PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
J Immunol. Author manuscript; available in PMC 2011 January 20.
Published in final edited form as:
PMCID: PMC3023905
NIHMSID: NIHMS263750

Proinflammatory Adjuvants Enhance the Cognate Helper Activity of Aged CD4 T Cells1

Abstract

Age-related declines in humoral responses contribute to the reduced efficacy of vaccines in older populations. Using an adoptive transfer model, we have shown that age-related intrinsic declines in CD4 T cell function contribute significantly to the reduced humoral responses observed with aging, resulting in reduced B cell expansion and differentiation as well as reduced IgG production. In this current study, we show that the helper function of aged CD4 T cells can be enhanced using a TLR-binding adjuvant or an adjuvant containing proinflammatory (PI) cytokines. The helper function of aged CD4 T cells was also enhanced when PI cytokines were added during in vitro CD4 effector generation. Enhanced helper activity resulted in improved expansion and differentiation of B cells and affinity maturation of IgG. PI cytokines also induced significant production of effector cytokines, including IL-4, IFN-γ, IL-17, and IL-21, by both young and aged CD4 T cells. Importantly, we also show that proinflammatory adjuvants can significantly enhance the humoral response in intact aged animals. We propose that one of the mechanisms involved in the ability of adjuvants to enhance both young and aged T cell responses includes driving multifaceted T cell differentiation and production of multiple cytokines by responding CD4 T cells.

The ability to produce high-affinity Abs upon immunization is dramatically reduced with age (13). Reduced Ab production and function in aged individuals, compared with young, have been observed after vaccination for Streptococcus pneumoniae, influenza, hepatitis, and tetanus (47). These studies found that not only is the amount of Ab produced in elderly patients decreased, the Abs that are produced do not function as well, showing decreased neutralizing and opsonizing activities. This is an extremely important problem since the aged are a major group targeted for vaccinations. Protection from infection following vaccination requires the production of high-affinity neutralizing Abs and is dependent upon germinal center (GC)6 formation in secondary lymphoid organs. GC development requires appropriate interactions between Ag-specific B cells and helper CD4 cells. Therefore, both of these cell types must function correctly for proper GC formation to occur.

The main subset of helper T cells involved in this B cell helper activity have been identified as T follicular helper (Tfh) cells (810). Tfh cells express the chemokine receptor CXCR5, which allows them to localize in the follicular areas of lymphoid tissue. They also express costimulatory molecules, such as CD40L (CD154), ICOS (CD278), and OX40 (CD134) and produce IL-21 (11). Numerous studies have shown that aging leads to decreased germinal GC formation, decreased levels of somatic hypermutations (SHM), and the production of Abs that are less protective (1215). These studies concluded that aged CD4 cells are not able to provide cognate B cell help that leads to the production of high-affinity Abs. Importantly, our laboratory and other researchers have shown that specific age-related declines in CD4 T cell function can dramatically impact humoral responses to vaccination (16, 17).

The response of CD4 T cells to protein Ags in vivo can be dramatically enhanced by the administration of the Ag in adjuvant, which increases T cell expansion and prevents tolerance induction (18). Importantly, potent adjuvants, including TLR-binding adjuvants, induce the production of proinflammatory (PI) cytokines, which can act to enhance CD4 T cell function (1821). These cytokines work, in part, by activating NF-κB, leading to enhanced clonal expansion of Ag-stimulated T cells by inducing growth and/or survival signals. PI cytokines can also act directly on CD4 cells to improve both expansion and survival of effectors. In vivo, TNF-α and IL-1 enhance the expansion, persistence, and differentiation of responding CD4 T cells (18). IL-1 and IL-6 together also exhibit costimulatory effects on CD4 cells that are APC independent, enhancing proliferation and IL-2 production by TCR-stimulated CD4 cells (22). In addition, IL-1 production by APC populations induces the expression of both CD40L and OX40 on CD4 cells (23), both of which are important in mediating CD4 cognate helper function. Notably, IL-1 alone has also been shown to exhibit an adjuvant-like effect in vivo, causing an increase in serum Ab production when administered with a protein Ag (24, 25). In this study, we show that inflammatory adjuvants, such as a TLR-binding molecules or PI cytokines, can enhance the in vivo cognate helper activity of CD4 T cells from aged mice, resulting in significantly improved humoral responses in both an adoptive transfer model and in intact mice. We also show that the most potent adjuvants (those that induce the most vigorous humoral responses) induce a heterogeneous population of CD4 T cell effectors, including those that secrete Th1, Th2, and Th17 cytokines.

Materials and Methods

Animals

All mice used in these studies were bred and housed in the Trudeau Institute animal facility. Young (2–4 mo) and aged (20–24 mo) B10.BR mice were used for studies involving intact hosts. AND TCR-transgenic (TCR Tg) mice were used as a source of young (2–4 mo) and aged (16–18 mo) CD4 T cells in adoptive transfer studies. AND TCR Tg mice express a Vβ3/Vα11 TCR Tg specific for a peptide fragment of pigeon cytochrome c (PCC) presented by MHC class II (I-Ek) (26). Young (2–4 mo) CD4 knockout (CD4KO) mice, backcrossed to B10.Br, were used as adoptive hosts. All animals were housed and aged in sterilized, high-efficiency particulate air-filtered, individually ventilated caging at the animal facility at the Trudeau Institute until use. Experimental procedures involving mice were approved by the Trudeau Institute Institutional Animal Care and Use Committee.

