang et al., 2004; Wen et al., 2004; Chevallier et al., 2005; Choi et al., 2008). In fact, this controversy is not surprising, as FAD-linked PS1 transgenic mice generated so far offer little advantage when it comes to processes that take place in restricted areas of the postnatal brain with a unique population of NPCs, as transgenes are expressed in a ubiquitously, nonspecific manner, in large neuronal populations in the forebrain, making the relevance of these studies to adult neurogenesis highly questionable. Equally troubling is neuropathology expressed in these mice, such as high levels of Aβ42, that may alter neurogenesis indirectly.

To establish a paradigm that examines PS1 function in the neurogenic niches of the adult brain exclusively we developed a lentiviral vector system that expresses small interfering RNAs (siRNA) for the targeting of PS1, and a green fluorescent protein (GFP) marker for the tracking of targeted cells. Here we show that knocking down PS1 expression in NPCs in the adult brain decreases their proliferation and enhances their differentiation. NPCs expressing reduced levels of PS1 differentiate faster into neurons and glia than NPCs expressing endogenous levels of PS1. PS1 function in NPCs dominates the critical proliferation signals epidermal growth factor (EGF) and basic fibroblast growth factor (bFGF). Finally, PS1 regulates NPC differentiation in a γ-secretase- dependent manner and may exert its effect through EGF receptor (EGFR) and β-catenin signaling pathways. This study suggests a physiological role for PS1 in regulation of NPC differentiation in the adult brain.

Materials and Methods

Development of lentiviral vectors expressing siRNA for the targeting of PS1

The development of a lentiviral vector system to knockdown PS1 expression was designed to expresses siRNA sequences for targeting PS1, and to co-express a green fluorescent protein (GFP) marker to track targeted cells. For this purpose, 3rd generation (self-inactivating) lentiviral vectors were designed to express small-hairpin RNAs (shRNA) from the 3’ remnant U3 sequence as previously described (Brummelkamp et al., 2002; Tiscornia et al., 2006b). Two siRNA sequences targeting murine PS1 were chosen. One is based on a previously published sequence (5’AAGGCCCACTTCGTATGCTGG 3’)(1.1) (Xie et al., 2004) and one by algorithm (S-fold, http://sfold.wadsworth.org) (5’GGACCAACTTGCATTCCAT3’; 4.11) (Figure 1A). As controls we generated vectors expressing irrelevant siRNAs: IR-8.1 (5’CTTCATTGTCGGCATGGGT 3’) and IR-9.1 (5’GTATAATACACCGCGCTAC3’). As an additional control, lentiviral vectors expressing GFP alone were used. For validation of shRNA constructs, N2a cells were transduced with the purified shRNA vector preparation followed by anti PS1 immunoblot. Purification of viral stocks was done as previously described (Tiscornia et al., 2006a). Briefly, HEK-293T cells were transfected with the lentiviral vectors and packaging plasmids and lentiviral vectors concentrated / purified by centrifugation of cell culture supernatants.

Figure 1
Reduced PS1 expression in adult neural progenitor cells following transduction with lentiviral vectors expressing siRNA for the targeting of PS1

Mouse Lines

Adult male C57/BL6 mice used in these studies were purchased from the Jackson Laboratories (Jax@ Mice). Mice were used at 6–8 months of age for stereotaxic injections. C57/BL6 mice 2–4 months old were used for all in vitro neurosphere culture.

Stereotaxic injection of lentiviral vectors expressing siRNA for PS1 targeting

Lentiviral vectors coexpressing either (1) GFP and siRNA for PS1 targeting (1.1 or 4.11) or (2) GFP and an irrelevant siRNA (IR 8.1 or 9.1) or (3) GFP alone, were stereotaxically injected (N=80) unilaterally into the SGL of C57/Bl6 mice (1µl/site; 0.25 µl/ minute) using the following coordinates: DG coordinates (AP=−3.0 mm, ML=+2.0 mm, DV=−2.5). Mice were anesthetized using a mixture of ketamine and xylazine. The mice then had their heads shaved and wiped with 70% EtOH. Animals were placed into the stereotaxic frame and a one-inch incision was made in the midline to reveal the Bregma. The scalp was then cleared of tissue and wiped with 30% hydrogen peroxide to dehydrate the scalp. A small hole was drilled at the coordinate site as measured from the bregma according the mouse atlas of Paxinos and Franklin. Animals then received unilateral injections of 1µl of lentivirus directly in the SGL. The virus was delivered using a 5µl Hamilton syringe connected to a hydraulic system to inject the solution at a rate of 0.20 µl/minute. The injection needle was then left in place for another minute to ensure distribution of the lentivirus. The needle was slowly removed and the wounds were closed with sterile EZ-clips from Stoelting and Co. The mice were placed in cages individually and survived for 6 weeks after surgery.

BrdU Injections

Animals were given intraperitoneal injections of 100mg/kg of 5’-bromo-2’deoxyuridine (BrdU, Sigma) every 12 hours for 3 days. Animals were perfused 12 hours after the last BrdU injection to study stem cell proliferation and differentiation. All animals were anesthetized with a mixture of ketamine and xylazine and transcardially perfused with 200 ml of cold 1X PBS followed by 100 ml of 4% paraformaldehyde (PFA). The brains were then dissected and placed into 4% PFA for 24 hrs at 4°C. They were then transferred into a solution of 30% sucrose and kept at 4°C.

