2.1 Subjects
Adult male and female Kiss1-Cre, LepR-IRES-Cre/LacZ, MC4R-GFP and C57BL/6 mice were housed in the University of Texas Southwestern Medical Center Animal Resource Center, in a light- (12h on/12h off) and temperature- (21–23°C) controlled environment. They were fed standard chow diet (Harlan Teklad Global Diet), unless otherwise mentioned and had free access to water. All experiments were carried out in accordance with the guidelines established by the National Institute of Health Guide for the Care and Use of Laboratory Animals, as well as with those established by the University of Texas Institutional Animal Care and Use Committee.
2.2 Generation of Kiss1-Cre BAC transgenic mice
We generated several lines of transgenic mice that express Cre recombinase eutopically within kisspeptin-expressing cells, and which we called J2-3, J2-4 and J2-6. These animals were made through the use of various ET-cloning “recombineering” technologies (
Lee et al., 2001,
Muyrers et al., 2001). We constructed two different Kiss1-Cre transgene-containing bacterial artificial chromosomes (BACs). The original
Kiss1 BACs were purchased from BACPAC Resources Center at Children’s Hospital Oakland Research Institute. Both spanned the entire coding region of
Kiss1 gene. The first BAC (RP24-186J14) contained approximately 88.03 kb sequence upstream of the
Kiss1 start codon and approximately 86.26 kb sequence downstream of the
Kiss1 stop codon. The second BAC (RP24-299B2) contained approximately 109.49 kb sequence upstream of the
Kiss1start codon and approximately 69.01 kb sequence downstream of the
Kiss1 stop codon. These BACs were transformed into EL250 cells by electroporation. EL250 cells were provided by N. Copeland; they contain heat-inducible recE and recT recombinases for homologous recombination and arabinose-inducible Flp-recombinase for site-specific recombination at
frt sites (
Lee et al., 2001). Next, a DNA fragment containing the coding sequence of Cre recombinase followed by an SV40 polyadenylation (polyA) signal and a kanamycin resistance gene flanked by
frt sites (FKF) was inserted into the
Kiss1 BACs, at the translational start site of
Kiss1, by ET-cloning. The construction of the Cre-polyA-FKF cassette was described previously (
Dhillon et al., 2006). This insertion also resulted in the replacement of the entire coding region of
Kiss1 and an additional 48-bp downstream of the
Kiss1 stop codon. Finally, the kanamycin resistance gene was removed by arabinose induction of Flp-recombinase, and the Cre recombinase coding region was sequenced to ensure that no mutations had been introduced. The Cre-modified
Kiss1 BACs were submitted to the UTSW Medical Center Transgenic Core Facility for microinjection into pronuclei of fertilized one-cell stage embryos of C57BL/6 mice. Oligonucleotide primers used to confirm the genotype of mice harboring the Kiss1-Cre transgenes were as follows: M358: 5′-GCTCTGGTGAAGTACGAACTCTGA-3′ and M247: 5′-TGCGAACCTCATCACTCGTTGCAT-3′. The mice used in this study were on a pure C57BL/6 genetic background ().
2.3 Validation of Kiss1-Cre mouse models
In order to validate our lines, we crossed the Kiss1-Cre mice with reporter mice that express either GFP [B6.Cg-Tg(ACTB-Bgeo/GFP)21Lbe/J; Jackson Labs] or βGal [B6.129S4-Gt(ROSA)26--Sortm1Sor/J; Jackson Labs] in a Cre-dependent manner (
Srinivas et al., 2001,
Scott et al., 2009). The lines demonstrating Cre activity (as assessed by Cre-mediated expression of GFP and/or βGal) in the hypothalamic arcuate nucleus (Arc) and anteroventral periventricular nucleus (AVPV, line J2-4) were used in additional histochemical experiments for assessment of colocalization of Cre activity and
Kiss1 mRNA expression. Adult (60-day old) males and females from each line (n = 8 females and n = 4 males per line) were perfused in the afternoon (2:00 to 4:00 pm). Females were further divided into two groups: those ovariectomized 15 days prior perfusion (n = 4) and those normally cycling (n = 4). Brains were dissected, cryoprotected overnight and cut in the frontal plane into 25-μm sections on a freezing microtome. Five series were collected into antifreeze solution and stored at −20°C.