T cell enrichment and culture

Naive CD4 T cells were enriched from spleens and pooled peripheral lymph nodes by negative selection with MACS magnetic beads (Miltenyi Biotec) and Percoll gradient centrifugation. Purity of TCR Tg CD4 T cells was determined by flow cytometric analysis of Vβ3/Vα11 TCR staining. T cells were cultured in RPMI 1640 (Cellgro) supplemented with 200 µg/ml penicillin, 200 µg/ml streptomycin, 4 mM glutamine, 50 µM 2-ME, 10 mM HEPES, and 8% FBS (Sigma-Aldrich). To generate effector populations in vitro, TCR Tg T cells were stimulated with 5 µM PCC peptide presented by a mitomycin C-treated APC cell line (DCEK-ICAM fibroblasts (27)). The following effector populations were generated: no cytokine effectors (peptide Ag with APC alone), Tpi effectors (Ag/APC with TNF-α, IL-1, and IL-6 (all at 10 ng/ml)), or Th17 effectors (Ag/APC with IL-23 (50 ng/ml), IL-2 (11 ng/ml), and anti-IFN-γ and anti-IL-4 (both at 10 µg/ml)).

Adoptive transfer and immunization

For all studies, each experiment was conducted at least twice with at least five individual mice per experimental group. Naive or effector TCR Tg T cells (106) from young or aged AND Tg mice were transferred i.v. into young CD4KO hosts. Mice (adoptive hosts or intact animals) were immunized i.p. with 200 µg of 4-hydroxy-3-nitrophenyl acetyl (NP)-conjugated PCC (NP-PCC) in alum. PI cytokines (TNF-α, 250 ng; IL-1, 500 ng; and IL-6, 500 ng; PeproTech]) were administered i.p. on days 0, 1, and 2. For some studies, 50 µg of polyriboinosinic-polyribocytidylic acid (poly(I:C)) was alum precipitated with NP-PCC.

Humoral responses and immunofluorescent staining

Two weeks after immunization, splenocytes were harvested and NP-specific B cells were identified by staining with NP conjugated to allophycocyanin (NP-allophycocyanin) (16). The CD38 and PNA phenotype of the NP+ population was examined using a FACSCalibur flow cytometer (BD Biosciences) and the data were analyzed with FlowJo software (Tree Star). Serum was also collected and NP-specific IgG titers were determined by ELISA. The final Ab titer was determined by the last dilution of serum to give a detectable signal above background. FITC-PNA was purchased from Sigma-Aldrich; PE anti-CD38 (clone 90) was purchased from BD Pharmingen. NP-PCC and NP-allophycocyanin were prepared as previously described (28).

Somatic mutation analysis

Analysis was conducted using methods described by Jacob et al. (29). Briefly, 2 wk after adoptive transfer and immunization, splenocytes were harvested from five mice for each group, pooled, and stained. NP-specific B cells were sorted for GC phenotype (PNAhighCD38low) using a FACSVantage cell sorter (BD Biosciences). RNA was extracted and reverse transcribed to generate cDNA. NP-specific IgG1 VH sequences were amplified by nested PCR. The primers for the first round of amplification were CATGCTCTTCTTGGCAGCAACAGC and GTGCACACCGCTGGACAGGGATCC; primers for the second round of amplification were CAGGTCCAACTGCAGCAG and AGTTTGGGCAGCAGA. PCR products were cloned and sequenced and then compared with germline for mutations in CDRs 1 and 2. For each sample, at least 50 unique sequences were examined. The frequency of mutations for each condition was calculated using the equation: (No. of mutated sequences/no. of total sequences) × 100.

Real-time PCR

RNA was extracted from CD4 T cell effector populations using a RNeasy Kit (Qiagen) according to the manufacturer’s instructions. RNA samples were reverse transcribed to generate cDNA, which was amplified with TaqMan reagents on the Applied Biosystems Prism 7700 sequence detection system. Primers and probes were purchased from Applied Biosystems Gene Expression Assays. Levels of gene expression were normalized to levels of GAPDH for each sample and the fold increase in signal was determined using the ΔΔCT calculation recommended by Applied Biosystems. Samples were run in triplicate and the results shown are log-fold changes in gene expression between sample groups.

ELISPOT analysis

Cytokine production by CD4 T cells was examined by ELISPOT as described in a recent publication (30). Briefly, IL-17, IL-21, IL-4, and IFN-γ production was determined by culturing CD4 T cells (5 × 105) with irradiated splenocytes with or without PCC peptide and IL-2 (10 ng/ml). After 18 h, plates were developed and the total number of responding cells was determined. Background cytokine production (without peptide) was subtracted from specific cytokine production (with peptide) to determine the total number of cytokine-producing cells within each population.

Statistical analysis

Statistical significance was determined by a two-tailed Student’s t test or χ2 analysis. Values of p < 0.05 were considered significant.