Neurosphere Culture

SVZ derived neural stem cells were isolated as previously described (Demars et al., 2010). Briefly, SVZ of 2–4 month old C57/Bl6 mice were dissected and chopped. The tissue was incubated in a mixture of activated Papain (Sigma), EDTA (Sigma), and L-Cistene (Sigma), and 0.1% DNase for 40 minutes at 37°C. Tissue was then disassociated and centrifuged at 1000 × g for 5 minutes. Cells were then plated in complete medium (Water, DMEM-F-12 (Gibco), Glucose (Sigma), NaHCO3 (Sigma), HEPES (Sigma), L-Glutamine (Gibco), Penicillin/Streptomycin (Gibco), Putrescine (Sigma), Apo-Transferrin (Sigma), Insulin (Roche), Selenium (Sigma), Progesterone (Sigma), BSA (Sigma), Heparin (Sigma), EGF (20ng/ml, Peprotech), bFGF (10ng/ml, Peprotech)) and incubated in 37°C, 5% CO2 for 10 days. Cells were passaged two to three times to clear debris before using in experiments.

L-685, 458, DAPT γ-secretase inhibitors

Neurosphere cultures were treated with the γ-secretase inhibitor N-[N-(3,5-difluorophenacetyl)-L-alanyl]-(S)-phenylglycine tert-butyl ester (DAPT, 0.5 µM, Calbiochem) or with the transition state analogue inhibitor L-685, 458 (10 µM, Sigma) for 48 hours.

Antibodies

The following primary antibodies were used in this study: Rat anti-BrdU polyclonal (1:500), green fluorescent protein (GFP) marker mouse anti GFP monoclonal (1:200 Santa Cruz, California), chicken anti-TUJ-1 polyclonal (1:100 Chemicon), mouse anti-TUJ-1 monoclonal (1:5000 Promega, Madison, WI) early neuronal marker goat anti doublecourtin polyclonal (DCX, 1:400 Santa Cruz, California), rabbit anti-PS1NTF polyclonal (1:5000, a generous gift from Dr. Gopal Thinakaran), glial marker rabbit anti-glial fibrillary acidic protein polyclonal (GFAP, 1:400 Dako, Glostrap, Denmark), glial marker mouse anti-glial fibrillary acidic protein monoclonal (GFAP, 1:500 Millipore), mouse anti-NeuN monoclonal (1:400 Chemicon), mouse anti-actin monoclonal (1:5000 Chemicon), neural stem cell marker mouse anti-nestin monoclonal (1:200 Chemicon). The following secondary antibodies were used from Jackson ImmunoResearch Laboratories: Cy 3-conjugated Donkey anti-Rat (1:500), Biotin-conjugated Donkey anti-Mouse (1:250), Cy 2-conjugated Streptavidin (1:250), Cy 5-conjugated Donkey anti-Chicken (1:250), Cy 5-conjugated Donkey anti-Mouse (1:250), Cy 3-conjugated Donkey anti-Mouse (1:500), Cy 5-conjugated Donkey anti-Goat (1:250), Cy 3-conjugated Donkey anti-Rabbit (1:500), Cy 5-conjugated Donkey anti-Rabbit (1:250). Alexa 488 Goat anti-Mouse IgM (1:400 Molecular Probes). Peroxidase conjugated Rabbit anti-Mouse (1:5000 Pierce Biotechnology). Protein A-Peroxidase (1:1000 Sigma). DAPI Nucleic Acid Stain (1:50000 Molecular Probes).

BrdU Proliferation Assay

Neural progenitor cells were plated at a density of 1.5 × 104 cells/well into a round-bottom 96-well plate in complete medium. Cells are incubated for 24 hours at 37°C, 5% CO2. 5µM of a BrdU solution was added to each well and incubate at 37°C, 5% CO2 for 48 hours. Plates were spun down at 1000 × g for 10 minutes to pellet the cells. The cells were fixed with 70% EtOH and 0.1N NaOH for 30 minutes at room temperature. Cells were incubated in mAb BrdU (1:300, Novocastra) primary antibody for 1 hour. After washing, cells were incubated in secondary antibody rabbit anti-mouse HRP (1:5000, Pierce) for 30 minutes. The cells were then washed and incubated with tetramethylbenzidine (TMB) substrate solution (Invitrogen) for 15 minutes in the dark. To stop the reaction, a solution of 2.5N sulfuric acid was added to the cells with TMB. The plates were read using a spectrophotometric microtiter plate reader set at a dual wavelength of 450–595. Each experimental group includes 4 replicates (N=10).

Clonogenic Assay

Lentiviral infected or γ-secretase inhibitor treated neurospheres were singly disassociated and plated at a density of 2,500 cells/ ml onto a 2 cm grid plate. Neurospheres were counted after 7 days using an upright microscope. N=5 for each experimental group.

Neurosphere differentiation assay

For differentiation assays, neurospheres or single cells were plated onto glass coverslips coated with matrigel (BD Biosciences) in complete media without EGF and bFGF and with the addition of 5% fetal bovine serum. Cells were allowed to differentiate for various time points at 37°C, 5% CO2. The cells were then fixed with 4% PFA for 30 minutes and immunostained. N=5 for each experimental group.

Immunohistochemistry

Brains were sectioned sagitally at 50 µm using a microtome (Leica) and placed into cryoprotectant (Glycerol, Ethylene Glycol, PBS). Every 6th section was used for immunohistochemistry. To expose the BrdU antigen, sections were pretreated with deionized formamide and SSC for 2 hours at 65° in a shaking waterbath. Sections were then rinsed with SSC and incubated in a 2N HCL solution for 30 minutes at 37°C. Sections were then neutralized with 0.1M Borate buffer for 10 minutes. Sections were blocked for 1–3 hours in TBS, Normal Donkey Serum, and Triton X-100 (TBS++) before being incubated in primary antibodies in TBS and Triton X-100 (TBS+) for 72 hours at 4°C. Sections were blocked again in TBS ++ before being incubated in secondary antibodes for 2 hours at room temperature. Sections were then mounted onto glass coverslips using PVA-DABCO. Immunohistochemistry was followed by stereological analysis of sections.