2.4 Quantitative RT-PCR (qPCR)
In order to further assess the expression of Kiss1 mRNA, we collected tissue from specific brain sites from wild-type C57BL/6 mice (n=3 males and n=3 females). These sites included olfactory bulb, cerebral cortex, amygdala, hypothalamus, cerebellum and brainstem. Mice were anesthetized (chloral hydrate 7% ip.) and decapitated, brains were removed and blocks containing the specific sites were collected using neuroanatomical landmarks, as reference. Olfactory bulb was collected by an incision made immediately before the anterior fissure at the anterior edge of the frontal cortex. Cerebral cortex was collected by cutting the dorsal cortical mantle, which comprises the motor cortex and medial subfield of the somatosensory cortex. Ventral limits were defined by the corpus callosum. Amygdala was collected following an incision lateral to the optic tract and ventral to the rhinal fissure. Part of the piriform cortex was also included in this block. Hypothalamic blocks were limited by an incision 1 mm anterior to the optic chiasm and another immediately posterior to the mammillary bodies. Lateral limits were defined by the optic tract, and superior limits were defined by the dorsal tip of the third ventricle. We attempted to avoid thalamic tissue, but some contamination may have occurred. The cerebellum was obtained by harvesting the cerebellar cortex, having the forth ventricle as the ventral limit. We expect to have included the cerebellar nuclei as well. The brainstem was collected after incision made immediately caudal to the mammillary bodies and isolation of the cerebellar tissue.
Total Kiss1 mRNA levels were determined by quantitative RT- PCR (qPCR). RNA was extracted using TRIzol reagent (Invitrogen) and 2 μg of total RNA was incubated in DNase I (Roche Diagnostics) for 30 min at 37°C. Subsequently, cDNA was generated using random hexamers (Roche Diagnostics) and SuperScript II Reverse Transcriptase (Invitrogen). We used SYBR Green PCR master mix (Applied Biosystems) for qPCR analysis, and the assays were performed using an Applied Biosystems Prism 7900 HT sequence detection system. The mRNA contents were normalized to cyclophilin content (forward primer: 5′-TGGAGAGCACCAAGACAGACA-3′; reverse primer: 5′-TGCCGGAGTCGACAATGAT - 3′), and the resulting values were expressed as fold change above control levels. The primers for Kiss1 mRNA quantification were 5′-GGCAAAAGTGAAGCCTGGAT-3′ (forward) and 5′-GATTCCTTTTCCCAGGCATT-3′ (reverse). Data are expressed as mean ± SEM.
2.5 Leptin administration
To identify those hypothalamic Kiss1 neurons directly targeted by circulating leptin, we initially assessed the distribution of leptin-induced phosphorylation of STAT3 (pSTAT3) in C57BL/6 female mice. These mice were treated with recombinant murine leptin (provided by Dr. A.F. Parlow, Harbor-UCLA Medical Center, Torrance, CA-USA; through the National Hormone and Peptide Program) or pyrogen free saline (PFS, Sigma). Estrous cycle was monitored and, on diestrus, mice were fasted for 24h before leptin or PFS treatment. We compared the distribution of pSTAT3 following 2 different pharmacological doses of leptin (2.5 μg/g or 5.0 μg/g) on brains from mice perfused at 3 different time points following leptin administration, as follows: 45 min after injection (2.5 μg/g n=4; 5.0 μg/g n=8; and PFS n=4), 60 min after injection (5.0 μg/g n=4; and PFS n=3) or 120 min after injection (5.0 μg/g n=4; and PFS n=3). Brains were dissected and cryoprotected overnight. Five series of sections (25- μm thickness, frontal plane) containing the entire brain were collected and processed for histology. A set of Kiss1-Cre reporter (GFP or LacZ, line J2-4) male and female mice were also fasted for 24h and treated with leptin or PFS ip. 45 min before perfusion (5.0 μg/g n=4; and PFS n=3) and 120 min before perfusion (5.0 μg/g n=4/line; and PFS n=3). Kiss1-Cre reporter female mice were also monitored for estrous cyclicity and were fasted on diestrus, 24h prior perfusion.