Results

A TLR-binding adjuvant enhances the helper activity of aged CD4 T cells

Naive CD4 T cells (CD44lowCD62LhighCD25neg) from young (2–4 mo) and aged (16–18 mo) AND TCR Tg mice, which express a Vβ3/Vα11 TCR specific for a peptide of PCC (26) were used for these studies. Donor TCR Tg CD4 T cells were transferred into young CD4KO hosts which were then immunized with NP-PCC in alum with or without poly(I:C) added to the immunization. CD4KO hosts were used for these studies because they do not respond to NP-PCC immunization in the absence of donor CD4 T cells (16). We have shown previously that the responding young and aged donor T cells migrate into the B cell follicle and develop a phenotype similar to Tfh cells with up-regulation of CXCR5 and CD134 following immunization with NP-PCC/alum (16). When alum alone was used as an adjuvant, aged TCR Tg CD4 T cells provided low levels of help, with reduced levels of host NP+ B cell expansion and differentiation to a GC phenotype (PNAhighCD38low) when compared with hosts receiving young donor T cells (Fig. 1A). In contrast, the addition of poly(I:C) to the immunization protocol significantly enhanced the activity of the aged donor cells, leading to increased expansion of host NP+ B cells and differentiation to a GC phenotype (Fig. 1B). It is interesting to note that poly(I:C) does not have an enhancing effect on the NP-specific response in the hosts that received young CD4 T cells, but did enhance the response in the hosts receiving aged CD4 T cells (2.5-fold increase in the number of NP+ cells and 3.2-fold increase in the number of GC+ cells). Thus, in this adoptive transfer model. addition of a TLR-binding adjuvant significantly improved the in vivo function of aged CD4 T cells.

FIGURE 1
Reduced helper activity of aged naive T cells can be enhanced with TLR-binding adjuvant. Young or aged TCR Tg CD4 T cells (1 × 106) were transferred into young CD4KO hosts which were then immunized i.p. with 200 µg of NP-PCC/alum alone ...

PI cytokines augment the helper activity of aged CD4 T cells

Since TLR-binding adjuvants, such as poly(I:C), induce the production of PI cytokines and up-regulate NF-κB activation, we went on to examine the ability of a mixture of PI cytokines to enhance the in vivo function of aged donor T cells. The cytokine mixture used for these studies was composed of TNF-α, IL-1, and IL-6, which we have shown previously improves the in vivo expansion and differentiation of aged CD4 T cells by enhancing NF-κB activation (31). Fig. 2A shows that the NP-specific B cell response and IgG production were significantly lower in hosts receiving aged donor T cells when alum alone was used as the adjuvant. In contrast, when hosts were immunized with NP-PCC/alum and PI cytokines, the expansion and GC differentiation of NP-specific cells were very similar regardless of whether the donor T cells were from young or aged mice (Fig. 2B). Interestingly, not only was the expansion of NP-specific cells enhanced in the presence of aged donor cells, it was also enhanced in the presence of young cells by ~10-fold (compare cell numbers in Fig. 2, A and B). Although the serum titers of NP-specific IgG1 (and other isotypes also; data not shown) were not enhanced by the cytokine adjuvant when young donor T cells provided help, the use of the PI cytokine adjuvant did significantly enhance the IgG1 (Fig. 2B), IgG2a, IgG2b, and IgG3 (Fig. 2C) titers when aged donor CD4 T cells provided help.

FIGURE 2
Reduced helper activity of aged naive T cells can be enhanced with cytokine adjuvant. Young or aged TCR Tg CD4 T cells (1 × 106) were transferred into young CD4KO hosts which were then immunized i.p. with 200 µg of NP-PCC/alum alone ( ...

Since the total amount of NP-specific IgG was significantly increased in hosts with aged donor T cells immunized with the PI cytokine adjuvant, we went on to examine the levels of affinity maturation of these Abs. The levels of SHM in the VH genes from NP-specific GC B cells were examined by PCR analysis. Fig. 2D shows that when alum alone was used as an adjuvant, the frequency of mutations on day 14 following immunization was significantly greater in the presence of young CD4 T cells compared with aged donor cells (2.57% vs 1.63%). In contrast, when alum with added PI cytokines was used, the frequency of mutations was very similar, whether help was provided by young or aged CD4 T cells (2.86% vs 2.21%). Thus, not only was the quantity (better B cell expansion and higher IgG titers) of the humoral response enhanced in the presence of PI cytokines, the quality (higher levels of somatic mutations) of the response was improved when help was provided by aged CD4 T cells. Interestingly, the replacement: silent (R:S) ratio of mutations was not different between the young and aged T cell groups and did not change with the addition of PI cytokines to the immunization. This result indicates that although the defect in aged CD4 T cell function significantly impacts the frequency of mutations, this defect does not negatively influence the R:S ratio.

To determine whether the PI cytokine adjuvant was having a direct effect on the responding CD4 T cells, in vitro-generated effector populations were examined. Young and aged naive TCR Tg CD4 T cells were stimulated with peptide/APC (27), with no added cytokines (Th0 effectors), or with added PI cytokines (Tpi effectors) for 4 days. Effectors were transferred into young CD4KO hosts, which were then immunized with NP-PCC/alum. On day 14, the Th0 effectors generated from aged T cells exhibited significantly reduced helper activity compared with young Th0 effectors, leading to a 3-fold reduction in expansion and a 5-fold reduction in GC differentiation of NP-specific B cells and reduced NP-specific IgG1 titers (Fig. 3A). In contrast, Tpi effectors generated from both young and aged T cells exhibited robust helper activity (Fig. 3B) that was dramatically enhanced over the Th0 effector populations with regard to B cell expansion (compare cell numbers in Fig. 3, A and B). These results demonstrate that the PI cytokines can act directly on CD4 T cells, enhance their differentiation, and dramatically improve their in vivo function.