Cell culture immunostaining

Differentiated cells were fixed using 4% PFA for 30 minutes at room temperature. Cells were washed 3X in TBS and blocked in TBS++ for 1 hour. Cells were then incubated in primary antibodies for 2 hours in TBS+. Following a second block in TBS++ for 30 minutes, cells were incubated in secondary antibodies in TBS+ for 1 hour at room temperature. Cells were incubated in a DAPI solution for 5 minutes. Cells were then washed and mounted using PVA-DABCO.

Stereological analysis

Quantification of immunostained sections were done using Stereo Investigator Microbrightfield Bioscience. Immunostained sections were counted using the following parameters: the counting frame was set to 115 µM × 115 µM, and sampling grid was set at 122 µM × 122 µM. The section thickness was averaged at 35 µM. The entire dentate gyrus was counted due to the scarcity of BrdU+ cells.

Western blot Analysis

Protein extraction of tissue was prepared using a 1X TNE buffer (50mM Tris, 150 mM NaCl, 5 mM EDTA, 0.5% SDS, 100mM PMSF, and Protease inhibitor cocktail (Sigma)). Protein extraction of in vitro cells was prepared using a 1X IP buffer (150mM NaCl, 50 mM Tris-Cl, 0.5% Triton X-100, 0.5% Sodium deoxycholate, 5 mM EDTA, 0.25% SDS, 100 mM PMSF and Protease inhibitor cocktail), or 50 mM HEPES and 1% SDS lysis buffer. Protein was extracted by homogenization of tissue in the appropriate lysis buffer. Protein concentration was determined using the BCA (bicinchoninic acid) method (Pierce). Equal amounts of protein were taken for immunoblotting.

Real time RT-PCR

Total RNA was extracted using TRI Reagent (Sigma). 2 µg of total RNA was treated with DNAse for 1h (RNAse free, Ambion) and then reverse transcribed into cDNA using a mix of oligodT and random primers (High-Capacity cDNA Reverse Transcription Kit, Applied Biosystems). Primer sets were CycloA-5' GGC CGA TGA CGA GCC C, CycloA-3' TGT CTT TGG AAC TTT GTC TGC AA at, Egfr 5' ATCCTCTGCAGGCTCAGAAA, Egfr 3' GGCGTTGGAGGAAAAGAAAG, Bmi1–5' AGCAGCAATGACTGTGATGCACTTGAG, Bmi1–3' GCTCTCCAGCATTCGTCAGTCCATCCC, Catnb-5' CAGCTTGAGTAGCCATTGTCC, Catnb-3' GAGCCGTCAGTGCAGGAG, Tlx1–5' TCACGTTCCTCTGCTGTCTG, Tlx1–3' CAAGGCGCTCAAAATGACC. DCX-5' TTCAGGACCACAAGCAATGA, DCX-3' GGAAACCGGAGTTGTCAAAA, Beta-III Tubulin-5' ATGCTTGGGACTACGTTTGG, Beta-III Tubulin-3' TGAGGCCTCCTCTCACAAGT, GFAP-5' CACGAAGCTAACGACTATCGC, GFAP-3' CTCTAGGGACTCGTTCGTGC, PDGF-5' CTGCACCAAGTCAGGTCCC, PDGF-3' CTTCTCTGGGTGTTGGCTCA, Nestin-5' GGTCACTGT CGCCGCTACTC, Nestin-3' CGGACGTGGAGCACTAGAGAA. qRT-PCR was performed with SYBRGreen PCR master mix (Applied Biosystems) using an ABI Prism 7700 sequence detection system. The results were analyzed using the comparative delta-delta-Ct method (normalized to the amplification cycle counts of the cyclophilin "house-keeping" gene). Unpaired t-test and ANOVA used for statistical analysis.

