PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Cancer. Author manuscript; available in PMC 2012 March 1.
Published in final edited form as:
Published online 2010 October 13. doi:  10.1002/cncr.25511
PMCID: PMC3023831
NIHMSID: NIHMS215420
A higher degree of methylation of the HPV 16 E6 gene is associated with a lower likelihood of being diagnosed with cervical intraepithelial neoplasia
Chandrika J. Piyathilake, PhD,1 Maurizio Macaluso, MD,2 Ronald D. Alvarez, MD,3 Min Chen, MD,1 Suguna Badiga, MSc,1 Jeffrey C Edberg, PhD,4 Edward E Partridge, MD,5 and Gary L Johanning, PhD6
1 Department of Nutrition Sciences, University of Alabama at Birmingham, Birmingham, Alabama
2 Department of Epidemiology, University of Alabama at Birmingham, Birmingham, Alabama
3 Department of Obstetrics & Gynecology, University of Alabama at Birmingham, Birmingham, Alabama
4 Department of Medicine, University of Alabama at Birmingham, Birmingham, Alabama
5 Comprehensive Cancer Center of the University of Alabama at Birmingham, Birmingham, Alabama
6 Department of Veterinary Sciences of the The University of Texas MD Anderson Cancer Center
Correspondence to: Chandrika J Piyathilake, Department of Nutrition Sciences, University of Alabama at Birmingham (UAB), 1675 University Blvd, Webb 326, Birmingham, AL 35294. Phone: 205-975-5398 Fax: 205-934-7049 ; piyathic/at/uab.edu
Background
Even though HPV 16 is the most common HPV genotype associated with cancerous lesions of the cervix, only a fraction of HPV 16 infected women are diagnosed with pre-cancerous lesions of the cervix. Therefore, molecular changes in HPV 16 rather than infections per se may serve as better screening or diagnostic biomarkers. The purpose of the study was to evaluate whether methylation status of specific regions of the HPV E6 gene promoter and enhancer is independently associated with the likelihood of being diagnosed with higher grades of cervical intraepithelial neoplasia (CIN 2+).
Methods
The study included 75 HPV 16 positive women diagnosed with CIN 2+ or ≤ CIN 1. Pyrosequencing technology was applied to quantify methylation at 6 cytosine guanine dinucleotide (CpG) sites of the HPV 16 E6 promoter and enhancer. CIN 2+ (yes/no) was the dependent variable in logistic regression models that specified the degree of methylation of the CpG sites of the HPV 16 E6 gene as the primary independent predictors. All models were adjusted for demographic, lifestyle, known risk factors for cervical cancer and circulating concentrations of “cancer-protective” micronutrients.
Results
The odds of being diagnosed with CIN 2+ was 79% lower when the degree of methylation of the HPV 16 enhancer and promoter sites were ≥9.5% (OR= 0.21; 95% CI, 0.06–0.79; P=0.02).
Conclusions
Results suggested that CpG methylation is independently involved in the biology of HPV-16 as well as in the development of higher grades of CIN.
Keywords: HPV 16, methylation, cervical, neoplasia
The oncogenic human papillomavirus (HPV) type 16 is the most frequent causative agent found in higher grades of cervical intraepithelial neoplasias (CIN 2+) and invasive cervical cancer (ICC) world-wide. However, even this most carcinogenic HPV type is a necessary but insufficient cause of CIN or ICC. One of the main mechanisms by which HPV 16 exerts carcinogenic effects is through the expression of two viral early genes, E6 and E7 (1). E6 protein binds to and promotes degradation of the tumor suppressor protein, p53, while E7 protein complexes and inactivates the Rb protein. Cell cycle regulation is disrupted by these two events. Therefore, factors that regulate the expression of E6 and E7 are likely to influence transformation of HPV 16 infections to CIN or ICC.