FIGURE 3
Tpi effectors from aged mice exhibit good cognate function. In vitro effectors were generated using TCR Tg CD4 T cells from young and aged AND mice by culturing with (A) Ag/APC alone or (B) with added PI cytokines (TNF-α, IL-1, and IL6; all 10 ...

Effect of PI cytokines on CD4 T cells

We have shown previously that PI cytokines can enhance the in vitro proliferation and IL-2 production by aged CD4 T cells via a mechanism involving enhanced NF-κB activation (31). To further determine the influence of PI cytokines on the effector generation and polarization of young and aged CD4 T cells, cytokine production by Th0 and Tpi effectors was examined more extensively. After 4 days of culture, effector populations were restimulated with anti-Vβ3 and anti-CD28 and RNA was collected and analyzed by real-time PCR. The signature cytokines of each major Th subset was examined: IFN-γ for Th1, IL-4 for Th2, and IL-17, IL-21, and IL-22 for Th17. Fig. 4A shows the fold induction of mRNA for each cytokine in young and aged effector populations. Both young and aged Th0 effectors expressed mRNA for IL-4 and IFN-γ, with little mRNA for IL-17 family cytokines, indicating induction of a mixture of Th1 and Th2 phenotype effectors. The major difference observed in the Th0 effectors was higher levels (1.7 log higher) of IFN-γ mRNA in the aged population. These results are not surprising since these Th0 effectors were not generated with IL-4- or IFN-γ-blocking Abs. Importantly, the cytokine production profiles of young and aged Th0 effector populations do not contribute to our understanding of why the young effectors exhibit robust cognate help, while the aged Th0 effectors do not.

FIGURE 4
PI cytokines drive production of IL-17 family cytokines. Effectors were generated using CD4 T cells from young and aged TCR Tg mice with Ag/APC alone (Th0) or with PI cytokines (Tpi) for 4 days. A, Effectors were harvested and then cultured for 4 h with ...

Both young and aged Tpi effectors also expressed mRNA for IL-4 and IFN-γ, but induction of IL-17 family cytokines (1– 3.4 log increase) was also observed. Thus, the Tpi effector population contained a combination of Th1, Th2, and Th17 effectors. To determine the differences in expression of transcription factors in young and aged Th0 and Tpi populations, we examined T-bet, GATA3, and RORγt mRNA levels, which indicate polarization to Th1, Th2, and Th17 effectors, respectively. Fig. 4B shows the induction of mRNA for each transcription factor in Tpi effectors compared with Th0 effectors. This analysis allows for the visualization of the differences in expression between these two effector populations and also allows us to determine which transcription factors are shared (fold induction will be less) and which are unique (fold induction will be more). Both young and aged Tpi effectors showed induction of T-bet and GATA3 that were only slightly different from the Th0 effectors, indicating similar expression in these populations. In contrast, Tpi effectors expressed 1 log higher RORγt compared with Th0 effectors, indicating induction of a Th17-like phenotype in the Tpi population.

Cytokine protein production was also examined for these effector populations. Fig. 4C shows that by ELISPOT analysis, both young and aged Th0 effectors produce moderate levels of IL-4, IL-17, and IL-21 and high levels of IFN-γ. Young and aged Tpi effectors produced significantly higher levels of IFN-γ, IL-4, IL-17, and IL-21 compared with the Th0 effectors.

Th17 effectors exhibit good cognate activity

Since Tpi effectors exhibited production of IL-17 family cytokines, we went on to examine the in vivo cognate helper function of in vitro-generated Th17 effectors. Th0 and Th17 effectors were generated in vitro and transferred to adoptive hosts, which were then immunized with NP-PCC/alum. As expected, aged Th0 effectors showed significantly reduced helper activity compared with the young Th0 effectors (Fig. 5A). Interestingly, both young and aged Th17 effectors showed robust helper function leading to good expansion of NP-specific B cells and differentiation to a GC phenotype (Fig. 5B). In fact, the aged Th17 effectors exhibited significantly better helper activity compared with young Th17 effectors. To determine whether differences in cytokine production by the young and aged Th17 effectors could account for the difference in helper function, we also examined cytokine production of Th17 effectors using ELISPOT analysis. There was no difference in the number of young and aged effectors producing IL-4, IL-17, or IL-21, but there were significantly more IFN-γ-producing effectors in the aged Th17 population (Fig. 5C). Although cytokine production alone is not likely to account for the observed enhancement of function, it is clear that not only can naive CD4 T cells from the aged donors readily differentiate to Th17 effectors, these effectors exhibit robust in vivo function.

FIGURE 5
Th17 effectors from aged mice exhibit good cognate function. In vitro effectors were generated using TCR Tg CD4 T cells from young and aged AND mice by culturing with Ag/APC alone (Th0) or with Th17- polarizing conditions (IL-23, IL-2, anti-IL-4, anti-IFN-γ). ...