Results

Targeting PS1 in NPCs and in neurogenic niches exclusively

To examine the role of PS1 in regulation of NPCs and their progeny in the adult brain we developed lentiviral vectors expressing siRNA for the targeting of PS1 (Figure 1A). Viral vectors co-express GFP for the identification of infected cells and their progeny. To avoid off-target effects of the siRNA, we developed 2 shRNA for the targeting of PS1 (designated 1.1 and 4.11 PS1 siRNA) and 2 control shRNA expressing irrelevant sequences (IR 8.1, 9.1 siRNA). As an additional control we infected neurospheres in vitro and in vivo with lentiviral vectors expressing GFP only (GFP-Lenti, Figure 1A). To validate that infection of cells with lentiviral vectors expressing siRNA for the targeting of PS1 results in a reduction of PS1 expression, we first infected murine neuroblastoma N2a cells with the five lentiviral vector preparations. As expected, infection of N2a cells with both lentiviral vectors expressing siRNA for the targeting of PS1 induced a reduction in PS1 expression (Figure 1B,C). Likewise, infection of neurosphere culture revealed a reduction in PS1 expression in cultures infected with lentiviral vectors expressing PS1 1.1 and PS1 4.11 siRNA, but not in cultures infected with lentiviral vectors expressing IR 8.1, IR 9.1 siRNA compared to non-infected neurospheres (Figure 1D,E). To confirm a reduction in PS1 expression in neurospheres cultures infected with lentiviral vectors expressing PS1 1.1 and PS1 4.11 siRNA, neurospheres were immunostained with anti-PS1 antibodies five days after lentiviral infection. PS1 immunoreactivity was significantly reduced in GFP+ neurospheres infected with lentiviral vectors expressing PS1 1.1 and PS1 4.11 siRNA, compared to GFP+ neurospheres expressing IR 8.1, IR 9.1 siRNA (Figure 1F). We then injected lentiviral vectors into the SGL and the SVZ of adult mice stereotaxically (Figure 2). Examination of PS1 expression in protein extracts of SGL (N=16; Figure 2A,B) and SVZ (data not shown) of mice infected with lentiviral vectors expressing PS1 1.1 and PS1 4.11 siRNA revealed a decrease in PS1 expression compared to SGL and SVZ of mice infected with lentiviral vectors expressing IR 8.1, IR 9.1 siRNA or GFP-Lenti (Figure 2A,B). To verify specificity of infection in the neurogenic microenvironments, brain sections of mice infected with lentiviral vectors were subject to immunohistochemical analysis (Figure 2C). Six weeks following stereotaxic injection of lentiviral vectors, GFP+ cells were confined to the SGL with some GFP+ cells in the granule layer of the dentate gyrus. No GFP+ cells could be detected in any other area of the hippocampus or in any other brain area (Figure 2Ca–d, Supplemental Figure 1). Likewise, injection of lentiviral vectors into the SVZ resulted in massive GFP+ expression of progenitor cells (Figure 2Ce). These results suggest that lentiviral vectors expressing siRNA for PS1 targeting, successfully downregulate PS1 expression in the neurogenic microenvironments and in neurosphere cultures derived from these niches.

Figure 2
Downregulation of PS1 expression in NPCs in the SGL of adult mice enhances their differentiation into neurons and glia

Targeting PS1 in the SGL of the dentate gyrus reduces the number of rapidly- proliferating NPCs and increases the number of differentiating cells

To examine the effect of reduced PS1 expression on neurogenesis, lentiviral vectors expressing PS1 1.1, PS1 4.11, IR 8.1, IR 9.1 siRNA or GFP-Lenti were injected into the SGL. Six weeks later mice were injected with BrdU and sacrificed three days following injection (Figure 2D). Unbiased stereology of brain sections revealed that the total number of BrdU+ cells was comparable in mice injected with lentiviral vectors expressing IR siRNA or GFP-Lenti and in mice injected with vectors expressing siRNA for PS1 targeting (Figure 2E), suggesting that infection with lentiviral vectors did not have a secondary effect on proliferation of cells in the SGL. However, there was a significant reduction in the number of GFP+BrdU+ cells in the SGL of mice injected with lentiviral vectors expressing PS1 1.1, PS1 4.11 (Figure 2F), suggesting that downregulation of PS1 expression decreased NPC proliferation in the SGL of these mice. To examine whether reduction in rate of proliferation in cells expressing siRNA for PS1 targeting is accompanied by alterations in extent of differentiation, brain sections were co-immunolabeled with neuronal and glial lineage markers (Figure 2Cf). The number of infected neurons (GFP+ β-tubulin+) and astrocytes (GFP+ GFAP+) was quantified by stereological analysis. The results show a significant increase in the number of neurons (GFP+ β-tubulin+) in the SGL of mice injected with lentiviral vectors expressing siRNA for PS1 targeting (Figure 2G). In addition we observed an increase in the number of neuroblasts (GFP+BrdU+β-tubulin+) in the SGL of mice injected with lentiviral vectors expressing siRNA for PS1 targeting (Figure 2H), suggesting that reduced expression of PS1 enhances neuronal differentiation in the SGL. Examination of the number of infected astrocytes revealed a slight but insignificant increase in the number of astrocytes (GFP+GFAP+, Figure 2I), but a dramatic increase in the number of newly formed astrocytes (GFP+BrdU+GFAP+; Figure 2J) in the SGL of mice injected with lentiviral vectors expressing siRNA for PS1 targeting. Taken together, these results suggest that downregulation of PS1 in NPCs in the SGL of adult mice enhances neuronal differentiation and increases the number of astrocytes, and this increase is accompanied by a decrease in the number of rapidly- proliferating NPCs.

Downregulation of PS1 expression enhances NPC differentiation into neurons and glia

To determine whether downregulation of PS1 expression in NPCs enhances their differentiation, neurosphere cultures were infected with lentiviral vectors expressing PS1 1.1 or PS1 4.11 siRNA, or with lentiviral vectors expressing IR 8.1, IR 9.1 siRNA, or with GFP-Lenti (Figure 3A). To induce cell differentiation, infected neurospheres were then cultured on matrigel for 24 hours. Neurospheres infected with lentiviral vectors expressing IR 8.1, IR 9.1 siRNA, or with GFP-Lenti exhibited round sphere-like morphology (Figure 3B). In contrast, neurospheres infected with lentiviral vectors expressing PS1 1.1 or PS1 4.11 siRNA lost the sphere morphology; cells migrated out and differentiated into process-bearing cells (Figure 3B). NPCs infected with lentiviral vectors expressing PS1 1.1 or PS1 4.11 siRNA differentiated faster than NPCs infected with lentiviral vectors expressing IR 8.1, IR 9.1 siRNA, or with GFP-Lenti even when cultured as single-cells (Figure 3C). To quantify extent of cell differentiation following PS1 downregulation, neurospheres infected with lentiviral vectors expressing PS1 1.1, PS1 4.11, IR 8.1, IR 9.1 siRNA, or GFP-Lenti were singly dissociated and an equal number of single cells were cultured for each infected group. Seven days later, the number of neurospheres in cultures infected with PS1 siRNA was significantly lower compared to the number of neurospheres in cultures infected with IR siRNA (Figure 3D). In contrast, the number of differentiated cells was significantly higher in cultures infected with PS1 siRNA compared to cultures infected with IR siRNA (Figure 3D). It should be noted that neurospheres differentiated in cultures infected with PS1 siRNA in spite of the presence of the potent proliferation factors basic fibroblast growth factor (bFGF) and epidermal growth factor (EGF), suggesting that PS1 dominates the proliferative effect of these growth factors. To examine whether reduced PS1 levels in NPCs affect multipotentiality, differentiating NPCs infected with lentiviral vectors expressing PS1 or IR siRNA were immunostained for cell-lineage markers. GFP+ NPCs could differentiate into neurons, astrocytes and oligodendrocytes independently of PS1 expressing levels (Figure 3E). Quantification of the number of differentiated neurons, astrocytes and oligodendrocytes revealed an increase in all three lineages in cultures infected with lentiviral vectors expressing PS1 siRNA (Figure 3F), suggesting that reduced levels of PS1 do not alter multipotentiality.