It has been known for many years that DNA methylation is a major epigenetic mechanism of controlling gene expression in mammalian cells (2, 3). There is increasing interest in understating the relationships between viral DNA methylation and viral gene expression, viral life cycle, its persistence, replicative behavior and immune responses, but most studies have focused on adenoviruses (4). In general, there is a strong trend of an increasing fraction of HPV 16 positive diagnoses with increasing severity of the CIN grade than it is for detecting any high risk (HR) or carcinogenic HPV genotype (5). An HPV 16 positive test result alone however, has not been able to categorize cervical biopsy specimens into more biologically and clinically meaningful categories of CIN (6). Results from our study cohorts demonstrate that only ~40% of women tested positive for HPV 16 in exfoliated cervical cells have underlying lesions of CIN 2+ (7). Recent studies have shown that specific regions of the HPV 16 genome targeted for methylation may have important roles in the viral life cycle and HPV 16 associated carcinogenesis suggesting that methylation status of the virus may have potential as a marker of lesion identification or progression (8, 9).
The purpose of the current study was to evaluate whether methylation status of specific regions of the HPV E6 gene promoter and enhancer is independently associated with the likelihood of being diagnosed with CIN 2+, after controlling for known risk factors for cervical cancer.
Patient population
The present analysis is based on base line samples from 75 HPV 16 positive women who were enrolled in an ongoing prospective follow-up study funded by the National Cancer Institute (R01 CA105448, Prognostic Significance of DNA & Histone Methylation) which is expected to be completed before the end of 2010. The study has been described in a previous publication (10). All women were diagnosed with abnormal cervical cells in clinics of the Health Departments in Jefferson County and surrounding counties in Alabama and were referred to the University of Alabama at Birmingham (UAB) for further examination by colposcopy and biopsy. Women were 19–50 years old, had no history of cervical cancer or other cancer of the lower genital tract, no history of hysterectomy or destructive therapy of the cervix; were not pregnant, and were not using antifolate medications such as methotrexate, sulfasalazine, or phenytoin. Of these 75 women, 30 women were diagnosed with CIN 2+ (cases, including CIN 2, CIN 3 or carcinoma in situ) and 45 women were diagnosed with ≤ CIN 1 (non-cases, including normal cervical epithelium, HPV cytopathic effect, reactive nuclear enlargement or CIN 1). Both cases and non-cases tested positive for HPV 16 in exfoliated cervical cells. All women included in this analysis participated in an interview that assessed socio-demographic variables and lifestyle risk factors (questionnaire pre-tested in a study conducted by the NCI, namely, the Atypical Squamous Cells of Undetermined Significance-Low-Grade Squamous Intraepithelial Lesion (ASCUS-LSIL) Triage Study (ALTS). Healthy eating index (HEI) was derived from dietary intake data gathered by the Block’s food frequency questionnaire, version 98.2. Height, weight and waist circumference (WC) measurements were obtained using standard protocols. Pelvic examinations and collection of cervical cells and biopsies were carried out following the protocols of the colposcopy clinic. Fasting blood samples were collected from all women. The study protocol and procedures were approved by the UAB Institutional Review Board.
Laboratory Methods
Exfoliated cervical cells collected from the transformation zone with a cervical brush and immediately rinsed in 10 ml of phosphate buffered saline (PBS) and fasting blood samples collected in EDTA containing blood collection tubes which were kept cold after collected were transported to the laboratory on ice within two hours of collection. In the laboratory, cervical cell suspensions were centrifuged and the resulting pellets were re-suspended in fresh PBS. Cervical cell aliquots used for HPV genotyping were stored in PreservCyt Solution at −20°C while cervical cell aliquots used for methylation were stored at −80°C. Blood samples were processed to isolate plasma, buffy coat and red blood cells. All components were stored at −80°C including the buffy coat used to extract DNA for methylation analysis. DNA was extracted from cervical cells using a standard phenol-chloroform extraction method. As described below, methylation analysis of HPV 16 promoter was investigated using a pyrosequencing-based methylation analysis.