Inflammatory cytokines can enhance responses in intact aged animals

Since the aged environment in intact animals is likely to be somewhat different from our adoptive transfer model using young CD4KO hosts, the ability of these inflammatory adjuvants to increase the response to vaccination in intact aged animals was also examined. The expansion and GC differentiation of NP-specific B cells was significantly lower in aged mice compared with young when alum alone was used as an adjuvant (Fig. 6A). In contrast, no significant differences were apparent in young and aged groups when PI cytokines (Fig. 6B) or poly(I:C) (Fig. 6C) were added to the immunization protocol. Thus, not only do these inflammatory adjuvants have enhancing effects in the adoptive transfer model, they also restore function in intact aged animals.

FIGURE 6
Inflammatory adjuvants enhance responses in intact aged animals. Young and aged B10.BR mice were immunized with NP-PCC/alum alone (A), NP-PCC/alum with PI cytokines (B), and NP-PCC/alum with poly(I:C) (C). On day 14, the number of NP+ and GC+ cells was ...

Discussion

Responses to vaccination, such as the yearly influenza vaccine, are dramatically reduced in the elderly. A review of published studies over the last 20 years describes significantly lower levels of both seroconversion and seroprotection in elderly populations following influenza vaccination when compared with young subjects (32). This is problematic since the elderly are much more susceptible to infections and are often targeted for vaccination. The immune response to vaccination can be enhanced by the use of adjuvants, but currently aluminum-containing adjuvants, such as alum, are the predominant adjuvant found in human vaccines. Alum induces the production of IL-4, IL-5, and IL-10 as well as the chemokines CCL2 (MCP-1), CXCL1 (KC), and CCL11 (eotaxin 1) by responding Ag-specific CD4 T cells (33), inducing a vigorous type 2 immune response. Although Th2 effector generation proceeds efficiently in the young, our studies have shown that naive CD4 T cells from aged mice do not differentiate well to Th2 effectors without the addition of exogenous IL-2 (34). Thus, the response to vaccination with alum-adjuvanted vaccines in the aged is dramatically reduced, as we have shown in this current study.

One straightforward approach to enhancing vaccine efficacy is to use more potent adjuvants. Published studies have demonstrated that the use of TLR ligands as adjuvants can significantly enhance the efficacy of vaccination in aged mice (35, 36). Moreover, we show here that the addition of poly(I:C) to our vaccine preparation could enhance the cognate helper activity of aged CD4 T cells, leading to a more robust humoral response. The use of specific TLR agonists may play a role in CD4 T cell differentiation. Poly(I:C) binds to TLR3 which is found predominantly on myeloid dendritic cells and induces activation of NF-κB and the production of high levels of PI cytokines, especially TNF-α and IL-6 (37). These conditions could favor generation of a Th2- and/or Th17-polarized response, which would be ideal for generation of protective Ab following vaccination. In contrast, other TLR agonists may influence the T cell response differently than poly(I:C). For example, CpG oligonucleotides bind TLR9, which is more highly expressed on plasmacytoid dendritic cells, and mainly induces production of type I IFN and IL-12 (38), which would drive generation of a more Th1-polarized response. Thus, by choosing TLR agonists based on the cellular expression of their receptor and the subsequent induction of cytokine production, it may be possible to direct the polarization of the CD4 T cell response.

To determine whether the induction of PI cytokines by TLR-binding adjuvants plays a role in vaccine efficacy, we examined the adjuvant effect of these cytokines directly in our adoptive transfer model. The use of the PI cytokine adjuvant in our studies is meant to be a proof of principle and assists in the determination of the mechanisms of action of the TLR agonists. The addition of PI cytokines to a vaccine preparation significantly enhanced the cognate helper activity of both young and aged CD4 T cells in young hosts (Fig. 2). In addition, the use of PI cytokines also resulted in an increase in all IgG isotypes as well as an increase in the levels of VH SHM in the presence of aged CD4 T cells. Thus, not only was the quantity of the humoral response enhanced (better B cell expansion and differentiation, higher IgG titers), the quality was also significantly enhanced (increased affinity maturation). Interestingly, although the addition of PI cytokines dramatically enhances the expansion of NP-specific cells when young donor T cells provide help, the titers of NP-specific IgG1 and the frequency of SHM remain unchanged (Fig. 2, A, B, and D). This could be due to a kinetics issue (we only examined one time point for this study) or it could indicate that these two aspects of the B cell response are controlled by different mechanisms. Further studies to examine these points are planned.

We have gone on to show that these PI cytokines induce increased expression of the transcription factor RORγt and production of IL-17 family cytokines (IL-17, IL-21, IL-22) by both young and aged CD4 T cell populations. Importantly, we have also shown that in vitro-generated young and aged Th17 effectors have potent in vivo cognate helper activity. Thus, the ability of naive CD4 T cells from aged donors to differentiate into highly functional Th17 effectors remains intact even though they lose the ability to differentiate well toward a Th2 phenotype (34).