Figure 3
Downregulation of PS1 in neurosphere cultures enhances their differentiation without affecting multipotentiality

Regulation of NPC differentiation by PS1 is γ-secretase-dependent

To determine whether enhancement of NPC differentiation following PS1 downregulation is γ-secretase-dependent, neurospheres were treated with the γ-secretase inhibitor DAPT or with the transition state analogue inhibitor L-685,458 or with vehicle, and cultured on matrigel. Twenty-four hours later, neurospheres treated with vehicle exhibited sphere morphology with some initial processes indicating cell differentiation (Figure 4A). In contrast, and similar to neurospheres infected with PS1 siRNA, neurospheres treated with either DAPT or L-685,458 lost sphere morphology. Cells migrated out of the neurosphere, and differentiated (Figure 4A). Similarly, singly-dissociated NPCs treated with either DAPT or L-685,458 differentiated faster than NPCs treated with vehicle (Figure 4B). Quantification of the length of cell processes revealed a dramatic increase in process length in L-685,458-treated NPCs (Figure 4C). To examine whether inhibition of γ-secretase affects multipotentiality, NPCs were immunostained using lineage-specific markers (Figure 4E) and the number of lineage-specific cells was counted (Figure 4D). NPCs treated with either DAPT or L-685,458 differentiated into all three lineages, suggesting that multipotentiality is not affected by γ-secretase activity (Figure 4D,E). We further observed a slight increase in levels of all three lineages neurons, astrocytes and oligodendrocytes in NPCs treated with DAPT or L-685,458 compared to NPCs treated with vehicle (Figure 4D). Taken together, these results suggest that lack of γ-secretase activity in NPCs induces a similar phenotype to that of downregulated PS1, implying that PS1 regulates NPCs differentiation in a γ-secretase-dependent manner.

Figure 4
PS1 effect on neural progenitor cells is γ-secretase-dependent

Downregulation of PS1 expression decreases extent of NPC proliferation and clone-formation capacity

To examine whether enhanced NPC differentiation following PS1 downregulation was accompanied by reduced rate of proliferation, extent of BrdU intake was examined in neurospheres infected with lentiviral vectors expressing PS1 1.1 or PS1 4.11 siRNA or IR 8.1, IR 9.1 siRNA, or GFP-Lenti, using a proliferation assay. We observed that the number of cells incorporating BrdU was significantly lower in NPCs infected with siRNA for PS1 targeting than in NPCs infected with an IR siRNA (Figure 5A). To examine whether reduction in NPC proliferation is the result of an effect of PS1 on NPC clone-formation capacity we quantified the number of NPCs giving rise to neurospheres following infection with lentiviral vectors. Hence, neurosphere cultures were infected with lentiviral vectors expressing PS1 1.1 or PS1 4.11 siRNA or IR 8.1, IR 9.1 siRNA, or GFP-Lenti. Infected cells were singly-dissociated. The number of primary neurospheres formed was lower in NPCs infected with lentiviral vectors expressing PS1 siRNA compared to the number formed in NPCs infected with IR siRNA (Figure 5B). To examine whether reduced proliferation is γ-secretase-dependent we repeated the BrdU uptake experiment using neurospheres treated with γ-secretase inhibitor. A significant reduction in BrdU uptake was observed in cells treated with the γ-secretase inhibitor L-685,458 (Figure 5C, Supplemental Figure 2B) or DAPT Figure 5D, Supplemental Figure 2A).

Figure 5
Reduced PS1 expression impairs proliferation and affects clone formation capacity

PS1 regulates NPC differentiation through β-catenin and EGFR signaling pathways

To gain further insight into the mechanism by which PS1 exerts its effect on NPC proliferation, we examined expression level of neurogenic signals that are functionally associated with PS1, namely, notch-1, notch-1 ligands Del-1 and Jagged-1, β-catenin and EGFR as well as levels of the proliferation signal Tlx, the PS1 homolog PS2, and differentiation markers: PDGF, GFAP, β-III tubulin and DCX (Figure 6). Thus, neurosphere cultures were transduced with lentiviral vector expressing siRNA for PS1 targeting or IR siRNA and gene expression was analyzed by quantitative real-time RT-PCR. We observed a significant decrease in expression levels of β-catenin and EGFR, suggesting that these neurogenic signaling are downstream players in PS1 regulation of NPC differentiation. Expression of Tlx, Notch-1 and Jag-1 was slightly increased, while Del-1 was significantly increased. In addition, PS2 level was significantly increased. PDGF expression levels were significantly higher in cultures with reduced PS1 expression, while β-III tubulin, DCX and GFAP were slightly increased but were not significantly different, suggesting that the effect of PS1 on the latter three proteins is not regulated on the transcription level.