2.6 Single and dual label immunohistochemistry
GFP- or βGal-immunoreactivity (GFP-ir or βGal-ir) was assessed in series of brain sections from both male and female Kiss1-Cre reporter mice (line J2-4). Briefly, sections were incubated in primary anti-GFP (1:5,000, Aves Labs, cat# GFP-1020) or anti-βGal (1:5,000, Abcam, cat# ab9361) antisera (both made in chicken), diluted in PBS + 0.25% Triton X-100 (Sigma) and 2% normal goat serum (Vector Labs.), overnight at room temperature. The next day, sections were rinsed in PBS and incubated in AlexaFluor 488-conjugated goat anti-chicken secondary antisera (1:250, Invitrogen) for 1h. Sections were mounted onto gelatin-coated slides, air dried and coversliped with Fluoromount medium. Series of sections from Kiss1-Cre/GFP reporter mice were also submitted to standard immunoperoxidase reaction (
Rondini et al., 2004). Following incubation in anti-GFP antisera (1:20,000), sections were incubated in biotin-conjugated donkey anti-chicken secondary antisera (1:1,000, Jackson Labs.) and avidin-biotin complex. A peroxidase reaction was performed using 3,3′-diaminobenzidine tetrahydrochloride (DAB; Sigma) as chromogen and 0.03% hydrogen peroxide dissolved in 0.1 M PBS, pH 7.4, for 2–3 min. Sections were mounted onto gelatin-coated slides, dehydrated, delipidated and coverslipped with DPX mounting medium (Sigma-Aldrich).
Series of brain sections from C57BL/6 female mice treated with leptin or saline were submitted to a standard immunoperoxidase reaction to detect pSTAT3 immunoreactivity (pSTAT3-ir). Sections were pretreated with a solution containing 1% hydrogen peroxide and 1% sodium hydroxide, for 20 min. After rinses in PBS, sections were incubated in 0.3% glycine followed by 0.03% lauryl sulfate for 10 min each, and blocked in 3% normal donkey serum diluted in 0.1 M PBS + 0.25% Triton X-100. The sections were then incubated in antisera against pSTAT3 (1:2,000, Cell Signaling, cat# 9131) at 4° C for 48–72h. This was followed by incubation for 1 h in biotin-conjugated donkey anti-rabbit secondary antisera (1:1,000, Jackson Laboratories) and for 1 h in avidin-biotin complex (1:500, Vector Labs). The tissue was then submitted to immunoperoxidase reaction as described except that in this case we used DAB and 0.5% nickel-ammonium sulfate (Fisher Sci.) as chromogens. Sections were mounted onto gelatin-coated slides, dehydrated in increasing concentration of ethanol, delipidated in xylenes and coverslipped with DPX mounting medium (Sigma-Aldrich).
Series of sections from Kiss1-Cre reporter mice (n=3 females from each line) were incubated in anti-ERα antisera (1:10,000, Upstate, antisera made in rabbit, cat#C1355) or antiβ–Endorphin antisera (βEnd 1:2,000, Phoenix Pharmaceutical, antisera made in rabbit, cat# H-022-33), overnight at room temperature, followed by AlexaFluor-594 conjugated donkey anti-rabbit secondary antisera (1:500, Invitrogen). Subsequently, sections were incubated in anti-GFP or anti-βGal antisera (1:5,000) overnight followed by incubation in AlexaFluor-488 conjugated secondary antisera as previously described. Sections were mounted onto gelatin-coated slides, air dried and coversliped with Fluoromount.
To assess whether Kiss1 neurons coexpress melanocortin receptors type 4 (MC4R), we used brain sections from MC4R-GFP female mice, kindly provided by Dr. Joel K. Elmquist (University of Texas Southwestern Medical Center, Dallas, TX). Series of sections were incubated in anti-GFP antisera (1:5,000) overnight at room temperature followed by AlexaFluor-488 conjugated goat anti-chicken secondary antisera (1:250). Subsequently, sections were incubated in anti-kisspeptin antisera (1:2,000, Millipore antisera made in rabbit, cat#AB9754) and AlexaFluor-594 conjugated secondary antisera. Sections were mounted onto gelatin-coated slides, air dried and coverslipped with Fluoromount.
To assess whether Kiss1 neurons are directly responsive to leptin, brain sections from Kiss1-Cre reporter mice (line J2-4) treated with leptin were submitted to dual label immunohistochemistry to detect GFP-ir or βGAl-ir and pSTAT3-ir. In addition, series of brain sections from female LepR-IRES-Cre reporter (LacZ) mice (n = 4) were submitted to dual label immunofluorescence to detect βGal-ir and kisspeptin-ir. The LepR-IRES-Cre mice were kindly provided by Dr. Jeffrey Friedman (Laboratory of Molecular Genetics and Howard Hughes Medical Institute, Rockefeller University, New York, NY).