Recently, IL-17 family cytokines, particularly IL-17 and IL-21, have been implicated in Tfh cognate helper function and the subsequent development of GC and plasma cells (3941). IL-21 impacts both CD4 T cell and B cell responses following immunization. In an autocrine feedback loop, Tfh cells produce IL-21 and also express the IL-21 receptor, which drives expression of CXCR5 and responsiveness to CXCL13 (42). In addition, IL-21 was shown to also promote B cell activation, Ab production, and plasma cell differentiation (40). Although it is true that IL-17 production results from inflammation (IL-6 in particular) and IL-17 has been shown to be involved in induction of autoimmunity (43), its critical role in the protection from infection is just beginning to be elucidated. IL-17 production can recruit neutrophils to infection sites (44) and Th17 effectors can enhance Th1 responses. Importantly, Th17 can also recruit Th1 effectors to these sites of infection (30), leading to a more robust antibacterial response. Mice that lack IL-17 expression also exhibit significantly reduced CD4 T cell-dependent Ab production (45), demonstrating the importance of this cytokine in humoral responses. In addition, Th17 effectors can produce IL-21, which is also important for generation of Ab to influenza as shown in our recent publication (46). Thus, much like IFN-γ, IL-17 can be involved in both autoimmune responses and responses to infection and vaccination.

IL-17 produced by responding CD4 T cells drives the enhanced frequency and duration of GC development by modulating the effects of chemokines, especially CXCL12, which is involved in B cell migration and retention (47). Although Nurieva et al. (41) demonstrated that Tfh do not absolutely require TGF-β or RORγt and, thus, IL-17 for their differentiation to functional helper cells, this does not mean that IL-17-producing CD4 helper T cell subsets cannot also provide B cell help. As our results in this study demonstrate, the Tfh subset is likely to be quite heterogeneous and it may actually describe a functional subset rather than a specific differentiated subset. This has been elegantly demonstrated in a recent study showing that the immune response to a successful vaccination is very broad, complex, and highly integrated (48). This report showed that following immunization, a complex innate immune response is initiated, resulting in a variety of Th cytokine-producing subsets, including Th1 and Th2. These Th subsets exhibit an array of protective functions, including cognate help for B cells and induction of robust Ab production. Importantly, our studies demonstrate that by using inflammatory adjuvants, we can drive the differentiation of naive CD4 T cells from aged animals into potent helper T cells and generate a robust humoral response. We suggest that by using inflammatory adjuvants, we have broadened the response of the Ag-specific CD4 T cells and, thus, have enhanced their ability to function in vivo. Most notably, by enhancing production of IL-4, IL-17, and IL-21, our immunization protocol with PI cytokines has enhanced the differentiation of follicular helper T cells, even from aged naive CD4 T cells. Ultimately, this could result in enhanced efficacy of vaccinations for the elderly.

Footnotes

1This work was supported by National Institutes of Health Grants AG21054, AG02160 and AG028878 and by funding from the Kirby Foundation and Trudeau Institute.

6Abbreviations used in this paper: GC, germinal cell; PI, proinflammatory; Tpi, T cell effectors generated with PI cytokines; Tfh, T follicular helper; SHM, somatic hypermutation; NP, 4-hydroxy-3-nitrophenyl acetyl; PCC, pigeon cytochrome c; poly(I:C), polyriboinosinic-polyribocytidylic acid; Tg, transgenic; PNA, peanut agglutinin.

Disclosures

The authors have no financial conflict of interest.