Bisulfite-pyrosequencing HPV 16 analysis
Bisulfite treatment of 1 μg of DNA extracted from each HPV 16 positive sample was completed using the EZ DNA methylation kit (Zymo Research, CA) and the converted DNA was eluted with 30 μTE buffer. The bisulfite-modified DNA was stored at −80°C until use. Methylation analysis of the E6 enhancer (position 7862) and promoter sites (positions 31, 37, 43, 52 and 58) of HPV 16 (GeneBank accession no: NC_001526) was investigated using a pyrosequencing-based methylation analysis. A reaction volume of 25 μl was amplified by PCR. Each reaction mixture contained 5 μl of bisulfite-modified DNA, 250 μM dNTP, 0.25 μM of the forward primer (11) (5′-TTGTAAAATTGTATATGGGTGTG-3′), 0.25 μM of the reverse-biotinylated primer1 (5′-BIO-AAATCCTAAAACATTACAATTCTC-3′), 0.25 mM MgCl2 and 0.025 units of AmpliTaq Gold DNA polymerase (Applied Biosystems, Foster City, CA). PCR was carried out in a GeneAmp PCR system 9700 thermal cycler (Applied Biosystems). PCR cycling conditions were 1 cycle of 95°C for 7 min, 48 cycles of 95°C for 45s, 50°C for 50s, and 72°C for 45s, and a final extension of 1 cycle of 72°C for 7 min. The biotinylated PCR product was purified and made single-stranded to act as template, using the Pyrosequencing Vacuum PrepTool (Biotage, Inc. Charlottesville, VA). In brief, 10 μl of each biotinylated PCR product was immobilized on streptavidin-coated Sepharose HP beads (Amersham Biosciences, Piscataway, NJ) and the non-biotinylated strand was removed using 0.2 M NaOH. The biotinylated single stranded product was annealed to the pyrosequencing primer: 5′-AATTTATGTATAAAATTAAGGG -3′ for positions 31, 37, 43, 52 and 58, or 5- TGTATATGGGTGTGTGTAAAT -3′ for position 7862 (0.4μM final primer concentration). Sequencing was carried out using an automatically generated nucleotide dispensation order for sequences to analyze corresponding to each reaction. The pyrograms were analyzed using allele quantification (AQ) mode to determine the proportion of C/T, and hence methylated and unmethylated cytosines at the targeted position(s).
Determination of circulating concentrations of micronutrients
Circulating concentrations of micronutrients were determined using protocols previously established and validated in the Nutrition Sciences Laboratory at the University of Alabama at Birmingham (12). Briefly, plasma folate was measured using the L. casei microbiological assay, plasma vitamin B-12 using a competitive radio-binding assay (SimulTRAC-SNB, MP Biomedicals), vitamins A, E, and C by high performance liquid chromatography [HPLC], and total carotene by spectrophotometry. All samples were stored at −80°C until micronutrient assays were completed within 2–3 months of collection.
Statistical analysis
We used descriptive statistics to characterize the 30 women diagnosed with CIN 2+ (cases) and 45 women diagnosed with ≤ CIN 1 (non-cases). Differences in proportions of all variables were tested using a two-sided χ2 test.
The degree of methylation was evaluated in 5 positions (31, 37, 43, 52 and 58) of the E6 promoter and one position (7862) of the enhancer. Association between disease status and methylation was evaluated by combining all methylation sites and methylation sites of the promoter and enhancer separately. Unconditional logistic regression models specified a binary indicator of CIN 2+ diagnosis (yes/no) as the dependent variable. We examined the degree of HPV 16 methylation as a potential biomarker for CIN status after adjusting for age (median), race (African American vs. Caucasian American), education (less than high school education vs. high school education or higher), smoking status (ever vs. never smoker), oral/hormone contraceptive use (ever vs. never), HEI (scale of 0–100 categorized into ≥ 53 vs. < 53 ), WC (> 88 cm vs. ≤ 88 cm) and all circulating concentrations of micronutrients (median) as categorical variables. We categorized the percent HPV 16 methylation based on the highest tertile for promoter and enhancer sites combined (≥ 9.5 vs. < 9.5), for only promoter sites (≥ 10.6 vs. < 10.6) and only the enhancer site (≥ 5.6 vs. < 5.6). Folate and vitamin B12 levels were not included in the three models presented, as they were considered a priori determinants of methylation, and would have been inappropriate to include such distal determinants of the outcome in the same regression model. Analyses including folate and vitamin B12 levels were presented in a previous publication (10) and showed significant protective effects of folate and vitamin B12 on CIN 2+ risk. We evaluated the strength and precision of each association by estimating the odds ratio (OR) and its 95% confidence interval (CI), and its statistical significance using Wald’s chi-square test of the null hypothesis that the OR=1.
Differences in demographic and lifestyle factors and circulating micronutrient status by HPV 16 methylation status were determined among non-cases. Exclusion of the cases was necessary to avoid the possibility of reverse causation (i.e., CIN 2+ status influencing methylation). All statistical analyses were conducted using SASR Version 9.1.3 (SAS Institute, Cary, NC).