2.7 In situ hybridization/dual label immunohistochemistry-in situ hybridization
We performed a set of single-label in situ hybridization histochemistry in one series of sections from Kiss1-Cre reporter lines in order to evaluate if
Kiss1 gene expression was intact in our
Kiss1-Cre mouse lines (n = 3 females on diestrus/line). In addition, single-label in situ hybridization histochemistry was performed in brain sections from C57BL/6 mice to assess whether melanocortin 4 receptors (MC4R) are expressed in the AVPV of female mice. Prior to hybridization, brain sections were mounted onto SuperFrost plus slides (Fisher Scientific) and pretreated in 0.1 M citric acid pH 6.0 under microwave for 10 min, as described (
Zigman et al., 2006,
Scott et al., 2009). The riboprobes (Kiss1 and MC4R) were generated by
in vitro transcription with
35S-UTP. The
35S-labeled probes were diluted in hybridization solution and brains sections were hybridized overnight at 56°C (
Zigman et al., 2006). The next day, slides were incubated in 0.002% RNAse A followed by stringency washes. Sections were dehydrated in increasing concentrations of ethanol and delipidated for 15 minutes in xylenes. After washes in 100% and 95% ethanol, tissue was air-dried, and slides were placed in X-ray film cassettes with BMR-2 film (Kodak, Rochester, NY) for 2–3 days. Slides were then dipped in NTB photographic emulsion (Kodak, VWR), and stored in foil-wrapped slide boxes at 4°C for 3–4 weeks. Slides were developed with Dektel developer (Kodak, VWR), counterstained with thionin, dehydrated in increasing concentration of ethanol, cleared in xylenes and coverslipped with Permaslip.
We performed dual label in situ hybridization/immunohistochemistry to determine coexpression of GFP-ir or βGal-ir with
Kiss1, vGluT2, GAD-67 or NPY mRNAs (line J2-4). The dual label in situ hybridization procedure was a modification of that previously reported (
Liu et al., 2003,
Yamamoto et al., 2003,
Scott et al., 2009). Series of sections of Kiss1-Cre reporter mice were rinsed with DEPC-treated PBS for one hour before being pretreated with 1% sodium borohydride (Sigma) for 15 minutes. After washes in DEPC-PBS, tissue was briefly rinsed in 0.1 M TEA, pH 8.0 and incubated for 10 minutes in 0.25% acetic anhydride in 0.1 M TEA. The tissue was then rinsed in DEPC-treated 2× SSC before hybridization. The riboprobes (Kiss1, vGluT2, GAD-67 and NPY) were generated by
in vitro transcription with
35S-UTP. The
35S-labeled riboprobes were diluted to 10
6 cpm/ml in hybridization buffer and applied to the tissue. Sections were incubated overnight at 50°C. The next day, sections were incubated in 0.002% RNase A (Roche Applied Bioscience) for 30 minutes at 37°C. Sections were then submitted to stringency washes followed by immunohistochemistry for detection of GFP-ir or βGal-ir, as previously described, using DAB as chromogen. Sections were mounted onto SuperFrost Plus slides, dehydrated in increasing concentrations of ethanol and delipidated for 15 minutes in xylenes. After washes in 100% and 95% ethanol, the tissue was air-dried, and slides were placed in X-ray film cassettes with BMR-2 film (Kodak, Rochester, NY) for 2–3 days. Hybridization signal was detected following standard autoradiographic protocol as previously described. All probes used in this study have been tested and published before (
Elias et al., 1999,
Elias et al., 2001,
Liu et al., 2003,
Tong et al., 2007,
Donato et al., 2009,
Scott et al., 2009).