Figure 6
Gene expression in neurospheres after PS-1 knockdown

Discussion

Here we show that PS1 regulates NPC differentiation in the adult brain. Downregulation of PS1 expression reduces proliferation of NPCs, and enhances their differentiation without interfering with their multipotentiality. Our study suggests that PS1 may exert its effect through EGFR and β-catenin signaling, and that PS1 dominates major proliferation pathways in NPCs, namely, EGF and bFGF signaling. PS1 effect on NPC differentiation is γ-secretase dependent.

Lack of PS1 during embryonic development was suggested to impair neurogenesis through enhanced neuronal differentiation, without an effect on cell proliferation or apoptosis (Handler et al., 2000; Yang et al., 2000). Recent studies show that in PS1/PS2 conditional double knockout mice, in which expression of both PSs are inactivated in NPC beginning at embryonic day 11 suggests that NPCs exit cell cycle and prematurely differentiate into neurons between E13.5 and E14.5 (Kim and Shen, 2008). Other studies examining the role of PS1 in stem cell maintenance during development suggest that PS1 plays a role in the development and/or maintenance of the anterior and intermediate lobes of the pituitary gland (Nakajima et al., 2009). The present study determined that PS1 regulates neurogenesis postnatally as well. We show that down regulation of PS1 expression contracted the population of proliferating NPC in the SVZ and SGL, while enhancing the number of mature neurons and glia. This suggests that PS1 regulates a fundamental checkpoint that determines whether a cell would keep proliferating or differentiate.

Enhanced NPC differentiation observed following PS1 knockdown was similar to the effect exerted by treatment of NPCs with γ-secretase inhibitors. While the IC50 of L-685,458 and DAPT is about 3–17nM and 100–170nM, respectively (Shearman et al., 2000; Weihofen and Martoglio, 2003; Morohashi et al., 2006), both inhibitors enhanced NPC differentiation in the range of 0.5–20 µM. IC50 of these inhibitors was determined using in vitro cell-free assays with purified or enriched γ-secretase membrane prep and substrate. In addition, the readout of these experiments is the inhibition of Aβ production and the accumulation of APP-CTFs. In contrast, our experiments are based on whole cell (primary culture) assays. APP is expressed at endogenous levels. The readout is a cellular phenotype that may involve the concerted action of several signaling pathways regulated by γ-secretase in addition to APP metabolites. In addition, the time course of our experiments is days (rather than hours). In support of that, previous studies examining the effect of these inhibitors on stem cell biology used doses similar to ours (Mori et al., 2006; Borghese et al., 2010).

We further show that downregulation of PS1 in neurosphere culture reduces the expression of two critical neurogenic signaling molecules, β-catenin and EGFR. PS1 is implicated in regulation of epidermal growth factor receptor EGFR and the Wnt/β-catenin signaling, critical regulators of NSC self-renewal and proliferation [For review (Shi et al., 2008)]. Substantial evidence exists for an interaction between PS1 and β-catenin and for the formation of a β-catenin/PS1 complex (Tesco et al., 1998; Tesco and Tanzi, 2000). β-catenin is a critical downstream component of the canonical Wnt pathway, a central regulator of mammalian neural development and a regulator of NPCs in the SVZ, promoting proliferation of Mash1+ cells in the SVZ. Modulation of β-catenin signaling specifically in dividing cells in the adult mouse SVZ suggests β-catenin signaling is sufficient to increase the percentage of dividing Mash1 cells (Adachi et al., 2007). Wnt signaling plays a role in adult hippocampal neurogenesis as well, regulating proliferation of progenitor cells and neuronal differentiation (Lie et al., 2005). In the nucleus, stabilized β-Catenin functions through TCF/LEF1 transcription factors and the notch-1/RBP-J complex, promoting proliferation of NPCs and suppressing their differentiation, respectively (Shimizu et al., 2008), possibly by activating the expression of target genes that are involved in the G1-S transition, such as cyclin D1 and c-Myc. In addition, β-Catenin and NICD form a complex with the promoter region of the antineurogenic hes1 gene, allowing its expression. Reduced expression of β-Catenin following downregulation of PS1 in NPCs may suggest that less β-Catenin reaches the nucleus, leading to attenuation of proliferation-inducing genes. In addition, our results show that expression level of the notch-1 ligand Del-1 is upregulated following PS1 knockdown. Notch1 is thought to be involved in the regulation of radial glia differentiation into committed NPCs during postnatal neurogenesis in the SGL, as well as during newborn neuron maturation (Breunig et al., 2007). Interestingly we observed an increase in PS2 and notch ligand expression, suggesting unsuccessful compensatory mechanisms to resume normal levels of PS and notch signaling, respectively. Shimizu and colleagues (2008) have shown that GSK3β inactivation and β-catenin stabilization in NPCs potentiated the promoter activity of hes1 and hes5 genes only when Notch signaling was activated. Further, stabilized β-catenin associates with N1IC and enhances its RBP-J-dependent transcription activity to induce hes1 and hes5 gene expression. Interestingly, in hyh mutant mice reduced β-catenin correlates with early neurogenic differentiation (Chae et al., 2004). Conditional knockout of β-catenin in the cortex and hippocampus resulted in reduced cell proliferation as a consequence of deficits in the neuroepithelium during development (Machon et al., 2003).