Forty percent of the women infected with HPV 16 had higher grades of cervical intraepithelial neoplasia (CIN 2+ or cases) while 60% were free from higher grades of CIN (≤ CIN 1 or non cases). Cases and non-cases were not significantly different with regard to demographic (age, race, education, WC), lifestyle factors (ever vs. never smoking status, HEI, lifetime number of sexual partners and oral/hormone contraceptive use) and circulating concentrations of micronutrients (vitamins C, E, A and total carotene) (Table 1). Women with a higher degree of methylation of the HPV16 enhancer and promoter sites combined were more likely to be a non-case compared to women with lower methylation of those sites (P=0.045). Proportions of cases and non-cases were not significantly different based on the highest tertiles of methylation of either HPV 16 enhancer or promoter sites separately.
Table 1
Table 1
Demographic, lifestyle factors, circulating concentrations of micronutrients and HPV 16 CpG methylation by case status (N=75)
In the logistic regression analyses, the odds of being diagnosed with CIN 2+ was 79% lower when the degree of methylation of HPV 16 enhancer and promoter sites was ≥9.5% (OR= 0.21; 95% CI, 0.06–0.79; P=0.02). A similar protective trend of lower likelihood of being diagnosed with CIN 2+ was observed with a higher degree of methylation of HPV 16 promoter or enhancer sites separately, although those were not statistically significant (OR= 0.56, 95% CI, 0.18–1.73; P=0.31 and OR = 0.33, 95% CI, 0.09– 1.17; P=0.08 respectively) (Table 2).
Table 2
Table 2
Association between HPV16 CpG methylation and risk of being diagnosed with CIN 2+
Most of the life style factors evaluated in this study including folate and vitamin B12 were not significantly associated with the degree of HPV 16 methylation except for the HEI; i.e., 56% of women with higher HEI had a higher degree of methylation in the HPV 16 enhancer site compared to 25% of women with lower HEI having a higher degree of methylation (P = 0.04).
The current standard of care for the early detection of cervical cancer based on Pap smear has significant limitations, false negative results being the most important. In view of this, testing for HR-HPVs is increasingly used in the screening or diagnosis of cervical cancer. However, because HR-HPV infections are highly prevalent among sexually active women and most HPV infections, including HPV 16, do not always lead to cervical cancer, this approach also has limitations. Therefore, it is worthwhile to investigate molecular changes in HPVs rather than infections per se as screening or diagnostic biomarkers of CIN or ICC.
CpG methylation within the HPV genome has been reported previously, but documenting its prevalence, biological or clinical significance has begun only recently. The study of Badal et al (8) indicated that methylation of the long control region (LCR) and the E6 gene decreases with disease progression, but they did not show the functional effect of methylation-mediated inhibition of E6 gene expression. The study of Hublarova et al addressed this limitation by demonstrating that decreased methylation frequency correlates with the progression of CIN and its association with E6 gene expression by quantitative analysis of E6 mRNA levels (13). In contrast to the two studies cited above, methylation of the E6 LCR has also been shown to increase in cervical cancer. Bhattacharjee and Sengupta (14) reported that LCR-E6 methylation was higher in normal subjects than in cervical cancer samples, but this difference was not significant. Kalantari et al. (9) found that while patients with asymptomatic infections generally had lower methylation of the HPV 16 promoter/enhancer region than patients with cervical carcinoma, low- and high-grade CIN lesions showed the lowest methylation frequency of all the specimens tested. In another study, although premalignant cervical cells from clinical samples showed a pattern consistent with slight methylation of the LCR, the predominant methylation in these samples occurred in the HPV 16 late genes and the E5 gene (15). Studies showing associations between HPV 16 E6 methylation and CIN risk have thus been inconclusive. None of these studies, however, adjusted their results for demographic, lifestyle or risk factors for cervical cancer. Our study which adjusted for these factors demonstrate that a higher degree of methylation in CpG positions of both the promoter and enhancer are independently associated with reduced likelihood of being diagnosed with CIN 2+, but higher methylation status of the promoter and enhancer combined was associated with the most significant reduced risk of CIN 2+. The CpG residue at position 7862 is nearly always unmethylated in CIN and ICC lesions. This CpG dinucleotide is critically positioned between two nucleosomes that make up the enhancer and promoter region of HPV 16 E6. The CpG 7862 residue is part of an E2 binding site that activates HPV 16 replication, and methylation at this site would displace E2 and block replication. Our results showing that CIN 2+ risk is decreased with higher methylation at either E6 enhancer position 7862 or E6 promoter sites, and is significantly decreased with higher methylation at both sites, is consistent with the idea that methylation at one or both sites may be blocking HPV 16 replication and thereby decreasing CIN risk. E2 binding sites span regions 7853–7872 (designated site 3) and 46–65 (designated site 1) (16). The former region encompasses the 7862 CpG site, while the latter region covers a portion of the five CpG sites in the E6 promoter that we analyzed in the current study. The cellular transcription factor CEF-2 has been reported to bind tightly to E2 site 3, whereas an unrelated transfection factor, CEF-1, binds tightly to E2 site 1 (16). When binding of CEF-1 to site 1 or CEF-2 to site 3 was blocked by mutating their respective binding sites, there was significantly reduced P97 promoter activity (16). We hypothesize that increased methylation at both site 1 and site 3 may also block binding of these two transcription factors, and thereby reduce HPV 16 E6 expression and mitigate CIN 2+ risk.