2.8 Fluorescence Activated Cell sorting (FACS)
We took advantage of the fluorescence signal transmitted by GFP positive neurons to assess the expression of genes of interest in subpopulations of Kiss1 neurons. Female Kiss1-Cre/GFP mice on diestrus (n = 6) were sacrificed via an overdose of isofluorane. They were quickly decapitated and the brains excised in a manner preserving skull-base hypothalamic structures. The brains were placed in ice cold DEPC-treated PBS on an ice-cold pedestal positioned under a dissecting microscope. Regions comprising the AVPV (incision immediately caudal to the optic chiasm) and the arcuate nucleus (caudal to the optic chiasm to the mammillary body) were acutely dissected away from the rest of the brain tissue using an 11-blade scalpel. Females NPY-hrGFP (n = 3) and POMC-hrGFP (n = 4) kindly provided by Dr. Joel K. Elmquist (University of Texas Southwestern Medical Center, Dallas, TX) were used as control. Wild-type mice were included in each assay as a negative control. Excised regions were placed in cold Hank’s Balanced Salt Solution (HBSS, without calcium or magnesium, Gibco) in a 1.7 ml microcentrifuge tube and kept on ice. The tube was briefly spun down at 13,000 rpm to pellet tissue. HBSS was removed and replaced with a 500 μl of 5% dispase solution in HBSS (v/v, Dispase: BD 354235; HBSS: 14170-112), and the tissue was manually broken up using a pipette and allowed to digest at 37°C for 10 min, with occasional mixing by pipetting. After digestion the tissue was further broken up by manual pipetting and 500 μl of FACS buffer (2.2 ml 45% tissue-culture grade D+glucose; 10 μL 0.5 M EDTA; 30 mg fatty-acid free BSA; in 10 ml HBSS) then was added to neutralize the dispase. The slurry was pelleted at 13,000 rpm for 2 minutes. Supernatant was removed and the pellet was dissolved in 500 μl FACS buffer. Once fully resuspended, the slurry was passed through a cell-strainer topped polypropylene tube (cell strainer tops: BD falcon 5 mL; pp polypropylene tubes: VWR 12×75 mm round bottom).
The UTSW Flow Cytometry Core facility was used to sort GFP positive (GFP+) neurons. GFP was excited by a 488 nm laser. GFP negative (GFP-) neurons were used as control to properly gate a MoFlo flow cytometry and fluorescence activated cell sorter for GFP+ neurons. Live neurons (as gated by forward and side scatter) that were GFP+ were collected directly into 1.7 ml microfuge tubes containing 500 ul of RNAlater solution (Ambion AM7024). Neurons were spun down at 13,000 rpm for 30 minutes, excess RNAlater was removed, and the neurons were frozen at −80°c until RNA extraction.
RNA extraction was done using the PicoPure RNA Isolation kit (Arcturus). All steps described in the MacroCap LCM instructions were followed, except that 100 ul of extraction buffer and 100ul of 70% ethanol were used instead of the volumes listed. Neurons from multiple animals were pooled on-column in order to achieve at least 1000 GFP+ neurons per pool (pools contained a maximum of two animals, n = 3 pools). RNA was extracted using 12 μl of kit elution buffer. All 12 μl of sample, as well as a standard curve (0.5 ug to 16 ng) of universal RNA was subjected to reverse transcription.
Prior to qPCR, cDNA was pre-amplified for genes of interest (Kiss1, NPY, POMC, ERα, LepR, MC4R, vGluT2, GAD67) using 2xTaqMan PreAmp Master Mix (Applied Biosciences, 4384266), according to the manufacturer’s directions, for 18 cycles. The following primers were used: Kiss1 (primer sequences described above); NPY forward: 5′-CGCTCTGCGACACTACATCA – 3′ reverse: 5′-TCTCAGGGCTGGATCTCTTG – 3′; POMC forward: 5′-TGCTTCAGACCTCCATAGATGTGT – 3′ reverse: 5′-GCGAGAGGTCGAGTTTGCA – 3′; LepR forward: 5′-CCCAGCACAATCCAATCACTAG – 3′ reverse: 5′-CAGACGTAGGATGAATAGATGGACTATC – 3′; MC4R forward: 5′-TGAGCCGAACCCAGAAGAG reverse: 5′-AGGAGCAGGGTCAGAAGCA – 3′; ERα forward: 5′-GCAGATAGGGAGCTGGTTCA - 3′ reverse: 5′-TGGAGATTCAAGTCCCCAAA – 3′; vGluT2 forward: 5′-TCACCCAGATTCCAGGAGGAT – 3′ reverse: 5′-CCCAAAGACCCGGTTAGCA 3′; GAD67 forward: 5′ - GGGCTATGTTCCCCTTTATGTC - 3′ reverse: 5′-TTGGATCGAATGCTCCGTAA - 3′.