References

1. Goidl EA, Innes JB, Weksler ME. Immunological studies of aging. II. Loss of IgG and high avidity plaque-forming cells and increased suppressor cell activity in aging mice. J. Exp. Med. 1976;144:1037–1048. [PMC free article] [PubMed]
2. Kosco MH, Burton GF, Kapasi ZF, Szakal AK, Tew JG. Antibody-forming cell induction during an early phase of germinal centre development and its delay with ageing. Immunology. 1989;68:312–318. [PubMed]
3. Szakal AK, Taylor JK, Smith JP, Kosco MH, Burton GF, Tew JJ. Kinetics of germinal center development in lymph nodes of young and aging immune mice. Anat. Rec. 1990;227:475–485. [PubMed]
4. Burns EA, Lum LG, L’Hommedieu G, Goodwin JS. Specific humoral immunity in the elderly: in vivo and in vitro response to vaccination. J. Gerontol. 1993;48:B231–B236. [PubMed]
5. Cook JM, Gualde N, Hessel L, Mounier M, Michel JP, Denis F, Ratinaud MH. Alterations in the human immune response to the hepatitis B vaccine among the elderly. Cell. Immunol. 1987;109:89–96. [PubMed]
6. Musher DM, Chapman AJ, Goree A, Jonsson S, Briles D, Baughn RE. Natural and vaccine-related immunity to Streptococcus pneumoniae. J. Infect. Dis. 1986;154:245–256. [PubMed]
7. Phair J, Kauffman A, Bjornson A, Adams L, Linnemann C. Failure to respond to influenza vaccine in the aged: correlation with B-cell number and function. J. Lab. Clin. Med. 1978;92:822–828. [PubMed]
8. Breitfeld D, Ohl L, Kremmer E, Ellwart J, Sallusto F, Lipp M, Forster R. Follicular B helper T cells express CXC chemokine receptor 5, localize to B cell follicles, and support immunoglobulin production. J. Exp. Med. 2000;192:1545–1552. [PMC free article] [PubMed]
9. Mackay CR. Follicular homing T helper (Th) cells and the Th1/Th2 paradigm. J. Exp. Med. 2000;192:F31–F34. [PMC free article] [PubMed]
10. Schaerli P, Willimann K, Lang AB, Lipp M, Loetscher P, Moser B. CXC chemokine receptor 5 expression defines follicular homing T cells with B cell helper function. J. Exp. Med. 2000;192:1553–1562. [PMC free article] [PubMed]
11. King C, Tangye SG, Mackay CR. T follicular helper (TFH) cells in normal and dysregulated immune responses. Annu. Rev. Immunol. 2008;26:741–766. [PubMed]
12. Miller C, Kelsoe G. Ig VH hypermutation is absent in the germinal centers of aged mice. J. Immunol. 1995;155:3377–3384. [PubMed]
13. Nicoletti C, Cerny J. The repertoire diversity and magnitude of antibody responses to bacterial antigens in aged mice: I. Age-associated changes in antibody responses differ according to the mouse strain. Cell. Immunol. 1991;133:72–83. [PubMed]
14. Nicoletti C, Yang X, Cerny J. Repertoire diversity of antibody response to bacterial antigens in aged mice: III. Phosphorylcholine antibody from young and aged mice differ in structure and protective activity against infection with Streptococcus pneumoniae. J. Immunol. 1993;150:543–549. [PubMed]
15. Zheng B, Han S, Takahashi Y, Kelsoe G. Immunosenescence and germinal center reaction. Immunol. Rev. 1997;160:63–77. [PubMed]
16. Eaton SM, Burns EM, Kusser K, Randall TD, Haynes L. Age-related defects in CD4 T cell cognate helper function lead to reductions in humoral responses. J. Exp. Med. 2004;200:1613–1622. [PMC free article] [PubMed]
17. Yang Y, Wilson JM. CD40 ligand-dependent T cell activation: requirement of B7-CD28 signaling through CD40. Science. 1996;273:1862–1864. [PubMed]
18. Pape KA, Khortus A, Mondino A, Jenkins MK. Inflammatory cytokines enhance the in vivo clonal expansion and differentiation of antigen-activated CD4+ T cells. J. Immunol. 1997;159:591–598. [PubMed]
19. Curtsinger JM, Schmidt CS, Mondino A, Lins DC, Kedl RM, Jenkins MK, Mescher MF. Inflammatory cytokines provide a third signal for activation of naive CD4+ and CD8+ T cells. J. Immunol. 1999;162:3256–3262. [PubMed]
20. O’Neill LA. How Toll-like receptors signal: what we know and what we don’t know. Curr. Opin. Immunol. 2006;18:3–9. [PubMed]
21. Vella AT, Mitchell T, Groth B, Linsley PS, Green JM, Thompson CB, Kappler JW, Marrack P. CD28 engagement and proinflammatory cytokines contribute to T cell expansion and long-term survival in vivo. J. Immunol. 1997;158:4714–4720. [PubMed]
22. Houssiau FA, Coulie PG, Olive D, Van Snick J. Synergistic activation of human T cells by interleukin 1 and interleukin 6. Eur. J. Immunol. 1988;18:653–656. [PubMed]
23. Nakae S, Asano M, Horai R, Sakaguchi N, Iwakura Y. IL-1 enhances T cell-dependent antibody production through induction of CD40 ligand and OX40 on T cells. J. Immunol. 2001;167:90–97. [PubMed]
24. Reed SG, Pihl DL, Conlon PJ, Grabstein KH. IL-1 as adjuvant: role of T cells in the augmentation of specific antibody production by recombinant human IL-1α J. Immunol. 1989;142:3129–3133. [PubMed]
25. Staruch MJ, Wood DD. The adjuvanticity of interleukin 1 in vivo. J. Immunol. 1983;130:2191–2194. [PubMed]
26. Kaye J, Hsu M-L, Sauron M-E, Jameson SC, Gascoigne NRJ, Hedrick SM. Selective development of CD4+ T cells in transgenic mice expressing a class II MHC-restricted antigen receptor. Nature. 1989;341:746–749. [PubMed]