In summary, we show that PS1 plays a major role in adult neurogenesis, regulating NPC differentiation in a γ-secretase-dependent manner. This study reveals a new molecular target for the manipulation of NPCs in the adult brain.

Supplementary Material

Supp1

Acknowledgements

This study was supported by the NIH AG033570 and Alzheimer's Association Young Investigator Award (OL).

References

  • Adachi K, Mirzadeh Z, Sakaguchi M, Yamashita T, Nikolcheva T, Gotoh Y, Peltz G, Gong L, Kawase T, Alvarez-Buylla A, Okano H, Sawamoto K. Beta-catenin signaling promotes proliferation of progenitor cells in the adult mouse subventricular zone. Stem Cells. 2007;25:2827–2836. [PubMed]
  • Aimone JB, Deng W, Gage FH. Adult neurogenesis: integrating theories and separating functions. Trends Cogn Sci. 2010;14:325–337. [PMC free article] [PubMed]
  • Borghese L, Dolezalova D, Opitz T, Haupt S, Leinhaas A, Steinfarz B, Koch P, Edenhofer F, Hampl A, Brustle O. Inhibition of notch signaling in human embryonic stem cell-derived neural stem cells delays G1/S phase transition and accelerates neuronal differentiation in vitro and in vivo. Stem Cells. 2010;28:955–964. [PubMed]
  • Breunig JJ, Silbereis J, Vaccarino FM, Sestan N, Rakic P. Notch regulates cell fate and dendrite morphology of newborn neurons in the postnatal dentate gyrus. Proc Natl Acad Sci U S A. 2007;104:20558–20563. [PubMed]
  • Brummelkamp TR, Bernards R, Agami R. A system for stable expression of short interfering RNAs in mammalian cells. Science. 2002;296:550–553. [PubMed]
  • Chae TH, Kim S, Marz KE, Hanson PI, Walsh CA. The hyh mutation uncovers roles for alpha Snap in apical protein localization and control of neural cell fate. Nat Genet. 2004;36:264–270. [PubMed]
  • Chevallier NL, Soriano S, Kang DE, Masliah E, Hu G, Koo EH. Perturbed neurogenesis in the adult hippocampus associated with presenilin-1 A246E mutation. Am J Pathol. 2005;167:151–159. [PubMed]
  • Choi SH, Veeraraghavalu K, Lazarov O, Marler S, Ransohoff RM, Ramirez JM, Sisodia SS. Non-cell-autonomous effects of presenilin 1 variants on enrichment-mediated hippocampal progenitor cell proliferation and differentiation. Neuron. 2008;59:568–580. [PMC free article] [PubMed]
  • De Strooper B, Saftig P, Craessaerts K, Vanderstichele H, Guhde G, Annaert W, Von Figura K, Van Leuven F. Deficiency of presenilin-1 inhibits the normal cleavage of amyloid precursor protein. Nature. 1998;391:387–390. [PubMed]
  • De Strooper B, Annaert W, Cupers P, Saftig P, Craessaerts K, Mumm JS, Schroeter EH, Schrijvers V, Wolfe MS, Ray WJ, Goate A, Kopan R. A presenilin-1-dependent gamma-secretase-like protease mediates release of Notch intracellular domain [see comments] Nature. 1999;398:518–522. [PubMed]
  • Demars M, Hu YS, Gadadhar A, Lazarov O. Impaired neurogenesis is an early event in the etiology of familial Alzheimer's disease in transgenic mice. J Neurosci Res. 2010;88:2103–2117. [PMC free article] [PubMed]
  • Feng R, Rampon C, Tang YP, Shrom D, Jin J, Kyin M, Sopher B, Miller MW, Ware CB, Martin GM, Kim SH, Langdon RB, Sisodia SS, Tsien JZ. Deficient neurogenesis in forebrain-specific presenilin-1 knockout mice is associated with reduced clearance of hippocampal memory traces. Neuron. 2001;32:911–926. [PubMed]
  • Handler M, Yang X, Shen J. Presenilin-1 regulates neuronal differentiation during neurogenesis. Development. 2000;127:2593–2606. [PubMed]
  • Herreman A, Serneels L, Annaert W, Collen D, Schoonjans L, De Strooper B. Total inactivation of gamma-secretase activity in presenilin-deficient embryonic stem cells. Nat Cell Biol. 2000;2:461–462. [PubMed]
  • Kim WY, Shen J. Presenilins are required for maintenance of neural stem cells in the developing brain. Mol Neurodegener. 2008;3:2. [PMC free article] [PubMed]
  • Kriegstein A, Alvarez-Buylla A. The glial nature of embryonic and adult neural stem cells. Annu Rev Neurosci. 2009;32:149–184. [PMC free article] [PubMed]
  • Lazarov O, Marr RA. Neurogenesis and Alzheimer’s disease: At the crossroads Exp Neurol. 2010;223:267–281. [PMC free article] [PubMed]
  • Li YM, Xu M, Lai MT, Huang Q, Castro JL, DiMuzio-Mower J, Harrison T, Lellis C, Nadin A, Neduvelil JG, Register RB, Sardana MK, Shearman MS, Smith AL, Shi XP, Yin KC, Shafer JA, Gardell SJ. Photoactivated gamma-secretase inhibitors directed to the active site covalently label presenilin 1. Nature. 2000;405:689–694. [PubMed]
  • Lie DC, Colamarino SA, Song HJ, Desire L, Mira H, Consiglio A, Lein ES, Jessberger S, Lansford H, Dearie AR, Gage FH. Wnt signalling regulates adult hippocampal neurogenesis. Nature. 2005;437:1370–1375. [PubMed]