Pre-amplified cDNA was diluted 20-fold in molecular grade water in 96-well deep-well liquid handler plates, and 384-well qPCR plates were assembled using a robotic liquid handler (Perkin-Elmer, Multiprobe II Nucleic Acid Workstation). Plates were assayed using SYBR Greener reagent (Invitrogen) and an ABI PRISM 7900 HT instrument. Results were calculated using the efficiency-corrected-ΔCt method as described (
Bookout et al., 2006). Briefly, individual PCR primer efficiencies were accounted for to allow gene-to-gene comparisons. PCR efficiencies were calculated from the slope of the standard curve. Results were calculated by correcting all Ct values (concentration of amplified product multiplied by time) for primer efficiency. Relative RNA level of a target gene in each sample was computed by normalizing the efficiency-corrected test gene’s Ct values to efficiency-corrected 18S values. Coefficient of variance across efficiency-corrected Ct values of a sample was used to calculate sum of the squared deviations. Data are expressed as mean ± SEM.
2.9 Data analysis and production of photomicrographs
Brain sections were analyzed using a Zeiss Axioplan microscope or a Zeiss Axioscop2 microscope equipped with the ApoTome system. Dual labeled neurons coexpressing GFP-ir or βGal-ir and pSTAT3-ir, βGal-ir and vGluT2 mRNA, βGal-ir and GAD67, GFP-ir and kisspeptin-ir were quantified. Quantification of dual labeled neurons and percentage of colocalization were determined in the AVPV, in the periventricular nucleus (PeN) and in 3 rostro-to-caudal levels of the Arc (fixed distance among them). Cells were counted in one side (right side) of a determined level of each nucleus (
Paxinos and Franklin, 2001). For the experiments with in situ hybridization, we considered cells dual-labeled if the density of silver grains (
35S-labeled riboprobe) overlying a brown cytoplasm (βGal-ir) was at least 3 × that observed in the background. For background determination, we used the density of silver grains overlying the superior cerebellar peduncle, where no cell bodies were detected. For the experiments performed to detect pSTAT3-ir in Kiss1-Cre/GFP neurons, we considered cells dual-labeled those with brown cytoplasm surrounded by a fluorescent cytoplasm. For the experiments to detect kisspeptin-ir in MC4-GFP neurons, we considered cells dual labeled those with cytoplasm containing both fluorophores detected under epifluorescence microscope. Data are expressed as mean ± SEM. Comparison between the two groups was carried out using the unpaired two-tailed Student’s
t test. Statistical analysis was performed using GraphPad Prism software, and an α value of 0.05 was considered in all analyses.
Leptin-induced pSTAT3 immunoreactive neurons were counted in one side of a determined level of brain nuclei in which we detected subjectively an increase in pSTAT3-ir (
Paxinos and Franklin, 2001). Data are expressed as mean ± SEM. One-way ANOVA followed by the pairwise Tukey test were used to compare three groups simultaneously. Statistical analysis was performed using GraphPad Prism software, and an α value of 0.05 was considered in all analyses. Cell counting was corrected for double counting by applying Abercrombie’s formula,
N =n(T/T+D), where
N = the corrected cell count,
n = the observed number of cells, T = section thickness (25 μm), and D = the diameter of the nucleus (
Guillery, 2002).
To evaluate apparent innervation or close apposition between putative melanocortin terminals (βEnd-ir) and Kiss1 cell bodies (GFP-ir), we used a Zeiss Axioscop2 microscope equipped with the ApoTome system to collect high-resolution images in the Z-axis (Z-stack of 10 optical sections, 0.4 μm intervals, 63 × magnification) and used the Axiovision 3.1 software (Zeiss) to produce 3D rendering of our images.
Drawings were produced using a camera lucida and the Adobe Illustrator CS3 software was used to incorporate drawings into plates. For the topographic distribution of Kiss1 neurons compared to NPY and POMC neurons, adjacent series of sections (n=4 females, line J2-4) were submitted to two distinct dual labeling procedures: a) dual label immunofluorescence (to reveal immnoreactivity for Kiss1 reporter gene/βGal and βEnd) and dual label immunohistochemistry/in situ hybridization (to reveal immunoreactivity for Kiss1 reporter gene/βGal and NPY mRNA expression). Distribution of individual cells was plotted using a camera lucida. Neuroanatomical landmarks were used to determine the equivalent sections in both procedures. Photomicrographs were produced by capturing images with a digital camera (Axiocam, Zeiss) mounted directly on the microscope. Adobe Photoshop CS3 image-editing software was used to integrate photomicrographs into plates. Only sharpness, contrast and brightness were adjusted.
The publisher's final edited version of this article is available at 