These results suggest that CpG methylation is involved in the biology of HPV-16 as well as in the development of higher grades of CIN. Therefore, evaluation of methylation in these CpG positions of HPV 16 genome is likely to be useful in identifying women with underlying higher grades of cervical lesions that need medical care. Prospective studies are needed to evaluate the usefulness of this biomarker for identifying HPV 16 positive women who may progress toward higher grades of CIN or for identifying recurrence of CIN after HPV 16 positive lesions are treated. The ability to evaluate methylation status in non-invasively obtained exfoliated cervical cells by using a simple to perform and reproducible pyrosequencing technology will enable repeated monitoring of methylation status in clinical settings.
Dietary or life style factors which may alter the methylation status of HPV 16 are virtually unknown. One carbon micronutrients such as folate and vitamin B12 which are involved in the generation of methyl groups for methylation reactions are more likely than other factors to have influence on DNA methylation. Our recent results from the same cohort of women (17) demonstrated a significant positive association between supraphysiologic concentrations of folate (> 19.8 ng/mL) and sufficient vitamin B12 (≥ 200.6 pg/mL) and global methylation status of host DNA. Because only 13% of women have this combination, the current study did not have adequate power to test the associations between these micronutrients and methylation status of HPV 16. Our results, however, showed that women with a higher overall HEI were significantly more likely to have higher methylation in the HPV 16 enhancer, suggesting that “cancer-protective” micronutrients are likely to have modifying effects on HPV 16 methylation. Future studies with larger sample sizes are needed to evaluate these associations in detail.
Limitations of the study include small sample size and the cross-sectional nature of the study. The sample size was not determined by design, as it was the product of testing for specific HPV types within a group of women who were eligible for inclusion in the parent study (abnormal pap smear or positive for high-risk HPVs). The limited study size is reflected by the relatively wide 95% confidence intervals of the measures of association, which indicate that the results are imprecise even when significance testing allows rejecting the null hypothesis of no association. Confirmation of the findings from this cross-sectional study using prospectively collected samples from the parent study will increase the scientific credibility of the significance of HPV 16 methylation in modifying the development of CIN 2+.
The limitations listed above are offset by considerable strengths. First, this study assessed cervical lesions by employing a rigorous pathology review protocol, used sensitive and reproducible techniques for testing for HPV and for evaluating the degree of methylation in specific regions of the HPV 16 promoter and enhancer and measured several cancer related micronutrients and other risk factors for CIN. To our knowledge, this is the first study to integrate the measurement of HPV 16 DNA methylation with a thorough assessment of potential determinants and confounders. Multiple regression analysis of the data simultaneously controlled life-style factors and micronutrients, thus disentangling the effect of micronutrient levels from the effect of other covariates. Despite the limited study size and the regression adjustment of multiple covariates, the association of HPV 16 DNA methylation with the prevalence of CIN2+ was statistically significant. In conclusion, the present study provides initial evidence that CpG methylation is involved in thebiology of HPV-16 as well as in the development of higher grades of CIN.