27. Dubey C, Croft M, Swain SL. Costimulatory requirements of naive CD4+ T cells: ICAM-1 or B7-1 can costimulate naive CD4 T cell activation but both are required for optimum response. J. Immunol. 1995;155:45–57. [PubMed]
28. Lalor PA, Nossal GJ, Sanderson RD, McHeyzer-Williams MG. Functional and molecular characterization of single, (4-hydroxy-3- nitrophenyl)acetyl (NP)-specific, IgG1+ B cells from antibody-secreting and memory B cell pathways in the C57BL/6 immune response to NP. Eur. J. Immunol. 1992;22:3001–3011. [PubMed]
29. Jacob J, Przylepa J, Miller C, Kelsoe G. In situ studies of the primary immune response to (4-hydroxy-3-nitrophenyl)acetyl: III. The kinetics of V region mutation and selection in germinal center B cells. J. Exp. Med. 1993;178:1293–1307. [PMC free article] [PubMed]
30. Khader SA, Bell GK, Pearl JE, Fountain JJ, Rangel-Moreno J, Cilley GE, Shen F, Eaton SM, Gaffen SL, Swain SL, et al. IL-23 and IL-17 in the establishment of protective pulmonary CD4+ T cell responses after vaccination and during Mycobacterium tuberculosis challenge. Nat. Immunol. 2007;8:369–377. [PubMed]
31. Haynes L, Eaton SM, Burns EM, Rincon M, Swain SL. Inflammatory cytokines overcome age-related defects in CD4 T cell responses in vivo. J. Immunol. 2004;172:5194–5199. [PubMed]
32. Goodwin K, Viboud C, Simonsen L. Antibody response to influenza vaccination in the elderly: a quantitative review. Vaccine. 2006;24:1159–1169. [PubMed]
33. Kool M, Soullie T, van Nimwegen M, Willart MA, Muskens F, Jung S, Hoogsteden HC, Hammad H, Lambrecht BN. Alum adjuvant boosts adaptive immunity by inducing uric acid and activating inflammatory dendritic cells. J. Exp. Med. 2008;205:869–882. [PMC free article] [PubMed]
34. Haynes L, Linton P-J, Eaton SM, Tonkonogy SL, Swain SL. IL-2, but not other common γ chain (γc)-binding cytokines, can reverse the defect in generation of CD4 effector T cells from naive T cells of aged mice. J. Exp. Med. 1999;190:1013–1023. [PMC free article] [PubMed]
35. Maletto BA, Ropolo AS, Liscovsky MV, Alignani DO, Glocker M, Pistoresi-Palencia MC. CpG oligodeoxynucleotides functions as an effective adjuvant in aged BALB/c mice. Clin. Immunol. 2005;117:251–261. [PubMed]
36. Sen G, Chen Q, Snapper CM. Immunization of aged mice with a pneumococcal conjugate vaccine combined with an unmethylated CpG-containing oligodeoxynucleotide restores defective immunoglobulin G antipolysaccharide responses and specific CD4+-T-cell priming to young adult levels. Infect. Immun. 2006;74:2177–2186. [PMC free article] [PubMed]
37. Reis e Sousa C. Toll-like receptors and dendritic cells: for whom the bug tolls. Semin. Immunol. 2004;16:27–34. [PubMed]
38. Krieg AM, Vollmer J. Toll-like receptors 7, 8, and 9: linking innate immunity to autoimmunity. Immunol. Rev. 2007;220:251–269. [PubMed]
39. Hsu HC, Yang P, Wang J, Wu Q, Myers R, Chen J, Yi J, Guentert T, Tousson A, Stanus AL, et al. Interleukin 17-producing T helper cells and interleukin 17 orchestrate autoreactive germinal center development in autoimmune BXD2 mice. Nat. Immunol. 2008;9:166–175. [PubMed]
40. Kuchen S, Robbins R, Sims GP, Sheng C, Phillips TM, Lipsky PE, Ettinger R. Essential role of IL-21 in B cell activation, expansion, and plasma cell generation during CD4+ T cell-B cell collaboration. J. Immunol. 2007;179:5886–5896. [PubMed]
41. Nurieva RI, Chung Y, Hwang D, Yang XO, Kang HS, Ma L, Wang YH, Watowich SS, Jetten AM, Tian Q, Dong C. Generation of T follicular helper cells is mediated by interleukin-21 but independent of T helper 1, 2, or 17 cell lineages. Immunity. 2008;29:138–149. [PMC free article] [PubMed]
42. Vogelzang A, McGuire HM, Yu D, Sprent J, Mackay CR, King C. A fundamental role for interleukin-21 in the generation of T follicular helper cells. Immunity. 2008;29:127–137. [PubMed]
43. Weaver CT, Harrington LE, Mangan PR, Gavrieli M, Murphy KM. Th17: an effector CD4 T cell lineage with regulatory T cell ties. Immunity. 2006;24:677–688. [PubMed]
44. Moseley TA, Haudenschild DR, Rose L, Reddi AH. Interleukin-17 family and IL-17 receptors. Cytokine Growth Factor Rev. 2003;14:155–174. [PubMed]
45. Nakae S, Komiyama Y, Nambu A, Sudo K, Iwase M, Homma I, Sekikawa K, Asano M, Iwakura Y. Antigen-specific T cell sensitization is impaired in IL-17-deficient mice, causing suppression of allergic cellular and humoral responses. Immunity. 2002;17:375–387. [PubMed]
46. Dienz O, Eaton SM, Bond JP, Neveu W, Moquin D, Noubade R, Briso EM, Charland C, Leonard WJ, Cilberto G, et al. The induction of antibody production by IL-6 is indirectly mediated by IL-21 produced by CD4 T cells. J. Exp. Med. 2009;206:69–78. [PMC free article] [PubMed]
47. Allen CD, Ansel KM, Low C, Lesley R, Tamamura H, Fujii N, Cyster JG. Germinal center dark and light zone organization is mediated by CXCR4 and CXCR5. Nat. Immunol. 2004;5:943–952. [PubMed]
48. Gaucher D, Therrien R, Kettaf N, Angermann BR, Boucher G, Filali-Mouhim A, Moser JM, Mehta RS, Drake DR, III, Castro E, et al. Yellow fever vaccine induces integrated multilineage and polyfunctional immune responses. J. Exp. Med. 2008;205:3119–3131. [PMC free article] [PubMed]