  • Machon O, van den Bout CJ, Backman M, Kemler R, Krauss S. Role of beta-catenin in the developing cortical and hippocampal neuroepithelium. Neuroscience. 2003;122:129–143. [PubMed]
  • Mori H, Ninomiya K, Kino-oka M, Shofuda T, Islam MO, Yamasaki M, Okano H, Taya M, Kanemura Y. Effect of neurosphere size on the growth rate of human neural stem/progenitor cells. J Neurosci Res. 2006;84:1682–1691. [PubMed]
  • Morohashi Y, Kan T, Tominari Y, Fuwa H, Okamura Y, Watanabe N, Sato C, Natsugari H, Fukuyama T, Iwatsubo T, Tomita T. C-terminal fragment of presenilin is the molecular target of a dipeptidic gamma-secretase-specific inhibitor DAPT (N-[N-(3,5-difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butyl ester) J Biol Chem. 2006;281:14670–14676. [PubMed]
  • Nakajima M, Watanabe S, Okuyama S, Shen J, Furukawa Y. Restricted growth and insulin-like growth factor-1 deficiency in mice lacking presenilin-1 in the neural crest cell lineage. Int J Dev Neurosci. 2009;27:837–843. [PMC free article] [PubMed]
  • Selkoe DJ. Alzheimer’s disease: genes, proteins, and therapy. Physiol Rev. 2001;81:741–766. [PubMed]
  • Shearman MS, Beher D, Clarke EE, Lewis HD, Harrison T, Hunt P, Nadin A, Smith AL, Stevenson G, Castro JL. L-685,458, an aspartyl protease transition state mimic, is a potent inhibitor of amyloid beta-protein precursor gamma-secretase activity. Biochemistry. 2000;39:8698–8704. [PubMed]
  • Shen J, Bronson RT, Chen DF, Xia W, Selkoe DJ, Tonegawa S. Skeletal and CNS defects in Presenilin-1-deficient mice. Cell. 1997;89:629–639. [PubMed]
  • Shi Y, Sun G, Zhao C, Stewart R. Neural stem cell self-renewal. Crit Rev Oncol Hematol. 2008;65:43–53. [PMC free article] [PubMed]
  • Shimizu T, Kagawa T, Inoue T, Nonaka A, Takada S, Aburatani H, Taga T. Stabilized beta-catenin functions through TCF/LEF proteins and the Notch/RBP-Jkappa complex to promote proliferation and suppress differentiation of neural precursor cells. Mol Cell Biol. 2008;28:7427–7441. [PMC free article] [PubMed]
  • Suh H, Deng W, Gage FH. Signaling in adult neurogenesis. Annu Rev Cell Dev Biol. 2009;25:253–275. [PubMed]
  • Tesco G, Tanzi RE. GSK3 beta forms a tetrameric complex with endogenous PS1-CTF/NTF and beta-catenin. Effects of the D257/D385A and FAD-linked mutations. Ann N Y Acad Sci. 2000;920:227–232. [PubMed]
  • Tesco G, Kim TW, Diehlmann A, Beyreuther K, Tanzi RE. Abrogation of the presenilin 1/beta-catenin interaction and preservation of the heterodimeric presenilin 1 complex following caspase activation. J Biol Chem. 1998;273:33909–33914. [PubMed]
  • Tiscornia G, Singer O, Verma IM. Production and purification of lentiviral vectors. Nat Protoc. 2006a;1:241–245. [PubMed]
  • Tiscornia G, Singer O, Verma IM. Design and cloning of lentiviral vectors expressing small interfering RNAs. Nat Protoc. 2006b;1:234–240. [PubMed]
  • Wang R, Dineley KT, Sweatt JD, Zheng H. Presenilin 1 familial Alzheimer’s disease mutation leads to defective associative learning and impaired adult neurogenesis. Neuroscience. 2004;126:305–312. [PubMed]
  • Weihofen A, Martoglio B. Intramembrane-cleaving proteases: controlled liberation of proteins and bioactive peptides. Trends Cell Biol. 2003;13:71–78. [PubMed]
  • Wen PH, Hof PR, Chen X, Gluck K, Austin G, Younkin SG, Younkin LH, DeGasperi R, Gama Sosa MA, Robakis NK, Haroutunian V, Elder GA. The presenilin-1 familial Alzheimer disease mutant P117L impairs neurogenesis in the hippocampus of adult mice. Exp Neurol. 2004;188:224–237. [PubMed]
  • Wines-Samuelson M, Shen J. Presenilins in the developing, adult, and aging cerebral cortex. Neuroscientist. 2005;11:441–451. [PubMed]
  • Wolfe MS, Xia W, Ostaszewski BL, Diehl TS, Kimberly WT, Selkoe DJ. Two transmembrane aspartates in presenilin-1 required for presenilin endoproteolysis and gamma-secretase activity. Nature. 1999;398:513–517. [PubMed]
  • Xie Z, Romano DM, Kovacs DM, Tanzi RE. Effects of RNA interference-mediated silencing of gamma-secretase complex components on cell sensitivity to caspase-3 activation. J Biol Chem. 2004;279:34130–34137. [PubMed]
  • Yang X, Handler M, Shen J. Role of presenilin-1 in murine neural development. Ann N Y Acad Sci. 2000;920:165–170. [PubMed]
  • Zhang Z, Nadeau P, Song W, Donoviel D, Yuan M, Bernstein A, Yankner BA. Presenilins are required for gamma-secretase cleavage of beta-APP and transmembrane cleavage of Notch-1. Nat Cell Biol. 2000;2:463–465. [PubMed]