Acknowledgments
Authors acknowledge the excellent assistance from the following individuals: Assistance with sample collection: Drs. Nuzhat Siddiqui, Rodney P Rocconi, Jacob M Estes, Michael Numnum, James E Kendrick, Kristopher Kimball and Peter J Frederick Sample processing or laboratory assays: Nuzhat Siddiqui and Jorge Celediono, Connie Robinson Assistance with data analysis: David Helms
Supported by R01 CA105448 funded by the National Cancer Institute
1. Ishiji T. Molecular mechanism of carcinogenesis by human papillomavirus-16. J Dermatol. 2000;27:73–86. [PubMed]
2. Bernstein BE, Meissner A, Lander ES. The mammalian epigenome. Cell. 2007;128:669–681. [PubMed]
3. Egger G, Liang G, Aparicio A, et al. Epigenetics in human disease and prospects for epigenetic therapy. Nature. 2004;429:457–463. [PubMed]
4. Hoelzer K, Shackelton LA, Parrish CR. Presence and role of cytosine methylation in DNA viruses of animals. Nucleic Acids Res. 2008;36:2825–2837. [PMC free article] [PubMed]
5. Castle PE, Stoler MH, Solomon D, et al. The relationship of community biopsy-diagnosed cervical intraepithelial neoplasia grade 2 to the quality control pathology-reviewed diagnoses: an ALTS report. Am J Clin Pathol. 2007;127:805–815. [PubMed]
6. Galgano MT, Castle PE, Stoler MH, et al. Can HPV-16 genotyping provide a benchmark for cervical biopsy specimen interpretation? Am J Clin Pathol. 2008;130:65–70. [PubMed]
7. Piyathilake CJ, Macaluso M, Brill I, et al. Lower red blood cell folate enhances the HPV 16-associated risk of cervical intraepithelial neoplasia. Nutrition. 2007;23:203–210. [PubMed]
8. Badal V, Chuang LS, Tan EH, et al. CpG methylation of human papillomavirus type 16 DNA in cervical cancer cell lines and in clinical specimens: genomic hypomethylation correlates with carcinogenic progression. J Virol. 2003;77:6227–6234. [PMC free article] [PubMed]
9. Kalantari M, Calleja-Macias IE, Tewari D, et al. Conserved methylation patterns of human papillomavirus type 16 DNA in asymptomatic infection and cervical neoplasia. J Virol. 2004;78:12762–12772. [PMC free article] [PubMed]
10. Piyathilake CJ, Macaluso M, Alvarez RD, et al. Lower risk of cervical intraepithelial neoplasia in women with high plasma folate and sufficient vitamin B12 in the post-folic acid fortification era. Cancer Prev Res (Phila Pa) 2009;2:658–664. [PubMed]
11. Rajeevan MS, Swan DC, Duncana K, et al. Quantitation of site-specific HPV 16 DNA methylation by pyrosequencing. J Virol Methods. 2006;138:170–176. [PubMed]
12. Piyathilake CJ, Macaluso M, Hine RJ, et al. Local and systemic effects of cigarette smoking on folate and vitamin B12. Am J Clin Nutr. 1994;60:559–566. [PubMed]
13. Hublarova P, Hrstka R, Rotterova P, et al. Prediction of human papillomavirus 16 e6 gene expression and cervical intraepithelial neoplasia progression by methylation status. Int J Gynecol Cancer. 2009;19:321–325. [PubMed]
14. Bhattacharjee B, Sengupta S. CpG methylation of HPV 16 LCR at E2 binding site proximal to P97 is associated with cervical cancer in presence of intact E2. Virology. 2006;354:280–285. [PubMed]
15. Brandsma JL, Sun Y, Lizardi PM, et al. Distinct human papillomavirus type 16 methylomes in cervical cells at different stages of premalignancy. Virology. 2009;389:100–107. [PMC free article] [PubMed]
16. Lewis H, Webster K, Sanchez-Perez AM, et al. Cellular transcription factors regulate human papillomavirus type 16 gene expression by binding to a subset of the DNA sequences recognized by the viral E2 protein. J Gen Virol. 1999;80:2087–2096. [PubMed]
17. Piyathilake CJ, Macaluso M, Alvarez RD, et al. LINE-1 methylation in peripheral blood mononuclear cells and reduced prevalence of cervical intraepithelial neoplasia. (under review)